ID: 1195927256

View in Genome Browser
Species Human (GRCh38)
Location X:110038412-110038434
Sequence TCCCTGAGCCAAAGTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195927256_1195927263 11 Left 1195927256 X:110038412-110038434 CCATGCCCACTTTGGCTCAGGGA 0: 1
1: 1
2: 2
3: 32
4: 287
Right 1195927263 X:110038446-110038468 TGAGGAACAGCCTCCCTTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 167
1195927256_1195927260 -7 Left 1195927256 X:110038412-110038434 CCATGCCCACTTTGGCTCAGGGA 0: 1
1: 1
2: 2
3: 32
4: 287
Right 1195927260 X:110038428-110038450 TCAGGGAGATGGTCCAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 230
1195927256_1195927262 10 Left 1195927256 X:110038412-110038434 CCATGCCCACTTTGGCTCAGGGA 0: 1
1: 1
2: 2
3: 32
4: 287
Right 1195927262 X:110038445-110038467 CTGAGGAACAGCCTCCCTTTTGG 0: 1
1: 0
2: 2
3: 10
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195927256 Original CRISPR TCCCTGAGCCAAAGTGGGCA TGG (reversed) Intronic
900313266 1:2044873-2044895 CCCCGGAGCCAGAGCGGGCAGGG + Intergenic
900365138 1:2308932-2308954 TCCCAGAGCCGAAGTGGGGAAGG - Exonic
901120678 1:6890538-6890560 TCCAAGAGCCTAAGTGGGCAAGG - Intronic
901183459 1:7357312-7357334 CTCCTGAGCCAAAAAGGGCAAGG - Intronic
903029842 1:20455991-20456013 TCCCTGGGCCAGGGTGGGCATGG - Intergenic
903305378 1:22409229-22409251 TCCCTGAGCCCAAGTGTTAACGG + Intergenic
903601875 1:24547910-24547932 TCCCTGAGGCCAGATGGGCAAGG + Intergenic
903697230 1:25216886-25216908 TGCCTGCTTCAAAGTGGGCATGG - Intergenic
905299993 1:36980540-36980562 TCCCTGAGTCCAGGTGGGAAGGG - Intronic
905326050 1:37152739-37152761 TACCAGAGCCAAAGTTGGGAAGG - Intergenic
906645100 1:47469096-47469118 TCCCTGTGGGAAAGTGGGCCAGG + Intergenic
907050926 1:51329723-51329745 TTCCTGGGCCCCAGTGGGCAGGG - Intronic
908514295 1:64876204-64876226 TCCCTGAGCCAACGGAGCCACGG + Intronic
908524461 1:64974811-64974833 TCCTTGAGCCAAAGTGGCCACGG + Intergenic
911061517 1:93751873-93751895 TACCAGAGCCAAAGCTGGCATGG - Intronic
912609824 1:111031504-111031526 TCCCTAAGCCAAGCTGGGAAGGG + Intergenic
913300522 1:117365549-117365571 TCCGTAAGCCAAAGTGGGGGGGG - Intergenic
914201941 1:145493033-145493055 TACCTGAGCCCAAGAGGTCAAGG - Intergenic
914235869 1:145810947-145810969 TACCTGAGCCCAAGAGGTCAAGG - Intronic
914481063 1:148066161-148066183 TACCTGAGCCCAAGAGGTCAAGG - Intergenic
915236449 1:154486756-154486778 TTCCTGAGCCAAGGCAGGCAAGG - Intronic
917312619 1:173692574-173692596 TCCCTGTGTCAAAGTGTGAAAGG - Intergenic
917642663 1:176997933-176997955 GACCTGAGCAAAAGTGGGGAGGG + Intronic
919978680 1:202629032-202629054 TTCCTGAGCCAGGCTGGGCACGG + Intronic
921165522 1:212504111-212504133 GCCCAGAGCCAGTGTGGGCAGGG - Intergenic
921632923 1:217456222-217456244 TCCCAAAGCCCAAGTGGGCATGG - Intronic
922548042 1:226473296-226473318 CCCCTGAGCAAAAATGGGCTTGG - Intergenic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
923125807 1:231033486-231033508 CCCCTGAGGCCAGGTGGGCAAGG - Intronic
923129925 1:231066280-231066302 TCCCTGAGCAACAGGAGGCAGGG - Intergenic
924121456 1:240803483-240803505 GCTCTGACCCAAAGTGGGTATGG - Intronic
1064772561 10:18738493-18738515 TCCCAGGGACAAAGTGGTCATGG + Intergenic
1065022475 10:21511054-21511076 TCCCAGAGCCAAACTAGGAAAGG - Intergenic
1065284443 10:24174209-24174231 TCTCTGAGTCATACTGGGCAGGG - Intronic
1066349826 10:34627109-34627131 CCCCTGAGCCAAGGAGGTCAAGG - Intronic
1067179967 10:43977767-43977789 TCCATCAGCCAAAGTGCCCAGGG - Intergenic
1067410586 10:46060790-46060812 TGCCTGGGCCAAAGTGGCCCAGG + Intergenic
1069828887 10:71270804-71270826 TCCCTGACCCAGGGTTGGCATGG - Intronic
1070350744 10:75590101-75590123 TACCTGAGCCCAAGAGGTCAAGG - Intronic
1072860999 10:99006123-99006145 TCTCTGAGCCCAAGTCTGCAGGG + Intronic
1073721888 10:106182158-106182180 TCTCTGAGTCAAGGTGGCCAGGG + Intergenic
1073934658 10:108616704-108616726 TACATGAGACAAAGTGGGCGTGG - Intergenic
1074658413 10:115621386-115621408 TCCCTGAGCCCAGGAGGTCAAGG - Intronic
1075392522 10:122102706-122102728 TCCATGAGCCAAAGTGCTGACGG - Intronic
1075616942 10:123897069-123897091 CCCCTGGGCCAAAGTGGGTGGGG - Intronic
1077087997 11:764217-764239 GCCCTGAGCCCAAGGGGCCAAGG + Intronic
1080353430 11:31412528-31412550 TCCCTAAGCCAAAGTGGAGTTGG - Intronic
1082796738 11:57383366-57383388 TCCCTGAGCCATGGAGGGCTGGG - Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085104901 11:73833938-73833960 TACCTGAGCCAGAGAGGTCAAGG - Intronic
1089642372 11:119856318-119856340 TCCCTGATCCAATGTGGGAGGGG + Intergenic
1089837306 11:121382375-121382397 TGCCTGAGCCCAAGAGGTCAAGG - Intergenic
1090304736 11:125681502-125681524 TCCCTAGGCCTAAGAGGGCAGGG - Intergenic
1090880086 11:130825492-130825514 TCCATGAGCCTTGGTGGGCAGGG - Intergenic
1092337280 12:7644174-7644196 TCCCTAAGCCAAGCTGGGAAAGG + Intergenic
1092923871 12:13256780-13256802 TCCCAGAGCCTAAATAGGCACGG - Intergenic
1093591749 12:20909792-20909814 TCCCTGAGCCTAGGAGTGCAAGG - Intronic
1093683574 12:22030734-22030756 TCCAGAAGCCCAAGTGGGCATGG - Intergenic
1093787522 12:23210062-23210084 TCCCTGAGGCAAAGTGGGAGAGG - Intergenic
1094476951 12:30847936-30847958 TCCCTAAGCCAAGCTGGGAAGGG + Intergenic
1095991706 12:48039238-48039260 TGGCTGAGGCAGAGTGGGCAGGG + Intergenic
1096524029 12:52200146-52200168 TCCCTGAGACATGGTGGGCAAGG - Intergenic
1096614805 12:52826092-52826114 ACCCTGAGCTAAGGAGGGCAGGG - Intronic
1097307952 12:58089894-58089916 CACCTGAGCCAAACTGGGCGTGG - Intergenic
1100415711 12:94371724-94371746 TCCTAGAGCCAAAGAGGGCAAGG + Intronic
1101538449 12:105642266-105642288 TACCTGAGCCAAAGTGGTGATGG + Intergenic
1101902403 12:108800394-108800416 TCACTGAGCCAAAGAGGGCTAGG - Intronic
1103878945 12:124151102-124151124 TCCCTCAAACAAAGTGAGCAGGG - Intronic
1103945350 12:124523109-124523131 TCCCTTAGCCAACGTGGTCAGGG - Intronic
1104962738 12:132495866-132495888 TCCCAGAGCCAAAGCAGGCCAGG - Intronic
1105331557 13:19421365-19421387 GCCCTGAGCCATGGTGGGCACGG - Intergenic
1105880227 13:24599185-24599207 GCCCTGAGCCATGGTGGGCACGG + Intergenic
1105919605 13:24949681-24949703 GCCCTGAGCCATGGTGGGCACGG - Intergenic
1105924629 13:24996514-24996536 TCCCTAAGCCAAGCTGGGAAGGG + Intergenic
1107485254 13:40820522-40820544 GCCCCGAGCCATGGTGGGCATGG - Intergenic
1108719473 13:53116546-53116568 TACCTGATCCAAAATGGGGAAGG + Intergenic
1108957717 13:56182339-56182361 GCCCTCAGCCAAAGGAGGCAGGG + Intergenic
1110404446 13:75134125-75134147 GCCCAAACCCAAAGTGGGCAAGG + Intergenic
1110909008 13:80932037-80932059 TCTCTGAGCCAAAGTGTTCTGGG - Intergenic
1112509500 13:99997376-99997398 GCCCTGAGTCAAGGTGGGCGGGG + Intergenic
1113017745 13:105847029-105847051 TACCTGGGCCAAAGTGGATATGG + Intergenic
1114550237 14:23528581-23528603 TCACAGAGGCAGAGTGGGCAGGG - Intronic
1115436234 14:33377881-33377903 TCCCTGATGCAAATTAGGCATGG - Intronic
1118218186 14:63829331-63829353 TGCTTGAGCCCAAGTGGTCAAGG + Intergenic
1118586552 14:67359187-67359209 TCCCTAAGCCAAAGTGGGGATGG - Intronic
1118764664 14:68901811-68901833 TCCCGGAGCAAAACTGGGCCAGG + Intronic
1121040331 14:90741071-90741093 TCCCACAGCTAAAGGGGGCAAGG + Intronic
1121730976 14:96187051-96187073 CACTTGAGCCAAAGTGGCCAGGG + Intergenic
1122178605 14:99938638-99938660 TCCCTGAGCCCAGGTGGGCCTGG - Intronic
1122317602 14:100835230-100835252 TCTCAGGACCAAAGTGGGCACGG + Intergenic
1123836624 15:24201365-24201387 ACCCTGAGTCATATTGGGCAAGG - Intergenic
1123845854 15:24301181-24301203 ACCCTGAGTCGTAGTGGGCAAGG - Intergenic
1124650162 15:31468548-31468570 ACCCTGAGGCAAACTGGGAAGGG - Intergenic
1124655351 15:31502805-31502827 TCCCTGAGCCACACAGGGAAGGG + Intronic
1125591476 15:40857074-40857096 TCTCTGAGGCACAGTGGGCCTGG - Exonic
1126248822 15:46542198-46542220 TGCGTGAGCCGAAGGGGGCAAGG - Intergenic
1126403758 15:48301745-48301767 TCCCTGAGCCACTGTGCCCATGG + Intronic
1128350456 15:66885050-66885072 TCACTGAGTCAGAGAGGGCAGGG + Intergenic
1129269406 15:74411511-74411533 TCCCTGGGAGAAGGTGGGCATGG - Intronic
1129984725 15:79908061-79908083 TCCCTGTGCCAAATTGCCCAGGG - Intronic
1130770678 15:86920499-86920521 TCCATGATCAAAAGTGGGGAAGG + Intronic
1130803910 15:87298216-87298238 TCCCTAAGACAAAGTCAGCAGGG - Intergenic
1131952247 15:97693375-97693397 TCACTGAGCCAAAGGGGGATGGG + Intergenic
1132390287 15:101433689-101433711 TACCTGAGGCTGAGTGGGCAGGG + Intronic
1132489584 16:219012-219034 TCACTGAGCCGAAGAGGTCAAGG + Intronic
1133940622 16:10306140-10306162 TGACTGAGCCCAAGAGGGCAAGG - Intergenic
1134634454 16:15781635-15781657 TGCCTGAGCCCAACAGGGCAGGG - Intronic
1135722569 16:24829775-24829797 TGTCTGAGACAGAGTGGGCAAGG + Intergenic
1137378388 16:47974873-47974895 TGCCTGAGCCAGAGCGGTCAAGG + Intergenic
1137751311 16:50863082-50863104 TCCGGGAGCCCAAGTGTGCAGGG + Intergenic
1138332433 16:56225869-56225891 TCCTTTAGCTAAAGTAGGCAGGG + Intronic
1138350752 16:56345118-56345140 TCCCTGAGCAGAAGGGGGCGGGG + Exonic
1138793357 16:59936326-59936348 TACCTCAGCCAAAGTGATCAAGG - Intergenic
1139699528 16:68699239-68699261 TCCCTGAGCCCACTTAGGCATGG - Exonic
1140144777 16:72295918-72295940 TCTCTGAGCTAAGGTGGTCAGGG - Intergenic
1144732812 17:17538179-17538201 TACCTGAGCCCAACTGGACAGGG + Intronic
1144738935 17:17570508-17570530 ACCCTGAGTCAGAGAGGGCAGGG + Intronic
1145181016 17:20752417-20752439 TGCCTGAGCCCAGGTGGTCAGGG - Intergenic
1145938313 17:28727545-28727567 TCCCTGTATCAGAGTGGGCAAGG - Intronic
1146799200 17:35805178-35805200 TCCCTGAGGCAGAGTGGGAGGGG + Intronic
1146831763 17:36075762-36075784 TGCCTGAGCCAAAATGAGCAGGG + Intergenic
1147113158 17:38278760-38278782 TCCCTGGGCCCAGGTGGTCAAGG + Intergenic
1148416462 17:47510474-47510496 TCCCTGGGCCCAGGTGGTCAAGG - Intergenic
1148765271 17:50035215-50035237 GCCCTGAGCTAGTGTGGGCAGGG - Intergenic
1150216723 17:63475547-63475569 TCTCCAAGCCAAACTGGGCAGGG + Intergenic
1151154930 17:72117714-72117736 TTCCTTAGCAAAAGTGGGGACGG - Intergenic
1152456557 17:80420419-80420441 CCCATGACCCAAAGTGGGGAGGG - Intronic
1152973200 18:185776-185798 TCCTTGAGCCCAAGAGGTCAAGG - Intronic
1153086679 18:1296509-1296531 TCCCGAAGCCCAAGTGGGCGTGG + Intergenic
1155264685 18:24079883-24079905 TCCCTGAGCCTGAGAGGTCAAGG - Intronic
1155592527 18:27444374-27444396 TCCTTGAGCCCAAGAGGTCAAGG - Intergenic
1158793590 18:60813377-60813399 TCTTTCAGACAAAGTGGGCAGGG + Intergenic
1159960974 18:74555537-74555559 GTCCTGTGGCAAAGTGGGCAAGG - Intronic
1160543952 18:79640627-79640649 TCCCAGAGCCAAAGTGAGTGTGG - Intergenic
1163174003 19:15551743-15551765 GGCCTGAGCCCAAGGGGGCAGGG - Exonic
1165329514 19:35133835-35133857 ACCCTCAGCCTAGGTGGGCATGG + Intronic
1165975693 19:39674540-39674562 TCCCTAAGCCAAGCTGGGAAGGG + Intergenic
1166570507 19:43793326-43793348 TCCCTGAGGCATGGTGGCCAAGG - Intergenic
1168057364 19:53870582-53870604 TCCCTGAGACAAAGGAGCCAGGG - Intronic
926058956 2:9793341-9793363 TCCCTTAGCCTCAGGGGGCAGGG - Intergenic
926126610 2:10276307-10276329 ACACTGAGCCAAAGTTGGCGGGG - Intergenic
926156093 2:10454737-10454759 GCCCTGAGCCATACAGGGCATGG - Intergenic
927241109 2:20920200-20920222 TCCCTAGGCAGAAGTGGGCAAGG + Intergenic
927744747 2:25608023-25608045 CCCCTGACCCAAAGTGTCCACGG + Intronic
927843656 2:26460602-26460624 TCCAAGAGCCAGAGTGGGGAGGG + Intronic
928087737 2:28356328-28356350 GCCCTGAGCCAGAGGCGGCAGGG - Intergenic
929647739 2:43646078-43646100 TCCTTGACCCAAAGTGAGTAAGG - Intronic
931517656 2:63059294-63059316 TGCCTGAGCCAAAGCGGCCCTGG - Intergenic
933443754 2:82350174-82350196 TCCCAAAGCCGAAGTGGGCATGG - Intergenic
936441233 2:112555253-112555275 TCCCTGAGCCCAGGAGGTCAAGG + Intronic
937087067 2:119178636-119178658 CCCCAGAGCCAAAGTAGGGAGGG - Intergenic
937682948 2:124664237-124664259 TGCTTGAGCCCAAGTGGTCAAGG + Intronic
939143926 2:138389912-138389934 TTTCTGAGCCAAAGTTGGCATGG - Intergenic
939945894 2:148410511-148410533 TGCTTGAGCCAGAGTGGTCAAGG - Intronic
940723691 2:157309950-157309972 TCCCTGTGCCAAAGTCAGGAGGG + Intronic
941721521 2:168817683-168817705 TCCCTGGGCCAGAGTGAGCCGGG + Intronic
942304474 2:174592278-174592300 TCTCTAATCCCAAGTGGGCAGGG + Intronic
942324776 2:174766861-174766883 GCCGTGAGGGAAAGTGGGCAAGG + Intergenic
942330176 2:174815292-174815314 TGCCTGAGCCCAGGTGGTCAAGG + Intronic
942387021 2:175453133-175453155 TCCTTGAGCCCCAGTGGGCAAGG + Intergenic
942617946 2:177813998-177814020 TCCCTTAGCCACAGTGGAAAAGG + Intronic
944431227 2:199635733-199635755 TCCATCAGCCAGAGTGGGGATGG + Intergenic
946175555 2:217920038-217920060 TCCCTGGGCCGAAGCGGGCCTGG - Intronic
946568937 2:220999855-220999877 TGCCTGAGCCCAAGAGGGCCAGG - Intergenic
946620751 2:221560114-221560136 TCCTTGGGCAAAAATGGGCAGGG - Intronic
946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG + Intergenic
947144207 2:227049721-227049743 TTTCTAAGCCAAAGTGGGCACGG + Intronic
1168805440 20:669909-669931 TCCCTGTGCCCAAATGAGCAGGG + Intronic
1170848413 20:19981798-19981820 TTTATGAGCCAAAGTGTGCATGG + Intronic
1171308343 20:24125125-24125147 ACCCTGAGCCTATGTGGGAATGG + Intergenic
1172175806 20:32971132-32971154 ACCGTGAACCAACGTGGGCATGG + Intergenic
1174286242 20:49475721-49475743 TCCCTGAGCCTCAGCGGGTACGG - Intronic
1174326098 20:49780127-49780149 AGCCTGAGCCAAAATGAGCAAGG + Intergenic
1175112355 20:56657585-56657607 TCCCTTAGCGAGAGTGGTCAGGG + Intergenic
1175902224 20:62364508-62364530 TCACTGAGCCACAGAGGACAGGG + Intronic
1176341780 21:5705596-5705618 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176416004 21:6475146-6475168 TCCCTCACCCAGAGTGGGCTGGG - Intergenic
1176474034 21:7137748-7137770 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176503047 21:7618860-7618882 TGCCTGAGCCTGAGTGGTCAAGG - Intergenic
1176536101 21:8103665-8103687 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176741443 21:10607225-10607247 GCCCTGAGCCATGGTGGGCACGG + Intergenic
1176981043 21:15381251-15381273 TCCTGAAGCCAAAGTTGGCATGG - Intergenic
1177773324 21:25541244-25541266 TCTCTGATCCAAAGTGAACATGG - Intergenic
1178201750 21:30414849-30414871 TGCCTGAGTCAGAGTGGGGAAGG - Intronic
1179691504 21:43083480-43083502 TCCCTCACCCAGAGTGGGCTGGG - Intergenic
1181088534 22:20456562-20456584 TCCTTGAGACCAAGTGGACAAGG - Intronic
1181495016 22:23282827-23282849 TCCCTGAGACCAGGTGGGCTGGG + Intronic
1183360489 22:37380618-37380640 TCCCTGAGCCAGGCTGGCCAAGG + Intronic
1184704952 22:46204949-46204971 TTCCTGAGCCCAAGAGGTCAAGG - Intronic
1203241047 22_KI270733v1_random:20062-20084 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
951018256 3:17753520-17753542 TGACTGGGCCAAAGTGGGCTAGG + Intronic
952673682 3:36000805-36000827 TCCCTGAGACAGAGTGCCCAGGG - Intergenic
952897235 3:38085744-38085766 GACCTGTGCCACAGTGGGCAAGG + Intronic
953212681 3:40890278-40890300 TCCCTGTGCCAAAGTTGTCTAGG + Intergenic
953416201 3:42719352-42719374 TGCCTGAGGCAGAGTGGGGAAGG - Intronic
954637736 3:52080456-52080478 TACCTCAGCCACAGTGGGAATGG + Intronic
954684013 3:52360948-52360970 TCCCTGGGCAAAGCTGGGCAGGG + Intronic
955329958 3:58039109-58039131 TCCTTGAGCCCACGTGGTCAAGG - Intronic
955790225 3:62581595-62581617 TGCCTGAGCCCAAGAGGTCAAGG + Intronic
957020221 3:75118322-75118344 TCCGTGAGCCCCAGTGGGTAGGG + Intergenic
958178228 3:90023740-90023762 TCCCTGGGCCTTAATGGGCAAGG - Intergenic
960263616 3:115595581-115595603 TCCCTGAGACAATGTGGGAGGGG - Intergenic
960297694 3:115963835-115963857 TGCTTGAGCCCAAGAGGGCAAGG - Intronic
961143592 3:124575764-124575786 CCCCTGGGCCACAGTGGGAAAGG + Intronic
961653848 3:128430776-128430798 ATCCTTAGCCAAAGTGGGCACGG + Intergenic
968319693 3:197754746-197754768 TCCTTGAGCTCAAGTGGTCAAGG - Intronic
968326381 3:197820723-197820745 TCCCTGAGCCCAGGAGGCCAAGG + Intronic
968541170 4:1169166-1169188 GCACTGGGCCACAGTGGGCAGGG - Intronic
971282531 4:25252694-25252716 TGCCTGAGCCCAGGTGGTCAAGG - Intronic
972511644 4:39772489-39772511 CACCTGAGCCAAAGAGGTCAAGG + Intronic
973839171 4:54843390-54843412 TCCCTTAGGCAAAGTTGGCACGG - Intergenic
974647515 4:64714507-64714529 TCCCTAAGCCAAGCTGGGAAGGG - Intergenic
977830482 4:101585494-101585516 TCCTTGAGCCCAAGAGTGCAAGG - Intronic
978068222 4:104432798-104432820 TCTCTGAACCAAAATGGGAAAGG - Intergenic
979544269 4:121921725-121921747 CCTCTGTGCCAGAGTGGGCAGGG + Intronic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
983019125 4:162653457-162653479 TCAGGGAGCCAAAGTTGGCAGGG - Intergenic
983222719 4:165058249-165058271 TCCTTGAGCCACAGAGGTCAAGG - Intergenic
984441370 4:179774582-179774604 TGCCTGAGGCAGAGTGGGGAAGG - Intergenic
985780679 5:1869350-1869372 TCCCTCACCCGCAGTGGGCAGGG - Intergenic
985959921 5:3293617-3293639 TCCCTAAGCCAAGGTCTGCAGGG - Intergenic
986038337 5:3962178-3962200 TCGCGGAGGCAAAGCGGGCATGG - Intergenic
986659182 5:10043774-10043796 GCCCTGCGGCCAAGTGGGCATGG - Intergenic
990250831 5:53913217-53913239 TGCTTGAGCCCAAGAGGGCAGGG + Intronic
990256986 5:53981012-53981034 TCCCTCTGGCAAAGGGGGCAGGG - Intronic
992427669 5:76674776-76674798 GCCCAGAGCTAGAGTGGGCATGG + Intronic
992682785 5:79169375-79169397 TTCTTGAGCCAAAGAGGTCAAGG + Intronic
993884033 5:93395797-93395819 TCCCTGAACAATAGAGGGCATGG + Intergenic
995233803 5:109801640-109801662 TCCCTGAGCCGAAGTGGGCAAGG - Intronic
995259621 5:110087085-110087107 TCAGACAGCCAAAGTGGGCAGGG + Intergenic
995544837 5:113219747-113219769 TCCCTCAACCACAGTGGACAAGG + Intronic
995603384 5:113823688-113823710 TCCCTGAGACCAAGTGGGAGGGG + Intergenic
997195580 5:131977091-131977113 TCCCTGGGCCTGAGTGGGCCTGG + Intronic
997258763 5:132449371-132449393 GCCTTGAGACAAAGTGGGAAGGG + Intronic
997501476 5:134378084-134378106 TACCTGAGCCCAAGAGGTCAAGG + Intronic
998043295 5:138967152-138967174 ACCTTGAGCCAGAGTGTGCAGGG - Intronic
998868559 5:146530049-146530071 TCCCAAAGCCCAAGTGGGCCTGG - Intergenic
1000061085 5:157655714-157655736 TGCCTGAGGCAAGGTGGGGAAGG - Intronic
1000576051 5:162976295-162976317 TACCTGGGCCAGTGTGGGCAGGG + Intergenic
1000765370 5:165282975-165282997 TCCCTGCCCTAAAGTGGACACGG + Intergenic
1001094029 5:168762467-168762489 ACCCGGAGCCAGCGTGGGCAGGG - Intronic
1003501874 6:6709952-6709974 TCCAGGAGCCACAGTGGGAATGG + Intergenic
1004961982 6:20800421-20800443 TCCCTGAGGCAAATTGGTCTGGG + Intronic
1007402467 6:41611343-41611365 TCCCTGAGCCTTGGTGGGGAGGG - Intergenic
1009406422 6:63319044-63319066 TCCCTAAGGGAAACTGGGCAAGG - Intronic
1010127013 6:72444308-72444330 TCCTGAAGCCACAGTGGGCAGGG + Intergenic
1012950798 6:105515759-105515781 TGCCTGAGCCTAAGAGGTCAAGG - Intergenic
1013046503 6:106490772-106490794 TCCCTTAGCCAAATTTGCCAGGG - Intergenic
1013476151 6:110509040-110509062 TCCCAAAACCCAAGTGGGCATGG - Intergenic
1013961989 6:115911824-115911846 TGCCTGAGCTAAAGAGGGAATGG - Intergenic
1015376637 6:132517214-132517236 TGCCTGAGCCCAAGAGGTCAAGG + Intergenic
1015555712 6:134459434-134459456 TCCCTGAGCCCAGGAGGTCAAGG - Intergenic
1016061512 6:139636018-139636040 TCCCTGAGCCCAGGTGGGTCCGG + Intergenic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1019311786 7:365765-365787 CCCCTGAGATAAAGTGTGCAAGG + Intergenic
1019663480 7:2239360-2239382 CCCCTGAGGCTGAGTGGGCATGG - Intronic
1019737682 7:2658744-2658766 TGGCTGGGCCAAGGTGGGCAGGG + Intronic
1022530452 7:31063698-31063720 TCCCTGAGTGAAGGTGGGGATGG + Intronic
1025184649 7:56848137-56848159 TACCTGAGCCCAGGTGGTCAAGG - Intergenic
1025687281 7:63728825-63728847 TACCTGAGCCCAGGTGGTCAAGG + Intergenic
1026525015 7:71146059-71146081 TCCCTGAGCCAAAGAGGAGGTGG + Intronic
1026977758 7:74508771-74508793 TCCCAGGGACAAAGTGGGAATGG - Intronic
1027764502 7:82322533-82322555 TGCCTGAGCCCAAGAGGTCAAGG + Intronic
1029495341 7:100893416-100893438 ACCCTGGGCCACGGTGGGCATGG - Exonic
1029533444 7:101140896-101140918 CACCTGAGCCAAGCTGGGCATGG - Intergenic
1031992444 7:128207082-128207104 TCCCTGAGCCAACCTGGCCTGGG - Intergenic
1031999274 7:128254264-128254286 GGCCTGAGCCAAAGTGGTGAGGG + Intronic
1032088576 7:128896995-128897017 TGCCTGAGGCAGAGTGGGAAAGG - Intronic
1032790359 7:135238187-135238209 TCCCTGAGCCAAGGGGGGGCGGG + Intronic
1032851999 7:135803094-135803116 TCCCAGAGTCAGAGTAGGCAGGG - Intergenic
1033161709 7:139002501-139002523 TGCCTGAGGCAAGGTGGGAAAGG - Intergenic
1034534735 7:151719730-151719752 TCCCAGAGCCTATGTGGGCCTGG + Intronic
1035037297 7:155903655-155903677 TCCCTGCGACCAAGTGGGAAAGG + Intergenic
1035191579 7:157173805-157173827 TTCCTGAGAAAATGTGGGCAAGG + Intronic
1036696221 8:10976869-10976891 TGCCTGAGCCCCAGTGGGCTGGG + Intronic
1037582897 8:20256175-20256197 TCCCTGAGGCAGAGGGGGCTTGG + Intronic
1038253466 8:25927925-25927947 TTCCTGAGGCAATGTGGGCCAGG - Intronic
1038332503 8:26620000-26620022 ACCCTTAGACAAAGTGGGGAGGG - Intronic
1040095422 8:43437785-43437807 TCCCTGAGCCCAAGCTGGGAAGG + Intergenic
1042907707 8:73789406-73789428 TGCTTGAGCCAAGGTGGTCAAGG + Intronic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044278252 8:90327014-90327036 TCCCTAATCTCAAGTGGGCAGGG - Intergenic
1045640877 8:104249010-104249032 TTCTTGAGCCAAGGTGGTCAAGG - Intronic
1047441647 8:124884200-124884222 TCCCTGCTCCAAAGTTGGCCTGG - Intergenic
1048000104 8:130372253-130372275 TCCCTTAGCCAAATTGTGCAAGG - Intronic
1048121940 8:131591336-131591358 TGCCTGAGCCCAAGAGGTCAAGG - Intergenic
1048136641 8:131752779-131752801 TCACTGAGCCAGAGTGGGGAAGG + Intergenic
1048463147 8:134639442-134639464 TCCCTGGGGCATGGTGGGCAGGG + Intronic
1048504424 8:135007957-135007979 TCCCACAGCCAGAGTGGGAATGG - Intergenic
1049811784 8:144578552-144578574 TACATGAGCCAAAGTGTGCATGG - Intronic
1052917069 9:33931533-33931555 CCCATGAGCCACAGAGGGCAGGG + Intronic
1052990865 9:34518779-34518801 TCCCTGGATCAGAGTGGGCAGGG - Intronic
1052990885 9:34518864-34518886 TCCCTGGATCAGAGTGGGCAGGG - Intronic
1052990905 9:34518949-34518971 TCCCTGGATCAGAGTGGGCAGGG - Intronic
1053020096 9:34688684-34688706 TCTCTCAGCCAAACTGAGCAAGG - Intergenic
1053127752 9:35596616-35596638 TGCTTGAGCCCAAGAGGGCATGG + Intergenic
1053276598 9:36787950-36787972 TCCCTGAGTCACAGTGGGGAAGG - Intergenic
1054714922 9:68547532-68547554 GCTCTGATCCAAAGTGGCCATGG - Intergenic
1057420240 9:94906380-94906402 TGCCTGAGCCAAGGAGGTCAAGG + Intronic
1057567495 9:96178419-96178441 TCCCTGAAGCAAAGTCAGCATGG - Intergenic
1059677672 9:116555353-116555375 TCTCTGAGCCAAAGTGAGCTAGG + Intronic
1060452644 9:123757257-123757279 TCACCGACCCAAAGGGGGCAAGG + Intronic
1061347252 9:130036665-130036687 TCCCTGAACCATGGTGGGTAGGG - Intronic
1061378130 9:130238164-130238186 TCCCTGAGCCAATGGAGGTAGGG - Intergenic
1061461741 9:130745012-130745034 TATCTGAGACAAAGTGGGCAAGG + Intronic
1061962480 9:133995092-133995114 GCCCTGAGTCCAAGTGGACATGG - Intergenic
1203457373 Un_GL000220v1:3149-3171 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1188149172 X:26651145-26651167 TCCCTAAGCCAAGCTGGGTAGGG - Intergenic
1189953594 X:46256817-46256839 TCCCTGAACCAAAGTAGGAATGG + Intergenic
1190539248 X:51460126-51460148 TCCCTAAGCCAAGCTGGGAAAGG + Intergenic
1191664090 X:63680600-63680622 GCCCTGTGCCAAAGAGGCCACGG - Intronic
1191908908 X:66126836-66126858 TCCCTGAGACAGAGCGGGGAGGG - Intergenic
1192055171 X:67766477-67766499 TCCCTGAGGCAGAGTGAGCAAGG - Intergenic
1192072352 X:67954322-67954344 TCCTTGAGCCACAGAGTGCAGGG - Intergenic
1193353297 X:80486531-80486553 TCCCTGAGACAAAGTGTTCTTGG - Intergenic
1193572434 X:83160885-83160907 TCATTGAGCCAAAGAGGACAGGG + Intergenic
1195541595 X:106068638-106068660 TCCCAGAGACATAGTGGGCCAGG + Intergenic
1195737679 X:108030622-108030644 TCCTTGAGCCAAAGTAGGATCGG + Intergenic
1195856964 X:109342177-109342199 TCCATGATCCAAAGTTGTCATGG - Intergenic
1195927256 X:110038412-110038434 TCCCTGAGCCAAAGTGGGCATGG - Intronic
1201304237 Y:12537049-12537071 CCCCTGTGCCAAATTGTGCATGG - Intergenic
1202599773 Y:26581456-26581478 GCTCTGAGCCATGGTGGGCACGG + Intergenic