ID: 1195910829

View in Genome Browser
Species Human (GRCh38)
Location X:109887083-109887105
Sequence CACCCAGAACCACCTGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195910829_1195910837 26 Left 1195910829 X:109887083-109887105 CCTCATTCAGGTGGTTCTGGGTG No data
Right 1195910837 X:109887132-109887154 GATTGAAGACTGTGAGTTGCTGG No data
1195910829_1195910838 27 Left 1195910829 X:109887083-109887105 CCTCATTCAGGTGGTTCTGGGTG No data
Right 1195910838 X:109887133-109887155 ATTGAAGACTGTGAGTTGCTGGG No data
1195910829_1195910834 -8 Left 1195910829 X:109887083-109887105 CCTCATTCAGGTGGTTCTGGGTG No data
Right 1195910834 X:109887098-109887120 TCTGGGTGAGGGGGTAAAGATGG No data
1195910829_1195910835 4 Left 1195910829 X:109887083-109887105 CCTCATTCAGGTGGTTCTGGGTG No data
Right 1195910835 X:109887110-109887132 GGTAAAGATGGATAGTCCAGCGG No data
1195910829_1195910839 28 Left 1195910829 X:109887083-109887105 CCTCATTCAGGTGGTTCTGGGTG No data
Right 1195910839 X:109887134-109887156 TTGAAGACTGTGAGTTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195910829 Original CRISPR CACCCAGAACCACCTGAATG AGG (reversed) Intergenic
No off target data available for this crispr