ID: 1195906947

View in Genome Browser
Species Human (GRCh38)
Location X:109853415-109853437
Sequence TCACTGCAATGTAATCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 3, 2: 3, 3: 15, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195906947_1195906950 14 Left 1195906947 X:109853415-109853437 CCTTCAGGATTACATTGCAGTGA 0: 1
1: 3
2: 3
3: 15
4: 154
Right 1195906950 X:109853452-109853474 AAGTACCTGCCTCACAGCATAGG 0: 1
1: 0
2: 2
3: 20
4: 151
1195906947_1195906951 15 Left 1195906947 X:109853415-109853437 CCTTCAGGATTACATTGCAGTGA 0: 1
1: 3
2: 3
3: 15
4: 154
Right 1195906951 X:109853453-109853475 AGTACCTGCCTCACAGCATAGGG 0: 1
1: 0
2: 2
3: 19
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195906947 Original CRISPR TCACTGCAATGTAATCCTGA AGG (reversed) Intergenic
902657991 1:17882721-17882743 TCACTGCTGTGCAATGCTGAGGG + Intergenic
906514346 1:46430060-46430082 GTGCTGCAATGTTATCCTGAGGG + Intergenic
906881173 1:49592936-49592958 TCAGTCTAATGTAATCCTTATGG + Intronic
908196563 1:61751074-61751096 TCACTGCAATGTCTGCCTCATGG + Intronic
909305848 1:74075490-74075512 TCACTGCAATGTCCGCCTGCTGG - Intronic
909367352 1:74843199-74843221 TAACTGAAATGTAAGCTTGATGG + Intergenic
910671030 1:89772951-89772973 TCACTGGAATGTAAACCCCATGG + Intronic
911911414 1:103641746-103641768 TCACTGCAATCTAAACCTCGGGG - Intergenic
911917040 1:103710204-103710226 TCACTGCAATCTAAACCTCGGGG + Intronic
911918829 1:103735884-103735906 TCACTGCAATCTAAACCTCGGGG - Intronic
912739446 1:112180201-112180223 TGACTGCAAAGTAATGCTGATGG - Intergenic
912998133 1:114552164-114552186 TCACTGCAATGTACGCCTCCTGG - Intergenic
914819148 1:151086388-151086410 TCACTGCCATGTAATCTCAAGGG - Intronic
916265622 1:162887631-162887653 TGAGAGCAATGGAATCCTGAGGG + Intergenic
917831562 1:178895427-178895449 TCACTGAAATGTAATCCAGGAGG - Intronic
918136597 1:181679645-181679667 TCACTGCAGTGCCATCCTGATGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
921202908 1:212824129-212824151 TCACTGCAATGTAATCCTGCAGG - Intergenic
923136322 1:231123343-231123365 TCACTGCAATCTCATCCTCCCGG + Intergenic
1064741511 10:18439463-18439485 TCAGTTCAATATAATCCTTATGG + Intronic
1069211390 10:65764801-65764823 TCAGTGCAGTGTGAGCCTGATGG - Intergenic
1074107592 10:110400129-110400151 TCTCTGCTATGGAATCCTGGTGG - Intergenic
1078275710 11:9843684-9843706 TATTTGCAATGTAAACCTGAAGG + Intronic
1078440872 11:11366588-11366610 TCACAGCAATCAAATGCTGAAGG - Intronic
1080241051 11:30127659-30127681 TCACTGTCATGTAATCCTTATGG - Intergenic
1080391753 11:31854615-31854637 TGACTGCAAGGTGATCTTGAAGG - Intronic
1081483492 11:43509483-43509505 TCCCTGCAATGTCATCTTCATGG + Intergenic
1085908608 11:80794759-80794781 TCACTGTTATGTAATTCTAAAGG - Intergenic
1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG + Intronic
1092154824 12:6275295-6275317 TGACACCAATGTGATCCTGATGG - Intergenic
1093089897 12:14909376-14909398 TCACTAAAAGGTAATCCTGCCGG - Intergenic
1097354136 12:58582741-58582763 TGGGTGCAATGTAATCATGAGGG + Intronic
1097679317 12:62633756-62633778 TCACTGGACTGGAGTCCTGAGGG - Intergenic
1100261870 12:92940168-92940190 TCACTGCAATGTCTTCCTCCTGG + Intergenic
1101326703 12:103722048-103722070 CCAGTGAAATGTAAGCCTGAAGG + Intronic
1103149116 12:118621728-118621750 TGACTGCAATGTAGTCTTGGGGG - Intergenic
1105507434 13:21022668-21022690 CCACAGAAATGTAATACTGAAGG + Intronic
1106408563 13:29495281-29495303 TCACTGCAACCTAAGCCTGCCGG - Intronic
1108291122 13:48962215-48962237 TCACTACACTGAAATCCTCAAGG - Intergenic
1110204923 13:72900945-72900967 TCACTGCAATGTACGCCTCCCGG - Intronic
1110618504 13:77568780-77568802 TCCCTGGAATGTACTACTGATGG + Intronic
1114625824 14:24129629-24129651 TCACTGCAATGTCAACCTCCTGG + Intronic
1117050778 14:51857540-51857562 TCTCAGCAATGTACTTCTGATGG + Intronic
1117065725 14:52011778-52011800 ACACTGCACTGTGATCCTGCAGG + Intronic
1117083666 14:52177708-52177730 TCACTAGAATGTAATCTTCATGG + Intergenic
1117870010 14:60190466-60190488 TCTCTGAAATGTAATCATGTTGG + Intergenic
1124706298 15:31968757-31968779 TCACTGAAATGTAATGCCTAGGG + Intergenic
1124884848 15:33675901-33675923 GCACTGCGATGAAATCCTAATGG - Intronic
1128694777 15:69752839-69752861 TCACTGCAAGGTAATAATGTGGG - Intergenic
1128964895 15:72049024-72049046 ACACTGAAATGTCATCCAGACGG + Intronic
1129204888 15:74031347-74031369 TCACTGCAATGTCTGCCTCAGGG + Intronic
1131105573 15:89731832-89731854 TCACTGGAGTGTAATAATGAAGG - Intronic
1133150438 16:3824579-3824601 TCTCTGCATTCAAATCCTGATGG + Intronic
1133347003 16:5077887-5077909 GCCCTGCAATGAAATCATGACGG - Exonic
1138020840 16:53479660-53479682 TCACTGCAGTGTAGTACTGCAGG + Intronic
1138610715 16:58121762-58121784 TCCCCGCAATGTAAGCCTCAGGG + Intronic
1139115512 16:63946824-63946846 TCACTGCAATGTCGGCCTGCCGG - Intergenic
1140518256 16:75560203-75560225 ACACTGCAATGTGATCCTTCAGG - Intergenic
1141730811 16:85821681-85821703 TCACTGCCACGTAATCCAGACGG - Intergenic
1143126957 17:4648163-4648185 TCACTGAAATGTAGGCCTGAGGG + Intergenic
1144317867 17:14080980-14081002 CCACTGAAATATAATCCAGATGG - Intronic
1146403452 17:32518380-32518402 AGACTGCAATGGAATCGTGACGG + Intronic
1147788431 17:42997152-42997174 CCATTGCAATGGGATCCTGAGGG + Intergenic
1148195398 17:45709375-45709397 TCCCTGCAATGCAATTCTCAGGG - Intergenic
1148249639 17:46065048-46065070 TCACTGCAGTGTCAACCTGGTGG + Intronic
1148937480 17:51175140-51175162 TCACTGCAATGTACACCTCCTGG - Intergenic
1149457986 17:56804440-56804462 TAACTGCACTGGAATACTGAAGG + Intronic
1151105704 17:71614327-71614349 TCACTGCAGGGGACTCCTGAGGG - Intergenic
1151247375 17:72805252-72805274 TCCATCCTATGTAATCCTGATGG + Intronic
1151915982 17:77118287-77118309 TCACTGATTTGTAATCCTCAAGG - Intronic
1152192643 17:78897816-78897838 TCACTGCAACATGATCCAGAGGG + Intronic
1155069566 18:22302403-22302425 TCACTGAAATCTAAGCGTGATGG - Intergenic
1155251945 18:23961047-23961069 TGACTGGCATGTAATCCTGCTGG - Intergenic
1157166699 18:45363956-45363978 AGACTGCATTGTAATGCTGAAGG - Intronic
1157277171 18:46319517-46319539 TCAGTGTAAGGTGATCCTGATGG + Intergenic
1157288651 18:46394367-46394389 TCCCTGAAATGTAATTGTGACGG + Intronic
926902491 2:17769092-17769114 TCACTGCAATCTCAACCTGCCGG + Intronic
928182056 2:29075110-29075132 TCACTGCCATGTAAAGCTCAAGG + Intergenic
931909916 2:66888049-66888071 TCACTGCAATGTCAGCCTCCCGG - Intergenic
936286034 2:111182115-111182137 TCACTGCATTGAAATTCTCAAGG - Intergenic
940320613 2:152372584-152372606 TCACTGCATTGTGCTCATGAAGG + Intronic
946930596 2:224666441-224666463 TGACCGCAATGTAATTTTGAAGG + Intergenic
948486028 2:238281844-238281866 TCTCTGCAATGGATTCCTGGAGG - Intronic
948935978 2:241164971-241164993 TCACTGCAATGTCCTCCTCCTGG - Intronic
1170729877 20:18964337-18964359 TCACTGCAGTCTAATCATGAGGG - Intergenic
1174632261 20:51968111-51968133 TAACTGCTATGCCATCCTGATGG + Intergenic
1177749823 21:25266933-25266955 TCACTGCAAAATAATCCAGTGGG + Intergenic
1178544600 21:33482071-33482093 TCACTGCAGTGTAATCCTGCAGG + Intergenic
1178616289 21:34135926-34135948 TCACTGCAATGGAATCCTGCAGG + Intronic
1181717643 22:24744496-24744518 TCACTGCAATGTCCTCCTCCCGG - Intronic
1182718042 22:32375903-32375925 TCAATGCAATGATATGCTGAGGG - Intronic
1185387285 22:50540144-50540166 TCACTGCAATGTCAGCCTCCTGG - Intergenic
951186938 3:19724134-19724156 TCACTGCACTGTAGCCCTGGGGG - Intergenic
951240237 3:20277965-20277987 TCACTCCAATGTATTGCTAAAGG + Intergenic
951445150 3:22770557-22770579 TCCCTGAAATGTATGCCTGAGGG + Intergenic
953332734 3:42067644-42067666 TGACGGCAATGTGATCCTGGTGG + Intronic
956125919 3:66010822-66010844 TCACTGCCTGGAAATCCTGAGGG - Intronic
956979320 3:74617084-74617106 TTACTGCAATTTAATTCTGATGG - Intergenic
957758060 3:84517467-84517489 TCACTGCAGTCAAATCCTCAAGG - Intergenic
960923419 3:122772264-122772286 TCACTGTAAAGAAATCCTGTTGG - Intronic
960934506 3:122889629-122889651 TCACTGGAATGCAAATCTGAGGG - Intergenic
963673179 3:148278367-148278389 TCACTGCAATGCCATCCAGGAGG + Intergenic
964488085 3:157206347-157206369 TCACTGCACTGTCAACCTCAGGG - Intergenic
965208725 3:165756231-165756253 TTACTGCTAACTAATCCTGAAGG - Intergenic
974231531 4:59121742-59121764 TCTTTTCAATGAAATCCTGAGGG + Intergenic
974273021 4:59677572-59677594 TCACTGCAATCTCCTCCTGCTGG + Intergenic
974797663 4:66773835-66773857 TCACTGCCATGTATTTATGAGGG + Intergenic
974965213 4:68751840-68751862 TCACTGCAATGTCCACCTCATGG - Intergenic
979163187 4:117490426-117490448 TCACTGCAATGTACGCCTCCTGG + Intergenic
983676098 4:170295068-170295090 CCACTGCAATATAATCTTCAGGG + Intergenic
983709630 4:170697578-170697600 TCACTTCAACCTAATCATGAGGG - Intergenic
985690657 5:1309950-1309972 TCACTGCAATGTCTTCCTCCCGG - Intergenic
986727262 5:10608281-10608303 TCACTGCAATGTCCGCCTCATGG - Intronic
987841695 5:23230968-23230990 TCTTTGCAATGTAATCATCAAGG + Intergenic
988869655 5:35374714-35374736 TCACTGCTTTGTAAGCCTGCAGG - Intergenic
989267107 5:39487536-39487558 TCACTGCATTGTATTCATGTTGG + Intergenic
989626484 5:43434513-43434535 TCACTGCAATGTCTGCCTGCCGG + Intergenic
990009093 5:50974312-50974334 TCACTGGACTGTAGTTCTGATGG - Intergenic
992085688 5:73276193-73276215 TGACTGGAATGTAAACATGATGG + Intergenic
992199387 5:74368821-74368843 TCACTGCAATCTCTTCCTCATGG + Intergenic
993105884 5:83600392-83600414 TCACTGCAATGTCTGCCTGCTGG + Intergenic
995314723 5:110755895-110755917 ACATTGAAATGTAGTCCTGAAGG + Intronic
995381187 5:111535230-111535252 CCACTGAAATGTAATCATCAAGG - Intergenic
996909936 5:128644831-128644853 TAACTGTAATCTAATCATGAGGG - Intronic
1001141383 5:169146731-169146753 TCAAACCAATATAATCCTGAGGG + Intronic
1001739494 5:174040054-174040076 TCATTTCACTGTAATCCTTAGGG + Intergenic
1005513956 6:26537157-26537179 CCACTGCCATGTAATCTTGAGGG + Intergenic
1006910401 6:37559694-37559716 TCACTGAAATGGATTCATGAAGG - Intergenic
1007747675 6:44053120-44053142 TCTCTGCAACAGAATCCTGATGG + Intergenic
1008075070 6:47137213-47137235 TCACTGAAATCTCATCCTGAAGG + Intergenic
1008310554 6:49966533-49966555 TCTCTGCAATGGAATTCTCATGG + Intergenic
1011726665 6:90216504-90216526 TCACTGTAAGGGAGTCCTGAGGG + Intronic
1011921033 6:92577463-92577485 TCCCTGGAATGTAGTCCTGGGGG + Intergenic
1012603234 6:101124688-101124710 TCTATGCAATGAAAACCTGATGG - Intergenic
1013474265 6:110493148-110493170 TAACAGCTATGTAATCCTGAGGG + Intergenic
1013938507 6:115630781-115630803 TCAATGCAGTTTAATCATGAAGG + Intergenic
1013991511 6:116258992-116259014 TCACTGCAATGTAATCCTGCAGG + Intronic
1014105827 6:117559374-117559396 GGACTACAATGTAATCCTAAGGG + Intronic
1014830648 6:126099141-126099163 TAAATGCAATATATTCCTGAAGG - Intergenic
1015450268 6:133359370-133359392 TCACTGAAATGAAACCCTAATGG + Intronic
1018249214 6:161851554-161851576 TCACTGCAATCTCGGCCTGATGG + Intronic
1018512307 6:164538306-164538328 TCACTGCAATGTCTGCCTGCTGG + Intergenic
1021462836 7:20908611-20908633 GCACTGAAATGGAATCATGAAGG + Intergenic
1025051940 7:55739816-55739838 TCACTGCAACCTATTCCTGCCGG + Intergenic
1025128896 7:56365484-56365506 TCACTGCAACCTATTCCTGCCGG + Intergenic
1026888524 7:73968720-73968742 TCACTGCAGTGTCAGCCTGCTGG + Intergenic
1028649343 7:93133577-93133599 GCACAGGAATGTAATCCTGATGG + Exonic
1029877325 7:103768031-103768053 TCACTGCAATGTAGACTTCATGG + Intronic
1031378406 7:121055384-121055406 TTACTGTAAAGTAACCCTGAAGG - Intronic
1034321076 7:150182641-150182663 TCACTGCAATTTAACTCTGCAGG + Intergenic
1034771670 7:153784608-153784630 TCACTGCAATTTAACTCTGCAGG - Intergenic
1039871680 8:41551047-41551069 TCACTGCAATGTCCTCCTGTTGG - Intergenic
1041981650 8:63868599-63868621 TCACTGCAACCTCATCCTCATGG + Intergenic
1042411224 8:68468239-68468261 TCACTGTAATGTAATTTTAATGG + Intronic
1042700712 8:71610531-71610553 TCAGTGCAAATTAATCCTAAAGG - Intergenic
1045924291 8:107568024-107568046 TCACTGCAACGTCAGCCTCACGG - Intergenic
1046393047 8:113602062-113602084 TCGCTACAATGAGATCCTGAAGG + Intronic
1050355839 9:4781954-4781976 TCACTGCAATGTAATCCTTCAGG + Intergenic
1051709108 9:19911929-19911951 TCAATGGCATGTAATGCTGATGG - Intergenic
1052150750 9:25112590-25112612 TCACAGCAATGTACTGGTGAAGG - Intergenic
1052822577 9:33149641-33149663 CCACTACAATGAAATCCTCAAGG + Intronic
1055433847 9:76272410-76272432 TTTCTGAAATGTAAACCTGACGG + Intronic
1055478083 9:76683303-76683325 TGACTGTAATGTAAACCTGAGGG + Intronic
1058652537 9:107190168-107190190 TCACTGTAATGTAATTTTGCAGG - Intergenic
1059236971 9:112769373-112769395 TCACTGCAGTGCCATCCTGCAGG + Intronic
1186126750 X:6422578-6422600 TCACTGCAATGTAATCCTGCAGG + Intergenic
1187437236 X:19283762-19283784 TCACTGCAAGGGAATCTGGAAGG + Intergenic
1188257295 X:27978520-27978542 TTCCTGGAATGTAATCCTGTGGG + Exonic
1190689701 X:52903293-52903315 TCACAGAACTGTACTCCTGAGGG - Intronic
1190696282 X:52952499-52952521 TCACAGAACTGTACTCCTGAGGG + Intronic
1191853341 X:65602440-65602462 TCACTTCAATATAATTATGAAGG - Intronic
1192602299 X:72477866-72477888 TCACTTCAATGAAATCCAGATGG + Intronic
1195805322 X:108759182-108759204 TCACTGCAGTGTCAACCTCACGG + Intergenic
1195906947 X:109853415-109853437 TCACTGCAATGTAATCCTGAAGG - Intergenic
1199102499 X:143819526-143819548 TCACTGGAAAGTAATCCTTTGGG + Intergenic
1201739384 Y:17307188-17307210 TGAATGCATTGTGATCCTGATGG - Intergenic