ID: 1195878624

View in Genome Browser
Species Human (GRCh38)
Location X:109569399-109569421
Sequence TTAAATAAGCATATAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 368}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195878622_1195878624 7 Left 1195878622 X:109569369-109569391 CCAGATGTATTAAAAATATATAA No data
Right 1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG 0: 1
1: 1
2: 3
3: 29
4: 368
1195878621_1195878624 13 Left 1195878621 X:109569363-109569385 CCTACTCCAGATGTATTAAAAAT 0: 1
1: 1
2: 3
3: 48
4: 501
Right 1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG 0: 1
1: 1
2: 3
3: 29
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195878624 Original CRISPR TTAAATAAGCATATAGAGGA TGG Intergenic
901347940 1:8563948-8563970 CTAATTAAGCATACAGAGGGGGG + Intronic
902096612 1:13950887-13950909 TTAAATAGGTATACAAAGGAAGG + Intergenic
902237484 1:15066894-15066916 ATAAATAAATATATAGAGAAAGG - Intronic
904388440 1:30162826-30162848 TTAAATGAGCAAATAGATGTGGG + Intergenic
906453463 1:45972682-45972704 TGAATTAAGCATGTAGATGATGG - Intronic
907535209 1:55146814-55146836 TTATATAAGCATAAATAGTATGG - Intronic
907798099 1:57737677-57737699 TTAAAAAAGCATCAAGGGGATGG - Intronic
908708388 1:66987627-66987649 TTTAATAAGCATATTCAGAATGG - Intronic
909735600 1:78957310-78957332 ATAATTAAGCATAGTGAGGAAGG + Intronic
912926309 1:113916229-113916251 TTCAATGAGCACATTGAGGATGG - Intergenic
915236015 1:154483178-154483200 TGAGATAAGCATAAATAGGAAGG - Exonic
915909645 1:159906178-159906200 TTAAAAAAAAAAATAGAGGATGG + Intergenic
916363520 1:163998030-163998052 TTAAAGAAGAATATATAGGCTGG + Intergenic
916449386 1:164905639-164905661 TTTAATAGATATATAGAGGAAGG - Intergenic
916729061 1:167550282-167550304 TTTAAAATGCATATAGAGGCGGG - Intronic
917231340 1:172841010-172841032 TTAAAAAAGAATATATAGGCTGG - Intergenic
917425887 1:174913270-174913292 AGAAATAAGCATGTAGAGGTCGG - Intronic
917762218 1:178174207-178174229 TAAATTAAGCATTTAGAGAAAGG - Intronic
918514758 1:185350813-185350835 TTAAATAACAATATAAAGGGAGG + Intergenic
918625944 1:186656128-186656150 TCACATAAGCATAAAGAGGAGGG - Intergenic
918708095 1:187693651-187693673 TTAAATAAGCATATAATGTTAGG - Intergenic
919133584 1:193481006-193481028 TATAATAAGCACATAGAAGAGGG + Intergenic
919404138 1:197155161-197155183 TCTAATAAGCATATAGAGACAGG + Exonic
919722454 1:200853085-200853107 ATAAATAAGTAAATAAAGGAGGG - Intronic
919844116 1:201630217-201630239 TTAAAAAAGTATCTAGAGGATGG + Intronic
920356903 1:205380495-205380517 TTAAATAAGCATTTTCAGGCTGG + Intergenic
921692564 1:218166434-218166456 TGAAATCAGCAGAGAGAGGAGGG + Intergenic
921781141 1:219165988-219166010 TTGAAGAAGTAAATAGAGGAGGG + Intergenic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923590506 1:235314222-235314244 TTAAATAAGCTGATAGAGTGAGG - Intronic
924050594 1:240076382-240076404 TGAAATCAGCATGTAGAGGCAGG + Intronic
924922450 1:248644983-248645005 TTAAATAGGCAGATAAAGGGGGG - Intergenic
1063398865 10:5721606-5721628 GTGAATAAGCAAATAGAGAAGGG + Intronic
1063808115 10:9671066-9671088 TCAAATAAGCATCTAGTGGTGGG + Intergenic
1064359474 10:14650580-14650602 TTAAATAAGTATCGAGAGGCCGG - Intronic
1066104255 10:32143103-32143125 CTAAATAAGGACACAGAGGAAGG - Intergenic
1066577287 10:36839936-36839958 TTAAACAATCCTATAGAGGTGGG - Intergenic
1066758513 10:38733505-38733527 CAAAATATGCATATATAGGAAGG + Intergenic
1066963140 10:42239252-42239274 CAAAATATGCATATATAGGAAGG - Intergenic
1067740700 10:48894158-48894180 CTGAATAGCCATATAGAGGATGG - Intronic
1068410612 10:56649362-56649384 GTAAATAAGGATTTAGAGAAAGG - Intergenic
1068659603 10:59610594-59610616 TAAACTAAACATATGGAGGATGG - Intergenic
1068659814 10:59612321-59612343 TAAACTAAGCATATGGAGGATGG + Intergenic
1068750507 10:60586453-60586475 TTAAATAAATATATAGTGGTGGG - Intronic
1068831181 10:61496834-61496856 TTAAATATACATATATATGAAGG + Intergenic
1068941337 10:62684142-62684164 TTTCATAGGCATATAGATGACGG - Intergenic
1069441855 10:68435748-68435770 TTAAATAAAAATATATAGGCGGG - Intronic
1070050667 10:72886578-72886600 ATAGATAAGTATATAAAGGAGGG - Exonic
1070701607 10:78605764-78605786 TTAAAAAAGCTTATAGAGTAAGG + Intergenic
1072870230 10:99111475-99111497 TTATATAAGGATATACAGCAGGG - Intronic
1074444064 10:113504060-113504082 TTTATTCAGCATTTAGAGGAAGG - Intergenic
1074784910 10:116830476-116830498 TTAAATATGCATATATGGGCTGG + Intergenic
1074828058 10:117228757-117228779 AAAAAAAAGCATGTAGAGGAGGG - Intergenic
1077786081 11:5384752-5384774 TAAAATAAGCAGATTGAGGATGG - Intronic
1077832882 11:5894458-5894480 TGAAATAAGCAGATTGAGGCAGG + Intronic
1078490605 11:11764412-11764434 TTAAATGAGGATATCCAGGAAGG - Intergenic
1079182161 11:18203603-18203625 TAAAATAAAACTATAGAGGAGGG + Intronic
1080353831 11:31417990-31418012 TCAACTAAGCATATAGAAGTAGG - Intronic
1080414823 11:32059775-32059797 TTAAATAAGTGTATAAATGAGGG - Intronic
1081078792 11:38712686-38712708 TATAATAAGCATACAGAAGAGGG + Intergenic
1082768932 11:57190726-57190748 CTAAATAGGCATATATAGGTTGG + Exonic
1083243619 11:61408598-61408620 TTATATAAGCATATAGGAGCAGG - Intronic
1083336587 11:61925335-61925357 TTAAATATCCATATAGAGCCGGG + Intergenic
1085700748 11:78743771-78743793 TTATACAAGCAGATAAAGGAAGG + Intronic
1086517919 11:87635353-87635375 TTAAATAAGAAAAGAGAGAAGGG + Intergenic
1086745429 11:90420638-90420660 TAAAATAAGCACATGGAGAATGG + Intergenic
1090641741 11:128735132-128735154 TTAAATAAGATTATAGATGTGGG + Intronic
1092099432 12:5871025-5871047 TTAAAAAAGCAACTTGAGGAAGG + Intronic
1092467479 12:8746191-8746213 TGAGATAAGGATATAGAGAATGG - Intronic
1093348301 12:18067547-18067569 TTAAAAAAGCATATAAAGATGGG + Intergenic
1095205120 12:39430808-39430830 TTAGATAAGGTCATAGAGGAAGG + Intronic
1095910568 12:47422409-47422431 AAAATTAAGCATAGAGAGGAAGG + Intergenic
1096473574 12:51894750-51894772 TTAAATAAGAAAACAGAGGCCGG - Intergenic
1096753295 12:53777203-53777225 CTAAATAAACATATAGAGTTTGG - Intergenic
1097292870 12:57933909-57933931 TTAAAGAAGTTTATAGAGCAGGG - Intergenic
1097575762 12:61390498-61390520 TTAAATATGCATAAATAGGCAGG + Intergenic
1098077814 12:66751678-66751700 TTAAATAAGAATATAGATTTAGG + Intronic
1098096109 12:66957956-66957978 TTGAATAAGCAAATAAATGAGGG - Intergenic
1098779316 12:74664986-74665008 TGAAAAAAGCTTATAGAAGAAGG - Intergenic
1098808837 12:75057903-75057925 CAAAATAAAAATATAGAGGAAGG - Intronic
1099092600 12:78332228-78332250 TTAAAGAGGCATACAGATGAAGG + Intergenic
1099131335 12:78836001-78836023 CAAAATAAGCAAATAGAGAATGG + Intergenic
1099312975 12:81050679-81050701 TTAAAAAAGCATAGAGCGGCCGG - Intronic
1099547326 12:84000902-84000924 TTCAATAAACATATATATGAAGG + Intergenic
1100533172 12:95479238-95479260 ATAAATAGGCATGGAGAGGAAGG + Intronic
1101379294 12:104200402-104200424 ATAAATACCCATATACAGGAAGG - Intergenic
1101469806 12:104986057-104986079 ATAAAAAAGGATAAAGAGGAGGG + Intergenic
1101604469 12:106237552-106237574 TTGAATAGGCATAAAGAGGCTGG - Intergenic
1102403718 12:112653846-112653868 TTAAAAAAGCTTATAGAATAAGG - Intronic
1102564748 12:113788869-113788891 TAAAATAAGAATATAGACAAAGG - Intergenic
1102740894 12:115206742-115206764 TTGAAAAAACATATAGAGGCCGG - Intergenic
1103068900 12:117924172-117924194 TTAAAAAAGCAAATATAGGCCGG - Intronic
1103675853 12:122655133-122655155 GCAAATCAGCATGTAGAGGATGG - Intergenic
1107041344 13:35951217-35951239 TTAAATAAGCATTTGTTGGATGG + Intronic
1107154332 13:37148641-37148663 TCAAATAAGGATAGAGAGGGTGG + Intergenic
1107705184 13:43095777-43095799 TAAAATAAGGATAGAGAGGAGGG + Intronic
1108136596 13:47369663-47369685 ATAAATATGCATGTACAGGAAGG + Intergenic
1108729151 13:53215103-53215125 TACCATAACCATATAGAGGAGGG - Intergenic
1108845059 13:54668167-54668189 ATAAATAAGAATAGTGAGGAAGG - Intergenic
1108923990 13:55715009-55715031 GTAAATAAGCAAATTGAAGATGG - Intergenic
1109657434 13:65412160-65412182 TTACAAAAACATATAGAGGAGGG - Intergenic
1110018399 13:70438086-70438108 TTTAAAAAGAAAATAGAGGATGG + Intergenic
1110409238 13:75185638-75185660 TTAGATAAGAATCTTGAGGAAGG - Intergenic
1110574705 13:77042144-77042166 TCAAATAAGCTTATTGAGGTTGG + Intergenic
1110766513 13:79285297-79285319 ATAATTAAGCTTAGAGAGGAAGG + Intergenic
1110904419 13:80867540-80867562 TTGAATCAGCAAATAAAGGATGG + Intergenic
1112591914 13:100771371-100771393 TTAAAAAAATATATAAAGGAAGG - Intergenic
1112626748 13:101113617-101113639 ATAGATAAGCATATACAGTAAGG + Intronic
1112939481 13:104844042-104844064 AGAAATAAGCTTAGAGAGGAAGG - Intergenic
1114769962 14:25417984-25418006 ATAAATAAGGATATATAGTATGG - Intergenic
1114880592 14:26780632-26780654 TTAATTAAGGATCTTGAGGAGGG - Intergenic
1115594242 14:34893884-34893906 TTAAATAAAAATATAGAGATGGG - Intergenic
1116539274 14:46078695-46078717 ATAAATAAATAAATAGAGGAAGG - Intergenic
1118648328 14:67862934-67862956 ATAAATATGCATATATTGGAGGG + Intronic
1120346071 14:83291878-83291900 ATAAATTAGCATATAAAGTATGG - Intergenic
1120642970 14:87037820-87037842 TTAAATAAGCTGATTAAGGAAGG + Intergenic
1121032519 14:90671232-90671254 TTAAATAAGCATTTAGGTTAGGG + Intronic
1121261138 14:92566951-92566973 TTAAATAAGCATATACTCCATGG - Intronic
1121706644 14:96001362-96001384 TTAAATAAGCATGGTGAGGAGGG - Intergenic
1121766583 14:96492631-96492653 ATAATTAAGCATAGTGAGGAAGG - Intergenic
1121847132 14:97182503-97182525 TTAAATAAGAAAATAATGGAAGG + Intergenic
1122457571 14:101866187-101866209 CTAAATAAGAAAATAGAGGCTGG - Intronic
1123441924 15:20298173-20298195 CAAAATACGCATATATAGGAAGG + Intergenic
1125762426 15:42105766-42105788 TTAAAGAAGTATAAAGATGAAGG - Intergenic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126393855 15:48190803-48190825 TAAAATAAGGATAAAGAGCAAGG + Intergenic
1128784933 15:70387981-70388003 CTAAATGAGAATATTGAGGAAGG + Intergenic
1131742430 15:95408720-95408742 TTAAATATACATCTTGAGGAGGG + Intergenic
1131864304 15:96690752-96690774 TGAAATAAACCCATAGAGGATGG + Intergenic
1133466429 16:6031440-6031462 TTGAATATGCTTATAAAGGATGG - Intronic
1133961833 16:10501492-10501514 TTAAGTAAATTTATAGAGGAAGG + Intergenic
1134341368 16:13349858-13349880 TTAAATAAGCAAAAAGACCAAGG + Intergenic
1134661506 16:15987945-15987967 ATAAATAAACAAATACAGGATGG - Intronic
1134886298 16:17795733-17795755 TTAAATAAGCAGACACAGGCTGG + Intergenic
1135341361 16:21650925-21650947 TTAAAAAACCATATTGAGGCTGG + Intronic
1136100510 16:27992098-27992120 TTAGATAAGCATCTTGACGAGGG - Intronic
1136724309 16:32345707-32345729 CAAAATATGCATATATAGGAAGG - Intergenic
1136842636 16:33551751-33551773 CAAAATATGCATATATAGGAAGG - Intergenic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137350434 16:47709137-47709159 ATAAATAGTGATATAGAGGAAGG + Intergenic
1139907607 16:70377526-70377548 TTAAATAAGCAACCAGAGGCCGG + Exonic
1140725070 16:77804606-77804628 TGAAATAAGGACAGAGAGGAGGG - Intronic
1141238115 16:82239242-82239264 TTAAATAAACAAATAGATGGGGG + Intergenic
1203002121 16_KI270728v1_random:172058-172080 CAAAATATGCATATATAGGAAGG + Intergenic
1203133724 16_KI270728v1_random:1708465-1708487 CAAAATATGCATATATAGGAAGG + Intergenic
1203147838 16_KI270728v1_random:1813883-1813905 CAAAATATGCATATATAGGAAGG - Intergenic
1203152801 16_KI270728v1_random:1852048-1852070 CAAAATATGCATATATAGGAAGG - Intergenic
1144152310 17:12461400-12461422 TTAAATAAGGTTATATAGGTGGG + Intergenic
1145405929 17:22593797-22593819 TTTATTAAGCATATAGAGGAAGG + Intergenic
1147026584 17:37590212-37590234 TTAAATAAGAAGATACAGGTAGG + Intronic
1148718835 17:49735894-49735916 TTAAATAAGCACATATATGATGG - Intronic
1150988068 17:70221872-70221894 GTAAATAAATATATAAAGGATGG + Intergenic
1152195995 17:78918700-78918722 TTAAAAAAGTATATATAGGCCGG + Intronic
1153369538 18:4298406-4298428 TTAAAGAAGCATATACACCATGG + Intronic
1153440354 18:5111005-5111027 TGAAATTAGTATTTAGAGGAAGG - Intergenic
1153479064 18:5528897-5528919 TTAATTAAGAAACTAGAGGATGG - Intronic
1153491276 18:5650747-5650769 ATGATTAAGCATATTGAGGAAGG + Intergenic
1155014720 18:21821895-21821917 ATAAATAAGAACACAGAGGAAGG - Intronic
1157279701 18:46338236-46338258 TTAAATATGCACATAGAAGAGGG - Intronic
1158606523 18:58900912-58900934 TTAAATAGGCAAATAGAGACAGG - Intronic
1159318909 18:66819918-66819940 ATAAATAAGTAAATAGATGATGG - Intergenic
1159764878 18:72476852-72476874 TTAAGTAAGCTAAAAGAGGAAGG - Intergenic
1160759940 19:778643-778665 TTAAATAATAAAATAGAGGCTGG + Intergenic
1162653995 19:12115185-12115207 TTTAAGAAGCCTATAGAGGCAGG - Intronic
1163618175 19:18341647-18341669 ATAAATAACCAGATAAAGGAAGG - Intronic
1166038602 19:40188534-40188556 TCAAAGAAGCAAATAGAGGGTGG - Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167456713 19:49600083-49600105 TTACACAAGCATTTTGAGGAAGG + Intronic
1167958661 19:53088499-53088521 TTAAATAAAAATATAGAGACAGG - Intronic
1168411361 19:56142086-56142108 TTAAAATCGGATATAGAGGAGGG - Intronic
925029513 2:638574-638596 TTAAAAAAGCTTATAGAACAAGG - Intergenic
925035724 2:684067-684089 TTAAATGAGCATATAAGGGTGGG - Intergenic
925404065 2:3594752-3594774 TCAAAAGAGCATAAAGAGGAGGG - Intergenic
925694151 2:6557034-6557056 ATAAATAAACAAATAGGGGAGGG - Intergenic
926356702 2:12047272-12047294 TTGAATAAGCACATAGACCAGGG - Intergenic
926449200 2:12981751-12981773 TCATATAAGCATACACAGGATGG - Intergenic
926484287 2:13435761-13435783 TTAGATAAACAAGTAGAGGAAGG - Intergenic
926571919 2:14538308-14538330 TTAAATAAGCAAATAGAGGGAGG - Intergenic
927380026 2:22468458-22468480 TTAAATCAACATACAGATGATGG + Intergenic
928607631 2:32958276-32958298 TTAAAAACGCATAGAGAGCAGGG + Intronic
928711134 2:34006893-34006915 ATAAATAAACAAACAGAGGATGG - Intergenic
928824525 2:35403954-35403976 TTTAATAAGCATATAATGAATGG + Intergenic
931067748 2:58605597-58605619 TAATAAAAGCATATAGCGGAAGG - Intergenic
931096881 2:58950555-58950577 TCCAAAAAGGATATAGAGGATGG - Intergenic
931847340 2:66218298-66218320 GTGAATAGGGATATAGAGGAGGG + Intergenic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
933357894 2:81236949-81236971 TTAAACAAGCATATCAAGTAAGG + Intergenic
933683570 2:85124778-85124800 CTTAAAAAGCATATAGAGGCGGG + Intergenic
934321833 2:91977854-91977876 CAAAATATGCATATATAGGAAGG + Intergenic
935960398 2:108420152-108420174 TTAAATAAGCAAATACAGGCTGG + Intergenic
936604389 2:113934948-113934970 TTAAATGGGTATATAGAGAAAGG + Intronic
937191212 2:120100948-120100970 TTAAATAATCATATTGAGATGGG + Intronic
939033067 2:137099671-137099693 TTAAATGATCATTTAGAGTATGG + Intronic
939511939 2:143117784-143117806 TTAAATAAGCCAATACAGAATGG + Intronic
940024739 2:149193999-149194021 TTAAATAAGCAGAGAGAGATGGG - Intronic
940368466 2:152875184-152875206 TTAAAAAAGAATTTAGAGAATGG - Intergenic
941562238 2:167060983-167061005 ATATATAAGCATAAATAGGAAGG - Intronic
941809471 2:169740742-169740764 ATAAAAAAGCTTATAGAGGCCGG - Intronic
941975729 2:171403018-171403040 TTAAATAAACAAATAAATGAGGG + Intronic
942985889 2:182141601-182141623 ATAAATATGCATATAGAATATGG + Exonic
943634780 2:190294072-190294094 ATAAATAAGTACATAGAAGATGG + Intronic
944819093 2:203411191-203411213 TAAAATAAACACATAAAGGAGGG - Intronic
944902201 2:204226862-204226884 TTCAATAAGCAGAGAGATGAGGG - Intergenic
944967856 2:204956093-204956115 TTAAATAAGCCCAAAGAGCATGG - Intronic
945807369 2:214506229-214506251 TCAAACAAGTATATAGATGAAGG + Intronic
946537998 2:220652132-220652154 TGAAAAATGCATATATAGGATGG + Intergenic
948137263 2:235645787-235645809 TTAAATCAGAATTTATAGGAAGG + Intronic
1169150980 20:3289173-3289195 TTAAAAAAGCTTTTAGAGGTGGG - Intronic
1169205581 20:3738586-3738608 ATAAATAAGCATTCAGATGAGGG + Intronic
1169493921 20:6095073-6095095 TTAAATAGGCACATATAGCAAGG - Intronic
1170187961 20:13612948-13612970 TTATTTTAGGATATAGAGGATGG + Intronic
1171124775 20:22592005-22592027 TTAAATAAGCATTAAGGGAATGG - Intergenic
1172411508 20:34727094-34727116 TTAAATGAACAAATAAAGGAAGG + Intronic
1177485767 21:21753957-21753979 TTAATTTAGCTTATGGAGGATGG + Intergenic
1177592914 21:23195562-23195584 TCAAATAAGGTTAGAGAGGAGGG + Intergenic
1178373932 21:32050804-32050826 ATAAATAAACATACAGATGAAGG - Intergenic
1178596085 21:33953844-33953866 TTAAAAAAATATATAGAGGTTGG + Intergenic
1179257529 21:39729708-39729730 ATAAATAAGTAAAGAGAGGAAGG + Intergenic
1179463986 21:41559046-41559068 ATAAATAAATAAATAGAGGAAGG + Intergenic
1180548574 22:16523771-16523793 CAAAATATGCATATATAGGAAGG + Intergenic
1182017808 22:27055541-27055563 TTAAATAAACAAATGGATGAAGG - Intergenic
1182210877 22:28676663-28676685 CAAAATATGCATATATAGGAAGG - Intronic
1184141271 22:42578762-42578784 AAAAAGAAGCATATAGAAGAGGG - Intergenic
1184944438 22:47793094-47793116 AAAAATAAGCATAAAAAGGAAGG + Intergenic
950772190 3:15321269-15321291 CTAAATAAGCATATATATGACGG + Intronic
951151983 3:19301468-19301490 TTAAATAAGCCTATTAATGATGG - Intronic
951233663 3:20209765-20209787 TGAAATAATCACACAGAGGATGG - Intergenic
955205526 3:56892478-56892500 GTGAATAAACATATAAAGGAGGG - Intronic
955274018 3:57530314-57530336 TTACATAAGCAAATACAGAAAGG + Intronic
956374439 3:68599281-68599303 TTAAATAAGAATATAAACGAGGG + Intergenic
956551763 3:70468862-70468884 TTAGAAAAGCACATAGAGAAAGG + Intergenic
957188281 3:76972036-76972058 TCAAATAACCATATTGAAGATGG + Intronic
957843979 3:85706827-85706849 TTAAATAAGAATAAAGAAAAAGG + Intronic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
958268065 3:91463313-91463335 TTAAATAAGAACTTAGGGGAGGG + Intergenic
958428571 3:94009341-94009363 TCAAATAAGCATATAAAGGTTGG - Intronic
961049124 3:123732143-123732165 TTACATATGCATTTAGAGTAAGG + Intronic
962107131 3:132402039-132402061 TTAAATAAATAAATAAAGGATGG + Intergenic
963073952 3:141329175-141329197 CTTAAGAAGCATATAAAGGATGG - Intronic
963412136 3:144942267-144942289 TTAAGTAAACAGATAGTGGATGG - Intergenic
964474054 3:157083072-157083094 AAAAATTAGCATAGAGAGGATGG + Intergenic
965069605 3:163901770-163901792 TTCAATAACCATAGAGAAGAAGG - Intergenic
965156890 3:165071654-165071676 TTAAATAAGGATATAAGGGTGGG + Intronic
965207001 3:165732771-165732793 TTAAATAAAAATTTAGAGCAGGG - Intergenic
965248193 3:166304299-166304321 TTAAATAGGCTTATACAGGAAGG + Intergenic
966366515 3:179193973-179193995 TTAAATACCAATAAAGAGGATGG - Intronic
966384230 3:179378344-179378366 TTAAATAAGCACATAGAGGATGG + Exonic
966800865 3:183762753-183762775 TTAAAATAGCACATAGAGGCCGG + Intronic
967192610 3:186997948-186997970 TTAAAAAAGCAAAAAGAGGCCGG + Intronic
967293215 3:187941936-187941958 TTAAATAAGCAAATTAATGAGGG + Intergenic
968113933 3:196074583-196074605 TTAAAAAGGCATAAAGTGGACGG + Intronic
968136578 3:196224158-196224180 TTAAATAAAAACATAGAGAAAGG - Intronic
969598329 4:8161382-8161404 TTAAACGTGCATTTAGAGGAGGG + Intergenic
970386116 4:15558474-15558496 TCAAAGAAGCCTAGAGAGGATGG - Intronic
970571551 4:17388150-17388172 TTAAATACATATATAGAAGATGG + Intergenic
971441239 4:26689135-26689157 TTAAATAAGCATCTTCAAGAAGG + Intronic
971569080 4:28186807-28186829 ATAAATATCCAGATAGAGGAAGG - Intergenic
971997621 4:33985713-33985735 TTTATTAAGCATATACAGGAAGG - Intergenic
972624637 4:40784866-40784888 ATAAGTAAGGATATAGAAGATGG + Intronic
972827154 4:42772412-42772434 AAAAATAGGCATATAGAGGTTGG + Intergenic
974532802 4:63131986-63132008 TAAAATAATCATATAAAAGAGGG + Intergenic
974564118 4:63561895-63561917 ATAATTAAGCTTATCGAGGAAGG + Intergenic
974613228 4:64244140-64244162 TTAAATAAGATTATAAAGGCTGG - Intergenic
974823110 4:67093069-67093091 TGAAATGAGCAGAGAGAGGAGGG + Intergenic
975154166 4:71052671-71052693 TGAAATAAGCTTGTAGAGTATGG + Intergenic
976238224 4:82923971-82923993 TTAAATAAGCATATAGTGGCCGG + Intronic
977472781 4:97462542-97462564 TTATATAAACAAATAGAAGAAGG - Intronic
977738773 4:100451365-100451387 TTGAATCAGCATTTAGAGGTAGG + Intronic
978732974 4:112052333-112052355 TTAATTAAAAATATAGAGTAGGG - Intergenic
980163529 4:129196809-129196831 TTTAATAAGCATATTGAGCAAGG - Intergenic
980262216 4:130465236-130465258 TTAAATATTCATATAAATGACGG + Intergenic
980307899 4:131088286-131088308 TTAAATAAGAATGTGGGGGATGG - Intergenic
981118749 4:141023091-141023113 TTAAATAAGCTAATAAAGGAAGG - Intronic
981814311 4:148812335-148812357 TGAAAGAAGCATATAAAGGCAGG + Intergenic
981986486 4:150863293-150863315 TAGAATAAGGATATAGAGAAAGG - Intronic
982277295 4:153649450-153649472 TGAAAAAAGCTTATAGAGTAAGG - Intergenic
982563828 4:156964273-156964295 TTAAGCAAGTATATAGATGAAGG - Intronic
984790445 4:183610050-183610072 GCAAATAAGCATGTAGAGGATGG - Intergenic
985865661 5:2512140-2512162 TTTAATAAGAAAATAGTGGAAGG - Intergenic
986220299 5:5763060-5763082 TTAAAGAACCAAATAGAGAAAGG - Intergenic
986810148 5:11348859-11348881 TTAATTAAGCAGAAACAGGAAGG + Intronic
986887601 5:12258885-12258907 TTAAATAATAATAAAGATGATGG + Intergenic
987522613 5:19006128-19006150 TTAAATAAGCTTAACTAGGAAGG - Intergenic
987874378 5:23660999-23661021 TTAAATAAACATATTGAGAAGGG - Intergenic
987935522 5:24458932-24458954 ATAATTAAGCTTAAAGAGGAAGG - Intergenic
987992663 5:25234820-25234842 TTACATAAACATATATAAGAAGG - Intergenic
988544643 5:32143800-32143822 TTGAATTAGCATTGAGAGGAAGG - Exonic
989091532 5:37738958-37738980 TTAAATAAGCAAACAAGGGAAGG - Intronic
989206734 5:38816621-38816643 TTAAATAAAAGTTTAGAGGAGGG - Intergenic
989532723 5:42526037-42526059 TTAATTAAGCTTAGTGAGGAAGG + Intronic
990309292 5:54522540-54522562 TTAATTAAGCCTATATGGGAAGG - Intronic
991592319 5:68265896-68265918 TTAAATAACTATAGAGAGTAGGG - Intronic
992525617 5:77607260-77607282 TAAAATGAGGAAATAGAGGAAGG + Intronic
993518829 5:88872940-88872962 TTAAACAAGCATAAAGAGTTTGG - Intronic
993598057 5:89884357-89884379 TTAAATAATCCAATAGGGGATGG + Intergenic
993728425 5:91394749-91394771 TTGAATATGGGTATAGAGGAAGG + Intergenic
993874769 5:93293407-93293429 TTTTATAAGCAAATAGAGGCTGG - Intergenic
994958650 5:106568067-106568089 TTAGATAAGAATATAGGGAAAGG - Intergenic
995919553 5:117295219-117295241 TGAAATGAGCAAGTAGAGGAAGG - Intergenic
996479295 5:123955567-123955589 TTCAATATGCAAATAGAAGAGGG + Intergenic
996572987 5:124952457-124952479 TAAAACAAGCAAATAGATGAAGG - Intergenic
997004681 5:129803992-129804014 TTAAAGAAGAACATAGAAGATGG - Intergenic
997218464 5:132135343-132135365 ATAAATAAGCCAATAAAGGAAGG + Intergenic
998121229 5:139579749-139579771 TTAAATAATCACATAGATGTTGG + Intronic
998844036 5:146287805-146287827 TAAAATAAGCTTATAAAAGAAGG + Exonic
1000845703 5:166277488-166277510 TTATATTAGCACATTGAGGAAGG - Intergenic
1002822720 6:742056-742078 ATAATTAAGCTTATTGAGGAAGG - Intergenic
1003852893 6:10242872-10242894 TTAAATAAGAATGCAGAGCAGGG - Intergenic
1004739076 6:18439325-18439347 TTAAATGAAGATATAGAGAAAGG + Intronic
1005373264 6:25156599-25156621 TTGAATGACCAGATAGAGGAAGG - Intergenic
1005806604 6:29479179-29479201 TTAAATACGAATATAGAAGCTGG + Intergenic
1006118533 6:31789643-31789665 TTCAGCAAGCATATAGAGCAGGG + Intronic
1008255329 6:49292846-49292868 TTTAATAAGAATATAAAGAATGG + Intergenic
1008646939 6:53524120-53524142 TTAAATAAGCATAATGAGAAAGG + Intronic
1008987140 6:57558251-57558273 TTAAATAAGAACTTAGGGGAGGG - Intronic
1009175097 6:60450819-60450841 TTAAATAAGAACTTAGGGGAGGG - Intergenic
1010621096 6:78076184-78076206 TTATATAAGCATCTGGGGGAGGG + Intergenic
1012219543 6:96631829-96631851 TTGAATAAAAATATAGAGCATGG - Intergenic
1012263942 6:97118817-97118839 TTAAAGTAGCATATAGTAGAGGG + Intronic
1013184077 6:107742416-107742438 TCAAATATGCATGTATAGGAAGG + Intronic
1013277003 6:108594907-108594929 TTGCATAAGCACATAAAGGAAGG - Intronic
1014108096 6:117589877-117589899 TGAAATAAGAATATTGAGTATGG - Intronic
1014125336 6:117770371-117770393 TTAAATAAGGACATAAAGGTGGG - Intergenic
1014461078 6:121696349-121696371 ACAAATAAGGATACAGAGGAGGG - Intergenic
1015386571 6:132631496-132631518 TCAAATAAGTATATAGACTAAGG - Intergenic
1016366308 6:143322240-143322262 AAAAATAAGCATCTAGTGGAGGG + Intronic
1016943567 6:149506180-149506202 TTAAATAAGAAAATGGAGGCTGG + Intronic
1017386504 6:153891033-153891055 TTAAAAAAGCAGAGAGAGGCCGG + Intergenic
1018314308 6:162541682-162541704 AAAAATAAGGAAATAGAGGAGGG - Intronic
1018691716 6:166350737-166350759 ATTATTAAGCATATTGAGGAAGG - Intergenic
1020482339 7:8677658-8677680 GAAACTAAGCATAGAGAGGAAGG - Intronic
1021285225 7:18772464-18772486 TTACATCAGCAGAAAGAGGAGGG + Intronic
1021737942 7:23657417-23657439 TTAAAGAAGCCTATAGGGTAGGG - Intergenic
1022151126 7:27607708-27607730 TTAGATAAGCAGCTGGAGGAAGG - Intronic
1022595477 7:31709626-31709648 TTAAAAGAGCATATACAGAATGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023679398 7:42669326-42669348 TTAAAAAAACAGATAGAAGAGGG + Intergenic
1024753931 7:52505528-52505550 TGAAAAAAGAATATTGAGGATGG + Intergenic
1026417239 7:70195139-70195161 TAATTTAAGCATATTGAGGAAGG - Intronic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1030416504 7:109250808-109250830 TTAAATAGTCTTATAGTGGATGG + Intergenic
1031094974 7:117406347-117406369 TAAAATATGAAAATAGAGGATGG + Intronic
1035471459 7:159112550-159112572 TTAAATAGGCAGGCAGAGGAGGG + Intronic
1037246054 8:16836340-16836362 TTAAAGAGGCCTATATAGGAAGG - Intergenic
1037282956 8:17263993-17264015 TTAAATAGGCATGTAGAACATGG - Intronic
1038389938 8:27187462-27187484 ATAAATAAGCATATAAATAAGGG - Intergenic
1039222174 8:35344379-35344401 TGAAATAAAGATATAGAGGAGGG - Intronic
1040436138 8:47393543-47393565 TTAATTAGGCAGAGAGAGGAGGG - Intronic
1040671252 8:49693325-49693347 TTGAATAAGCATATAGTGTAAGG - Intergenic
1040875866 8:52151276-52151298 TAAAATAAGCAAATAAAAGAAGG - Intronic
1042099975 8:65265186-65265208 ATAATTAAGCTTATTGAGGACGG - Intergenic
1042274559 8:66990368-66990390 TTAAATAAACATACACTGGAGGG - Intronic
1042341377 8:67683667-67683689 TTGAATAGGCATAAAGAAGAGGG - Intronic
1043090706 8:75899340-75899362 TTTTATAAACATATAAAGGATGG - Intergenic
1043644184 8:82497497-82497519 TTAAAAAAGCTTATAGAATAAGG - Intergenic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1044750717 8:95412877-95412899 TTAAATGAGAAGAAAGAGGAGGG - Intergenic
1044955246 8:97473170-97473192 ATAAAAAAGAATATAGAGGAGGG - Intergenic
1045615981 8:103912110-103912132 TTAAATAAGCGTCTAAAAGATGG + Exonic
1045908897 8:107382054-107382076 TTAATTCAGAATATAGAGGCAGG - Intronic
1046006102 8:108487325-108487347 TTAAAGAATCATAAAGAGTAGGG + Intergenic
1047561991 8:125996181-125996203 ATAAATATACATATATAGGAAGG + Intergenic
1048035298 8:130672284-130672306 TTAGATAAGCATATTTATGAAGG - Intergenic
1050297672 9:4222312-4222334 TTAAATAAGCAGGTAGTGGGAGG - Intronic
1053246530 9:36538912-36538934 ATAAATAAGCACATAGAGGCCGG - Intergenic
1055228239 9:74027690-74027712 TTCAATTACCATATAAAGGAAGG + Intergenic
1055588023 9:77776948-77776970 TTAAAGAAGAATATAGGTGAAGG + Intronic
1055811308 9:80151394-80151416 TTGAATAAGAATATCGAGAATGG + Intergenic
1056000857 9:82215292-82215314 TGAAATAAGCAGATATAGGCTGG - Intergenic
1056204693 9:84308682-84308704 TTAAGTAGGAATATAGAAGATGG + Intronic
1056618395 9:88188508-88188530 TTAAATTAGCACTTAGAAGACGG - Intergenic
1057073378 9:92119843-92119865 GGAAATAAGCAAATTGAGGAAGG - Intergenic
1057882662 9:98804872-98804894 GTAAATAAGCAAAAAAAGGAAGG - Intergenic
1058304429 9:103419720-103419742 TTAAAGAAGCACATAGATGTTGG + Intergenic
1059011322 9:110464729-110464751 TTAAATAAAACTATAGAGGTAGG + Intronic
1059692674 9:116700415-116700437 TTAAAGAAGCATATATGGGTTGG + Exonic
1060472993 9:123964232-123964254 ATATATAAGGATATAGAAGATGG + Intergenic
1060616768 9:125023769-125023791 TTCAATAAGCATACAGAAGTGGG + Intronic
1186050887 X:5593826-5593848 GTAAATAAGAATACACAGGAAGG + Intergenic
1186213761 X:7277523-7277545 TTAAAGAAGCATCTAGAAGCTGG - Intronic
1186827407 X:13354299-13354321 TTAAAGAAGAATATAGAGACTGG + Intergenic
1189163685 X:38837736-38837758 TTAATTAATAATATTGAGGAGGG + Intergenic
1189728937 X:43998387-43998409 ATAAATAAACATATGGATGAAGG - Intergenic
1190734223 X:53244892-53244914 ATAAATAAGCAAATAAATGAAGG - Intronic
1190751438 X:53365241-53365263 ATAAATAAACATATGGAAGACGG - Intergenic
1191915832 X:66200384-66200406 TTAAAGTGGCATAGAGAGGAAGG + Intronic
1192348710 X:70336251-70336273 TTAAATGTGCATACATAGGAAGG - Intronic
1194316954 X:92389428-92389450 TTAAATAAGAATATAGAAATGGG + Intronic
1194549041 X:95273700-95273722 AAAAATAAACATATAGAAGATGG + Intergenic
1194607215 X:95995562-95995584 TTAAAAAGGCATATAGAGGGTGG - Intergenic
1194922720 X:99787092-99787114 ATAAATAAACACATAGAGGAGGG - Intergenic
1195449452 X:104994540-104994562 TTAAATAAGCAAACAGAATAAGG + Intronic
1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG + Intergenic
1197799602 X:130335687-130335709 TTACATAAACATATAAAAGATGG + Intergenic
1198011838 X:132564330-132564352 CTAAACAAGCATATGGAAGACGG - Intergenic
1198068379 X:133122753-133122775 TTAAATAAGATTATTGAGGAAGG - Intergenic
1198705324 X:139442776-139442798 ATATATAAGCAAATAGAGAATGG + Intergenic
1199121397 X:144058585-144058607 TTAAATGCAGATATAGAGGAAGG - Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1200625131 Y:5502748-5502770 TTAAATAAGAATATAGAAATGGG + Intronic
1200843781 Y:7810814-7810836 TTTAATAACCACAGAGAGGATGG - Intergenic