ID: 1195910834

View in Genome Browser
Species Human (GRCh38)
Location X:109887098-109887120
Sequence TCTGGGTGAGGGGGTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195910829_1195910834 -8 Left 1195910829 X:109887083-109887105 CCTCATTCAGGTGGTTCTGGGTG No data
Right 1195910834 X:109887098-109887120 TCTGGGTGAGGGGGTAAAGATGG No data
1195910828_1195910834 -7 Left 1195910828 X:109887082-109887104 CCCTCATTCAGGTGGTTCTGGGT No data
Right 1195910834 X:109887098-109887120 TCTGGGTGAGGGGGTAAAGATGG No data
1195910826_1195910834 -6 Left 1195910826 X:109887081-109887103 CCCCTCATTCAGGTGGTTCTGGG No data
Right 1195910834 X:109887098-109887120 TCTGGGTGAGGGGGTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195910834 Original CRISPR TCTGGGTGAGGGGGTAAAGA TGG Intergenic
No off target data available for this crispr