ID: 1195882909

View in Genome Browser
Species Human (GRCh38)
Location X:109611316-109611338
Sequence AATGTTTAGGAGAGTAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195882903_1195882909 2 Left 1195882903 X:109611291-109611313 CCCAATCCTGAAAGAAAAGCTCG No data
Right 1195882909 X:109611316-109611338 AATGTTTAGGAGAGTAGAGGAGG No data
1195882904_1195882909 1 Left 1195882904 X:109611292-109611314 CCAATCCTGAAAGAAAAGCTCGG No data
Right 1195882909 X:109611316-109611338 AATGTTTAGGAGAGTAGAGGAGG No data
1195882906_1195882909 -4 Left 1195882906 X:109611297-109611319 CCTGAAAGAAAAGCTCGGTAATG No data
Right 1195882909 X:109611316-109611338 AATGTTTAGGAGAGTAGAGGAGG No data
1195882902_1195882909 15 Left 1195882902 X:109611278-109611300 CCTTAAATGTATTCCCAATCCTG No data
Right 1195882909 X:109611316-109611338 AATGTTTAGGAGAGTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195882909 Original CRISPR AATGTTTAGGAGAGTAGAGG AGG Intergenic
No off target data available for this crispr