ID: 1195926117

View in Genome Browser
Species Human (GRCh38)
Location X:110026491-110026513
Sequence TTGGACTCCAATACATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195926117_1195926121 8 Left 1195926117 X:110026491-110026513 CCTGGAGATGTATTGGAGTCCAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1195926121 X:110026522-110026544 ACCTCAGAGCCGTGGGTAATAGG 0: 1
1: 0
2: 1
3: 3
4: 67
1195926117_1195926119 0 Left 1195926117 X:110026491-110026513 CCTGGAGATGTATTGGAGTCCAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1195926119 X:110026514-110026536 TAGTTAGAACCTCAGAGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 52
1195926117_1195926120 1 Left 1195926117 X:110026491-110026513 CCTGGAGATGTATTGGAGTCCAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1195926120 X:110026515-110026537 AGTTAGAACCTCAGAGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195926117 Original CRISPR TTGGACTCCAATACATCTCC AGG (reversed) Intronic
900796702 1:4712444-4712466 CTGGAGTCCAACACATTTCCGGG + Exonic
904137973 1:28328773-28328795 TTCTACACAAATACATCTCCAGG + Intergenic
907759923 1:57347647-57347669 TTGGACAACAAAACATCTCTAGG - Intronic
909838313 1:80285849-80285871 TCAGACTCAAATCCATCTCCTGG - Intergenic
912704609 1:111902627-111902649 TTGGAATCCAAAGGATCTCCTGG - Intronic
914232135 1:145772852-145772874 TTGGTATCCCACACATCTCCTGG + Intronic
919336536 1:196243794-196243816 TTTGATTCCAACACAGCTCCAGG - Intronic
919752705 1:201048206-201048228 TTCGACTCCACTAAATCTGCAGG - Intronic
922862640 1:228832412-228832434 TTTGACTTCAGTACATCTTCTGG - Intergenic
923330058 1:232915363-232915385 TGGGACACCAATACTCCTCCAGG - Intergenic
924525018 1:244838513-244838535 TTGGCTTCAAATACGTCTCCTGG - Intronic
1064506691 10:16038889-16038911 TTAGATTCCAAAACATCTCAAGG - Intergenic
1065088928 10:22209844-22209866 TGGGGCTCCAATGCATCTGCTGG + Exonic
1065904837 10:30241029-30241051 ATGGACCACAATACATCTTCTGG - Intergenic
1066663507 10:37759847-37759869 CTGGACACCGATGCATCTCCAGG - Intergenic
1069762401 10:70820985-70821007 GTGGACTCCAGGTCATCTCCAGG - Intronic
1085962627 11:81480716-81480738 CTGCTCTCCAATACATCTTCAGG + Intergenic
1086978162 11:93161560-93161582 TTTGACTCCAATAAATGCCCAGG + Intronic
1091848056 12:3672826-3672848 TTTGCCTCCAAGACCTCTCCAGG - Intronic
1092522155 12:9286153-9286175 TCGGACTTCAAGACAGCTCCAGG - Intergenic
1092545127 12:9445703-9445725 TCGGACTTCAAGACAGCTCCAGG + Intergenic
1094507820 12:31076346-31076368 TCGGACTTCAAGACAGCTCCAGG - Intronic
1102761068 12:115385695-115385717 CTGGGCTCCAATACATATCCAGG - Intergenic
1106690823 13:32114102-32114124 TTTGACTCCTAAACATCTCTGGG - Intronic
1108802462 13:54116316-54116338 TTGTTCTCCATTGCATCTCCTGG - Intergenic
1113832240 13:113305116-113305138 TTGGAATCCATTACTTTTCCAGG + Intronic
1114973928 14:28070182-28070204 TTGGACTCAAATGATTCTCCTGG + Intergenic
1117376410 14:55122076-55122098 TTGAATACCAGTACATCTCCAGG + Intergenic
1119435196 14:74594092-74594114 TGGGACTCAAACACGTCTCCAGG + Intronic
1119436136 14:74599190-74599212 TGGGACTCAAACACGTCTCCAGG + Intronic
1130900263 15:88201714-88201736 TCGGACCCCAAGACATCTGCAGG - Intronic
1137314248 16:47299776-47299798 TTGGACTGCAATATAACCCCAGG + Intronic
1139007390 16:62589691-62589713 TTGCACTCCAAGACAGCTCCTGG - Intergenic
1142783720 17:2203143-2203165 TGGTACTCCAATAGATTTCCTGG + Intronic
1151961910 17:77410003-77410025 TTGGACTCCACTTCCTCTCCGGG + Intronic
1161125820 19:2556599-2556621 TTGGCCTCCAATGCAGCCCCGGG - Intronic
1164339625 19:24376949-24376971 TTGCACTCCCATATATCTCTTGG - Intergenic
1164469889 19:28521375-28521397 TTGGTCTCCATTACAACACCTGG + Intergenic
925070724 2:965126-965148 TTGGACCCCAATCCTCCTCCTGG + Intronic
925070738 2:965165-965187 TTGGACCCCAATCCTCCTCCTGG + Intronic
925070766 2:965242-965264 TTGGACCCCAATCCTCCTCCTGG + Intronic
925070780 2:965281-965303 TTGGACCCCAATCCTCCTCCTGG + Intronic
925070794 2:965320-965342 TTGGACCCCAATCCTCCTCCTGG + Intronic
927311859 2:21640668-21640690 TTGGATTCCAATTACTCTCCCGG - Intergenic
931410025 2:62020469-62020491 TTGGACTCCCAAACATCTACAGG - Intronic
931689945 2:64827136-64827158 TCAGCCTCCAATACCTCTCCTGG + Intergenic
935585656 2:104797847-104797869 TTGGTCTCTAAAACCTCTCCTGG - Intergenic
936636130 2:114260631-114260653 GTGGACTCCAGCACATCCCCTGG + Intergenic
942103343 2:172607879-172607901 TTACACTCCAAGACATTTCCTGG + Intronic
1170413568 20:16116153-16116175 TTGGACTCCAATTATTCTCCAGG - Intergenic
1171409616 20:24937182-24937204 TTGGAGGCCAAAACTTCTCCTGG + Intergenic
1171961079 20:31494772-31494794 TTAGAATACAATACATTTCCTGG - Intergenic
1175609435 20:60338429-60338451 TTGGACTCTAAGTCATCCCCTGG + Intergenic
952681022 3:36092899-36092921 CTGTACTCAAATACATCTCTAGG - Intergenic
979263645 4:118676217-118676239 TTGGAATCCAGTTCATATCCAGG + Intergenic
985063599 4:186101537-186101559 TGGGACTTCAACACATCTTCTGG + Intergenic
986336271 5:6758287-6758309 TGGGACTCCAAAGCCTCTCCAGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989451982 5:41597371-41597393 TTGGACTCCAAGACATGCACTGG - Intergenic
1001316426 5:170644241-170644263 ATGGACACCATTACATCCCCAGG - Intronic
1007561053 6:42808726-42808748 TAGGCCTCCAAGACAGCTCCTGG + Intronic
1012614911 6:101264998-101265020 TAGGACTCTCATAAATCTCCAGG + Intergenic
1014988046 6:128036290-128036312 TTTGTCTCTAAAACATCTCCTGG - Intronic
1022849133 7:34241906-34241928 TTGGAATCAAATATATTTCCTGG + Intergenic
1032480198 7:132239967-132239989 TTAAACTCGAATACATCTCTGGG - Intronic
1033215372 7:139489742-139489764 TTGGTCTCCAAAATATCACCTGG - Intergenic
1035971321 8:4252461-4252483 TTACACTCTAATACATTTCCAGG + Intronic
1036419836 8:8585366-8585388 TTGTACTCCAAACCATCTGCAGG - Intergenic
1037077593 8:14740169-14740191 ATTGACTTTAATACATCTCCTGG + Intronic
1043355216 8:79403571-79403593 TTGGACCCCAAAACATATCTGGG + Intergenic
1045342958 8:101270621-101270643 TTGGACTGCATCACATCACCAGG + Intergenic
1050351488 9:4744341-4744363 TAGGACTTCAATATATCTCCTGG - Intergenic
1052188420 9:25627268-25627290 TTGAACCCATATACATCTCCTGG - Intergenic
1055238169 9:74149481-74149503 TTGAAGTCCACGACATCTCCTGG - Intergenic
1060250609 9:121983888-121983910 TTGGACTCTAACACATTCCCTGG - Intronic
1061627646 9:131850801-131850823 TGGGATTCCCATACACCTCCTGG + Intergenic
1187529507 X:20083806-20083828 TGAGACTCCAAAATATCTCCTGG + Intronic
1187849848 X:23581117-23581139 TTGGACACAGATACATCTGCAGG + Intergenic
1191583943 X:62798711-62798733 ATGGACTCCAAAATATCTCGTGG + Intergenic
1191945442 X:66529802-66529824 TTTGATTACAATACGTCTCCAGG + Intergenic
1192087050 X:68110597-68110619 TTGGACTCAAAGACTCCTCCAGG + Intronic
1194967956 X:100310942-100310964 CTGGACTCCAAGAATTCTCCTGG + Intronic
1195926117 X:110026491-110026513 TTGGACTCCAATACATCTCCAGG - Intronic
1197892095 X:131278394-131278416 TGGGACTCCAACACTGCTCCTGG - Intronic