ID: 1195915256

View in Genome Browser
Species Human (GRCh38)
Location X:109929111-109929133
Sequence ACATATCCACAGGGTGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195915256_1195915260 19 Left 1195915256 X:109929111-109929133 CCCACGACACCCTGTGGATATGT No data
Right 1195915260 X:109929153-109929175 GAACATTTGCCTACGCAAAATGG No data
1195915256_1195915262 30 Left 1195915256 X:109929111-109929133 CCCACGACACCCTGTGGATATGT No data
Right 1195915262 X:109929164-109929186 TACGCAAAATGGAAATACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195915256 Original CRISPR ACATATCCACAGGGTGTCGT GGG (reversed) Intergenic
No off target data available for this crispr