ID: 1195924486

View in Genome Browser
Species Human (GRCh38)
Location X:110012158-110012180
Sequence GCTTTTTAGTGGCTTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195924481_1195924486 -4 Left 1195924481 X:110012139-110012161 CCACCTGCAACCAGTAGATGCTT 0: 1
1: 0
2: 0
3: 20
4: 123
Right 1195924486 X:110012158-110012180 GCTTTTTAGTGGCTTGTGGATGG 0: 1
1: 0
2: 1
3: 17
4: 209
1195924482_1195924486 -7 Left 1195924482 X:110012142-110012164 CCTGCAACCAGTAGATGCTTTTT 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1195924486 X:110012158-110012180 GCTTTTTAGTGGCTTGTGGATGG 0: 1
1: 0
2: 1
3: 17
4: 209
1195924480_1195924486 -3 Left 1195924480 X:110012138-110012160 CCCACCTGCAACCAGTAGATGCT 0: 1
1: 0
2: 0
3: 15
4: 114
Right 1195924486 X:110012158-110012180 GCTTTTTAGTGGCTTGTGGATGG 0: 1
1: 0
2: 1
3: 17
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195924486 Original CRISPR GCTTTTTAGTGGCTTGTGGA TGG Intronic
901718271 1:11174426-11174448 GCATATTAGTAGCTTCTGGAAGG - Intronic
902769643 1:18638024-18638046 GACTTTTTGTGGGTTGTGGAGGG + Intronic
903564946 1:24258197-24258219 GCTTTTTAGGTAGTTGTGGATGG + Intergenic
903775970 1:25794058-25794080 TCTTTTTTGTGGCTTGTGTGTGG + Intergenic
904274868 1:29374958-29374980 GGTTTTCAGTGGCTTATGGATGG + Intergenic
904659455 1:32073494-32073516 GGCTTTTATTGGCTTGTGGGCGG + Intronic
904687928 1:32274179-32274201 GCTTTTCTGTGGCTGGTGAATGG + Intronic
906026419 1:42677900-42677922 GCTTTCTTCTGTCTTGTGGATGG + Intergenic
906101092 1:43262651-43262673 GGTTTTTAGTTTCTAGTGGAAGG - Intronic
907844219 1:58189413-58189435 GAATTTAAGTGGTTTGTGGAAGG + Intronic
907936006 1:59042938-59042960 TGTTTCTAGTGACTTGTGGAAGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
916312583 1:163413313-163413335 GCTTCTTGCTTGCTTGTGGAAGG + Intergenic
916313430 1:163422123-163422145 CCTTTTTCCTGGCTTGTAGATGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918267785 1:182862364-182862386 GGTTTTAAGTGGCTTGAGTATGG - Intronic
919727525 1:200893864-200893886 ACTTTTTAGGGGCTGGGGGAGGG + Intronic
921539268 1:216393415-216393437 GCATTCTAGGGGCTTGTGGTCGG + Intronic
921927827 1:220727165-220727187 TCTTTTTTGTGGCTTGTTCAGGG - Intergenic
924291125 1:242537532-242537554 GCTTTTTTGTGACTTCTCGATGG - Intergenic
924328199 1:242916820-242916842 GCATTTTAGGGTCTGGTGGAGGG - Intergenic
924946167 1:248848359-248848381 GCATTTGTGTGGCTTGTGGCCGG - Exonic
1064823057 10:19361397-19361419 GCTCTTTAGTGTCTGGGGGATGG - Intronic
1065063242 10:21930623-21930645 GTATTTTTGTGACTTGTGGAAGG + Intronic
1068221952 10:54056716-54056738 GATTTTGGGTGGCTTTTGGAAGG - Intronic
1069891554 10:71655613-71655635 GGTTTTCAGTGGCGTGGGGAAGG - Intronic
1070044037 10:72812820-72812842 GGTTTTTAGTGTCCTGTGGGAGG + Intronic
1073260725 10:102188453-102188475 GCTTTTATGTGGCTCGGGGAAGG + Intergenic
1074441397 10:113480119-113480141 AATTTTTAGGGGCTTTTGGAAGG + Intergenic
1075763210 10:124872225-124872247 GATGATTAGTGCCTTGTGGATGG + Intergenic
1075934774 10:126330793-126330815 GCATTTTTGTTGCTTGTTGAAGG - Intronic
1076579531 10:131497382-131497404 GATATTTAGTGACTTGTGCATGG - Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1080859867 11:36143745-36143767 CCTTTTTTTTGGCTTGTAGATGG + Intronic
1081565290 11:44257073-44257095 GCATTTTTGTGGCTTGCCGAAGG + Intergenic
1083206598 11:61153555-61153577 GCTTTTTAGTTTTTTGTGGCAGG - Intronic
1083376403 11:62226219-62226241 GCTTTTTAGTTTCCAGTGGAAGG + Intergenic
1085837865 11:79975594-79975616 GAAGTTTAGTGACTTGTGGAAGG + Intergenic
1086138655 11:83469524-83469546 GTTTTTTAGTTGCTTATGGTGGG - Intronic
1087464985 11:98492983-98493005 CCTTTTTAGTTTCTAGTGGAAGG - Intergenic
1088103404 11:106178849-106178871 GCTTTTTAGTTTCTAGTAGAAGG + Intergenic
1088338214 11:108732279-108732301 GCTTTTAAGTGACTTGTCCAAGG + Intronic
1088743653 11:112786754-112786776 GCCTTGTGGTGGCTAGTGGAAGG + Intergenic
1088902312 11:114127571-114127593 GCTTTTCAGGTGCTTGTGGATGG + Intronic
1091626846 12:2127585-2127607 GCTGTGTAGTGGGGTGTGGAAGG + Intronic
1095107714 12:38255495-38255517 GCCTTTTAGTAGATTGTTGAGGG + Intergenic
1096281163 12:50255102-50255124 TTTTATTAGTGGCTTGGGGAGGG - Intronic
1097600369 12:61684672-61684694 GCCTTATTGTGCCTTGTGGAGGG + Intergenic
1098619895 12:72582467-72582489 GTTTTTTTGTGTCTTCTGGATGG + Intronic
1102757233 12:115352085-115352107 GGTTTTCAGGGGCTAGTGGAGGG - Intergenic
1104473799 12:129053724-129053746 GCTTATTAATGGCTTGGGAAGGG + Intergenic
1104680578 12:130748471-130748493 GCTTTTTTGTGTCTTCTGCAAGG - Intergenic
1106333742 13:28764087-28764109 GCTTCTTACTTGCTTGTGGCTGG + Intergenic
1106985456 13:35342833-35342855 GCTTTTTATTGGGGTGGGGAGGG - Intronic
1109212014 13:59545839-59545861 GCTTTTTAGGGGCTGGTGTAGGG + Intergenic
1110307120 13:74001228-74001250 GGTTTTGAGAGGCTGGTGGAAGG + Intronic
1110391519 13:74980488-74980510 GCTTCTTAGAGGGTTGTGGGTGG - Intergenic
1111119258 13:83824094-83824116 GCTTTTTCCTGGCCTGTGCATGG + Intergenic
1112079209 13:95949929-95949951 GCTGTTTAGAGGCATGTGGTCGG + Intronic
1112356207 13:98676592-98676614 GCTTTGCAGTGGCTGGTAGATGG - Intergenic
1115286060 14:31713592-31713614 CCTTTTAAGTGGCATGTGGATGG + Intronic
1115414542 14:33116105-33116127 GCCTTTTAGTGGCTTTTTGGAGG + Intronic
1115557496 14:34555014-34555036 GCTTTCTAGTCACCTGTGGATGG + Intergenic
1117895883 14:60485931-60485953 GCTGTTTAGGTGCGTGTGGAAGG - Exonic
1117941839 14:60975705-60975727 GCTTTCAAGTGGCTTTTAGATGG - Exonic
1117957227 14:61131947-61131969 TCTCTTGAGTGGATTGTGGAGGG - Intergenic
1119566880 14:75636430-75636452 GCTATTCAGTGGTTTGGGGATGG - Intronic
1120147545 14:80995668-80995690 GCATTTTAGAGGCTGGGGGATGG + Intronic
1120191727 14:81445999-81446021 TCTTTTTGGTATCTTGTGGATGG + Intergenic
1125965193 15:43869217-43869239 GCTTTTTAGTAGGGTGTTGATGG + Intergenic
1126557275 15:50003611-50003633 GCTGTTTAGTGCCTTGTGCCTGG - Intronic
1129907863 15:79202135-79202157 GCTTTTCCTTGGCTTGTGCAAGG - Intergenic
1130120999 15:81047535-81047557 GCTTTTTTGTGGCTCAGGGATGG + Intronic
1131665856 15:94570568-94570590 GCTTTTTATTTGCTTGTGTGGGG - Intergenic
1131869166 15:96743882-96743904 GCTTACTACTTGCTTGTGGAAGG + Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1137523318 16:49212100-49212122 GCTTTGCAGGGCCTTGTGGATGG - Intergenic
1137804330 16:51289084-51289106 GCTTGAGAGTGGCTTGTGGCAGG - Intergenic
1139923882 16:70475198-70475220 GCCCTTTTGTGGCTTGGGGATGG + Intronic
1140899369 16:79353823-79353845 CTTATTTAGTGTCTTGTGGATGG + Intergenic
1141773523 16:86106251-86106273 GCTGTTTGGTGGATGGTGGATGG + Intergenic
1145313710 17:21715831-21715853 GCTTTTCCTTGGCTTGTAGACGG - Intergenic
1145712149 17:26987804-26987826 GCTTTTCCTTGGCTTGTAGATGG - Intergenic
1146679370 17:34796095-34796117 GTTTTTGAGTGGCTTGAGAAGGG - Intergenic
1147160702 17:38568011-38568033 GCCTGTCAGGGGCTTGTGGATGG - Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149046087 17:52246923-52246945 CTTTTTTAGTGGCTCTTGGAAGG + Intergenic
1149935033 17:60796405-60796427 GCTTGTTATTGGCCTGTTGAGGG + Intronic
1155803583 18:30139405-30139427 GCTTTTTAGTTTCTAATGGAAGG - Intergenic
1157620455 18:49014353-49014375 GCTTCTGGGAGGCTTGTGGAGGG - Intergenic
1159482771 18:69012050-69012072 GCTTTCTAGTGGCTCTTGGCAGG + Intronic
1160064910 18:75565631-75565653 GCGTTTTGGGGGCTTGTGGCTGG + Intergenic
1160076214 18:75680110-75680132 GCATTTCAGGGGCATGTGGAGGG - Intergenic
1161707506 19:5829094-5829116 TATTTTTAGTAGCTGGTGGAAGG - Intergenic
926999425 2:18777408-18777430 GCTTTTAAGTGGTTTGAGGCTGG - Intergenic
928097508 2:28413528-28413550 GCTTCTTTGAGGCTTGGGGAGGG - Exonic
936075447 2:109398737-109398759 GCCTTTCAGCGGCGTGTGGATGG + Exonic
937616495 2:123929032-123929054 TCTTTTTAGTTTTTTGTGGAGGG + Intergenic
938395985 2:130948434-130948456 GTTATTTAGAGTCTTGTGGAAGG + Intronic
940569136 2:155407681-155407703 GCTTTTTAGTTTCTAGTGGGAGG + Intergenic
941178288 2:162227520-162227542 AAGTTTTAGTGGCCTGTGGAAGG - Intronic
941413368 2:165188073-165188095 GCTTTTTGCTGGGATGTGGAGGG + Intronic
941510933 2:166408338-166408360 GCTTTTAAATGGATTGTTGATGG - Intronic
942929424 2:181471821-181471843 TCTTTCTTGTGGCTTCTGGAGGG + Intronic
942959756 2:181816026-181816048 GTTTTTGAGTGGCTTATTGAAGG - Intergenic
943478809 2:188392279-188392301 GCTTTTTATTGGTTTGTTCAGGG + Intronic
943651754 2:190464889-190464911 GGTTTTTAGTGGCTTTTGGTGGG + Intronic
943653858 2:190486626-190486648 GTTTTTTAGTTACTTGAGGAAGG + Intronic
945206879 2:207341877-207341899 TCTTTTCAGTGGCTTCTTGAAGG - Intergenic
946447650 2:219753521-219753543 GCTTTTTAGAGGCTGGTTGTGGG + Intergenic
948344801 2:237286690-237286712 GCTTATTAGTGGGTTGGGGGTGG + Intergenic
1171101524 20:22388302-22388324 CCTTTTAAGTTGCTTGGGGATGG + Intergenic
1173350294 20:42238855-42238877 GCTGTTTAGTGACTTGTTCAAGG - Intronic
1175371862 20:58497525-58497547 CCTTTCTTGTGGCTTGTAGATGG + Intronic
1180577212 22:16789259-16789281 GCTTTTTAGTGGTGTGTTTAGGG - Intronic
1181375706 22:22456326-22456348 GCTTTTTAATGACATGTGCAGGG - Intergenic
949360585 3:3228119-3228141 CTTTTTTAGTGGCTTCTAGAAGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950777268 3:15361533-15361555 ACTTTTCAGTGGTTTGAGGAAGG - Intergenic
950821493 3:15764430-15764452 GATTTTTAGTTACTTGTAGAAGG - Intronic
951137101 3:19117480-19117502 TCTTCTTATTGGCTTGTGTAGGG - Intergenic
952419483 3:33118425-33118447 GCCAATTAGTGGCTTGTGGCAGG - Intronic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
954672253 3:52297394-52297416 GGTTTGTAGTGGCTGGAGGAGGG + Intergenic
955377820 3:58412683-58412705 AGCTTTTAGTGGCTTGGGGAAGG + Intronic
960203642 3:114868303-114868325 GCTTTTTATCCGCTTGGGGAAGG - Intronic
963441952 3:145351757-145351779 CATTTTTAGTTGCTTGTGAAAGG - Intergenic
963576127 3:147062649-147062671 GCTTTTTAGATTCTAGTGGAAGG + Intergenic
964030105 3:152128415-152128437 GCTTGTTAGTGGTATGAGGAGGG + Intergenic
966955300 3:184871018-184871040 GCTGCTTAGTGGCGTGTGGAAGG + Intronic
968379125 4:73853-73875 GCTTGTGACTGGCATGTGGAGGG + Intronic
972118664 4:35671831-35671853 CCTTTTTACTGGTTTATGGAAGG + Intergenic
974648907 4:64729249-64729271 GCTTTTTAGTTTCTAGTGGAAGG + Intergenic
974870878 4:67639651-67639673 GCATTTTGGGGGGTTGTGGAAGG - Intronic
975950373 4:79763043-79763065 CCTTTTTGTTGGCTTGTAGATGG + Intergenic
977073178 4:92418722-92418744 CCTTTTTAGGGGGGTGTGGAAGG - Intronic
979008710 4:115338860-115338882 ACTTTTTAGTGGTTTGTTTATGG + Intergenic
980937246 4:139237735-139237757 GCTTTTTAGTTTCTAGTAGAAGG - Intergenic
981680644 4:147393758-147393780 ACATTTTATTGACTTGTGGATGG + Intergenic
983504553 4:168538955-168538977 CCTTTTTAGGGGCTGGGGGAGGG - Intronic
984183287 4:176511720-176511742 GTTTTCTAGTTGCTTGTGGTGGG - Intergenic
984946656 4:184974078-184974100 CCTTTTCCTTGGCTTGTGGATGG + Intergenic
985980308 5:3457020-3457042 GCTCCTTTGTGGCATGTGGAAGG - Intergenic
987406748 5:17529468-17529490 GCATTTTAATGGGATGTGGAGGG + Intergenic
988391208 5:30634594-30634616 GTTTTTTAGGGGCTTGAGGAAGG - Intergenic
989468639 5:41788219-41788241 ACTTTTTAGTGGCTTCTCTAGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
991990941 5:72338493-72338515 TCTTTTAAGTGGCTTGAGGGAGG + Intronic
992416078 5:76552584-76552606 GCATTTTTGTGTTTTGTGGAAGG - Intronic
993140818 5:84031004-84031026 GCCTGTTACTGGCTTGTGAATGG + Intronic
993803672 5:92376228-92376250 GCTTTAAAGTAGCTTTTGGAAGG + Intergenic
996332209 5:122342480-122342502 GCTATTAAGTGGCATGTGGATGG - Intronic
997734096 5:136200804-136200826 GCTTTTGAGCTGCCTGTGGATGG + Intergenic
998242428 5:140460005-140460027 AATTGTTTGTGGCTTGTGGAAGG + Intronic
1002393893 5:178938603-178938625 GTTTTTTAGTTGGCTGTGGAAGG + Intergenic
1004068866 6:12278334-12278356 GCTATCTAGTGGCTTGAGGAAGG - Intergenic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1004775441 6:18839279-18839301 GCTTTTCAGTGACCTGTTGAAGG + Intergenic
1008284456 6:49630451-49630473 GCTTTTTAGTGGCTCAAGGCTGG + Intronic
1009811615 6:68675095-68675117 GCAGTTTAGTTGCTTGTGGATGG + Intronic
1011278417 6:85652215-85652237 GCTGTTTTGTGGCTGGTGGCAGG + Intergenic
1011960179 6:93079103-93079125 GCTATTTTGTGGTTTGGGGAAGG - Intergenic
1012170145 6:96006795-96006817 GTGTTTTAGTGCTTTGTGGAAGG + Intergenic
1012649306 6:101733838-101733860 ATGTTTTAGTGTCTTGTGGAAGG - Intronic
1012846030 6:104390003-104390025 GTTTTTTAGTGGATTCTGTAGGG - Intergenic
1013227511 6:108130969-108130991 GCGTTCTAGTGTTTTGTGGAAGG - Intronic
1014053699 6:116988293-116988315 GCTTTCTAGTGGCTTAAGGTAGG + Intergenic
1014451053 6:121582245-121582267 GCTTATTAGTTGCTTGTGATGGG + Intergenic
1015351947 6:132230382-132230404 ACATGTTAGTGGCTTGGGGAAGG - Intergenic
1015722769 6:136262410-136262432 AAGTTTTAGTGGCTTTTGGATGG - Intronic
1016402730 6:143698444-143698466 GCTTTTCAGTGGCTTTTAAATGG + Intronic
1018932255 6:168248665-168248687 GCTTTGTGGTGGCTTTTAGAAGG + Intergenic
1024328876 7:48136647-48136669 GCTTTTTAGTTTCTAGTAGAAGG - Intergenic
1024861949 7:53854147-53854169 GCTTTCCCGTGGGTTGTGGATGG + Intergenic
1026411300 7:70125848-70125870 GTTTTTTAGTTGCTTGAGGTGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027707457 7:81552118-81552140 GCTTTTTAGTTTCTAGTGGAAGG + Intergenic
1029275255 7:99400158-99400180 GCTTTTTAAAGGCTACTGGAGGG + Intronic
1030144155 7:106335652-106335674 GTTTTTTAGTTTCTAGTGGAAGG + Intergenic
1031117527 7:117684037-117684059 GCATTTCTGTGACTTGTGGAAGG - Intronic
1031884130 7:127228115-127228137 GCTTTTTACTGCCTTTTAGATGG - Intronic
1032696055 7:134337304-134337326 GCTTTTTAGTGACTTCTGGAAGG + Intergenic
1033288041 7:140059435-140059457 GCTTATCAGACGCTTGTGGATGG - Intronic
1033803635 7:144929765-144929787 GCTTTTAGGAGGCTTGAGGAGGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035714452 8:1743409-1743431 GCTCTTTAGTGTCCTCTGGAGGG + Intergenic
1036186968 8:6630884-6630906 CCTTTTTAGTGGCTGGTGAAAGG - Intronic
1036797344 8:11765853-11765875 GATTTTTAGTCACTTGTTGAAGG + Intergenic
1037787442 8:21911293-21911315 GCTTTTGAGGAGCTGGTGGAGGG - Intronic
1039234573 8:35487903-35487925 GTTTTCTAGTGGTTTGTGGAAGG + Intronic
1040863691 8:52026256-52026278 CCTTTTTAATTGCTTCTGGAAGG - Intergenic
1041832224 8:62166862-62166884 GCTTTTTTGTGTCTTTTGCATGG - Intergenic
1043598123 8:81907584-81907606 GTTTTCTAGTTGTTTGTGGAAGG - Intergenic
1044434569 8:92146887-92146909 GCTTTCTAATGGATTGTAGAGGG + Intergenic
1051114761 9:13682107-13682129 GCCATAGAGTGGCTTGTGGAAGG - Intergenic
1053044601 9:34904798-34904820 GCTTGTTAGTGGCCTGTTCAGGG + Intergenic
1053542613 9:38990387-38990409 GTTTGTTATTGGTTTGTGGAGGG + Intergenic
1053807067 9:41813904-41813926 GTTTGTTATTGGTTTGTGGAGGG + Intergenic
1054623525 9:67373523-67373545 GTTTGTTATTGGTTTGTGGAGGG - Intergenic
1054796607 9:69307949-69307971 GCTTTTGTGTTTCTTGTGGAAGG - Intergenic
1055178303 9:73349204-73349226 GTTTTCTAGTGGTTTGTGGTAGG - Intergenic
1057490210 9:95514964-95514986 GCATTTTATAGCCTTGTGGAAGG + Intronic
1057584630 9:96318147-96318169 GCTTTTAAGAGGCTTCTGGAGGG - Intergenic
1058927178 9:109678015-109678037 GCTTGTTAGTGGCCTGAGCAAGG + Intronic
1059925642 9:119206518-119206540 CCCTTTTTCTGGCTTGTGGATGG - Intronic
1060008743 9:120024819-120024841 GCTTCTTGGTGGCTTGTGTTAGG - Intergenic
1060052273 9:120385905-120385927 GCTTGTAAGTGGGTGGTGGAAGG - Intergenic
1185922981 X:4114517-4114539 GCTTTTGGGTGACTTGGGGAGGG + Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186842074 X:13494387-13494409 GCTGTTCAGTGGATTGTAGAAGG + Intergenic
1189057587 X:37714588-37714610 TATTTTAAGTGGCTTCTGGAAGG - Intronic
1189577681 X:42372601-42372623 GATTTTTAATGGGTTTTGGATGG + Intergenic
1192100671 X:68261185-68261207 GCTTTTTTGTGGTTTCTGGTGGG - Intronic
1193774626 X:85626879-85626901 GCCTTTGTGTGGTTTGTGGATGG + Intergenic
1193882271 X:86937377-86937399 GGTTGTTACTGGCTTGTGCAGGG + Intergenic
1194252800 X:91599428-91599450 GGTTTTCAGTGGCTGGGGGAAGG + Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195924486 X:110012158-110012180 GCTTTTTAGTGGCTTGTGGATGG + Intronic
1197059203 X:122156533-122156555 GCTTTCCAGTAGCTGGTGGAAGG + Intergenic
1197554348 X:127936275-127936297 GCTTCTTAGGGCCTTTTGGACGG + Intergenic
1198362833 X:135912997-135913019 CCTTTTTCGTAGCTTCTGGAAGG - Exonic
1199951469 X:152709519-152709541 CCTTATTCGTGGCTTGTAGATGG + Intergenic
1199958214 X:152758941-152758963 CCTTATTCGTGGCTTGTAGATGG - Intergenic
1200571738 Y:4840668-4840690 GGTTTTCAGTGGCTGGGGGAAGG + Intergenic
1201225590 Y:11815748-11815770 GCCTTTTAGGGTCTGGTGGAGGG - Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic