ID: 1195899343

View in Genome Browser
Species Human (GRCh38)
Location X:109781194-109781216
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195899336_1195899343 8 Left 1195899336 X:109781163-109781185 CCTCTTCATTTACATAGGACATA No data
Right 1195899343 X:109781194-109781216 AACCAATGGAATCCTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195899343 Original CRISPR AACCAATGGAATCCTGGAGA GGG Intergenic
No off target data available for this crispr