ID: 1195928067

View in Genome Browser
Species Human (GRCh38)
Location X:110046284-110046306
Sequence GGATAAAGAAGGCCCCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195928067 Original CRISPR GGATAAAGAAGGCCCCCTGT TGG (reversed) Intronic
900461442 1:2803917-2803939 GGATAAAGACGCCACCCTCTGGG + Intergenic
902309164 1:15567628-15567650 AGAAAAAGAAGGCCTTCTGTGGG - Intronic
904379548 1:30101699-30101721 GGATGAGGACGGCCTCCTGTGGG - Intergenic
904440884 1:30529715-30529737 GCATAAACAAGGCCCACTGCAGG + Intergenic
905506470 1:38483935-38483957 GGTGACAGAAGGCCTCCTGTCGG - Intergenic
906731134 1:48082126-48082148 GGATAAAGAAGACCTACTGTGGG + Intergenic
910192016 1:84604459-84604481 GGATCACGAAATCCCCCTGTCGG - Intergenic
915567907 1:156726756-156726778 TGTTGAAGAAGGCCCCCTGTCGG - Intronic
922531995 1:226351769-226351791 GGATGGAGAAGGCCCCCAGCTGG + Intergenic
1063378042 10:5565892-5565914 GGCTTAAGAAGCCCGCCTGTTGG + Intergenic
1064740016 10:18423413-18423435 GGAGAAAGAATTCCCCCTGTAGG + Intronic
1067302347 10:45023452-45023474 GGATAAAGGCTGCTCCCTGTGGG - Intergenic
1068726503 10:60308826-60308848 GGATAAACCAGGCCTCCTGGGGG - Intronic
1071570472 10:86693959-86693981 GGAGAAAAAAGGCCCCCTGCTGG - Intronic
1073189947 10:101644055-101644077 GGGGAACAAAGGCCCCCTGTGGG - Intronic
1073444813 10:103574372-103574394 GGATAAAAAACACTCCCTGTGGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077454803 11:2672098-2672120 GGAGAAGAAAGGTCCCCTGTGGG - Intronic
1080255778 11:30288984-30289006 GGAAACAGATGTCCCCCTGTAGG - Intergenic
1081578576 11:44335113-44335135 GGATAAAGAAGGCTGACTCTTGG + Intergenic
1091015150 11:132043884-132043906 GGTTAAAGAAGGCCCAATCTTGG + Intronic
1092170268 12:6370010-6370032 GGATAAAGAATGCCCACAGTGGG + Intronic
1093177677 12:15931418-15931440 GGATAACTTTGGCCCCCTGTTGG - Intronic
1103380618 12:120491417-120491439 CCAGAAAGAAGGCACCCTGTGGG - Intronic
1104523171 12:129494412-129494434 GGAAAATCAAGGCCACCTGTAGG + Intronic
1105444575 13:20441475-20441497 GGATAAACAAGGTGCCCTGACGG + Intronic
1105650782 13:22374717-22374739 GCAAAAAGAAGGGCCCCAGTTGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1117943324 14:60992089-60992111 GGATAAAGATGGAACCCTGGTGG - Intronic
1118456311 14:65948267-65948289 GGTTAAGGAAGGCTCCCTGAAGG + Intergenic
1119998604 14:79279088-79279110 TGATAAAGAAGGCGCAGTGTCGG + Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1126447165 15:48760575-48760597 GGAAAGAGAAGGCCTCCTGGAGG + Intronic
1130913417 15:88286428-88286450 GGATTTAGAAGGGCCTCTGTGGG + Intergenic
1142474106 17:179864-179886 GGTTAGAGCAGGGCCCCTGTAGG - Intronic
1150295611 17:64005750-64005772 GGCTACAGAGGGCCCTCTGTGGG - Intronic
1150572660 17:66401259-66401281 GGATAAAGAAGGCTTCTTGCAGG + Intronic
1151379763 17:73717586-73717608 GGATACTGAATGTCCCCTGTGGG - Intergenic
1151967938 17:77441364-77441386 GGAAAAACAAGGCCCTCTCTGGG + Intronic
1203172755 17_GL000205v2_random:165355-165377 GGATAAAGAAGCACAGCTGTAGG - Intergenic
1156458828 18:37309925-37309947 GGATAAGGAAGGCTTCCTGGGGG - Intronic
1158851956 18:61503512-61503534 GGATCAATATGGCCCCCTGGGGG - Intronic
1159995403 18:74959923-74959945 GCATAAAGAAGCCACACTGTTGG - Intronic
1161214234 19:3085301-3085323 GGACACAGAAAGCCTCCTGTGGG - Intergenic
1161405528 19:4089356-4089378 GGATAGAGGAGGCCACCTCTGGG - Intergenic
1161879404 19:6937363-6937385 GGAAGATGAAGGCCCCCTGCAGG - Exonic
1161941671 19:7408636-7408658 GGATAAAGAGGGGCCCCTCAGGG - Intronic
925421694 2:3717930-3717952 GGAGAAAGGAGGCCTCCTGGAGG - Intronic
925850447 2:8076372-8076394 GGACTCAGAAGACCCCCTGTAGG + Intergenic
927775389 2:25898974-25898996 GAATAAGGAAGGCCCCCACTGGG + Intergenic
928085595 2:28344575-28344597 GGATCGAGAAGGCGCCGTGTGGG - Intergenic
928181408 2:29071290-29071312 CGAGAGAGAAGCCCCCCTGTGGG - Exonic
929831226 2:45348188-45348210 TGATGAAGAAGGCCGCCTGCAGG - Intergenic
930398082 2:50848004-50848026 GGATACAGAAATCCCTCTGTCGG + Intronic
930872003 2:56180315-56180337 GGAGAAAAACTGCCCCCTGTAGG + Intergenic
931152020 2:59585126-59585148 GGATCCAGAATGCCCCCTGGTGG + Intergenic
937435172 2:121874091-121874113 GGACAAAGCAGCCGCCCTGTGGG - Intergenic
942914481 2:181286783-181286805 GGAAAAAGAAGGCCAAGTGTTGG - Intergenic
944727650 2:202487284-202487306 GGCTAAAGAAGACCCCAGGTTGG + Intronic
946863187 2:224019526-224019548 GGATGAACAAGGTCCCCAGTGGG - Intronic
948011693 2:234653981-234654003 TGATAAAAAAGCCCTCCTGTGGG + Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172592262 20:36126185-36126207 GGATGAGGAAGGCCTCCTGTGGG + Intronic
1180072557 21:45443595-45443617 GGAGAAAAAGGGCCGCCTGTCGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1182091351 22:27597046-27597068 GGCTAAAGTAGGCAGCCTGTGGG - Intergenic
1183293264 22:37015734-37015756 GGATCAGGGAGGCACCCTGTAGG - Intronic
1183696949 22:39428870-39428892 GGGAAAGGAAGGCCCCCTGATGG - Intronic
1184331063 22:43828260-43828282 GGCCATAGGAGGCCCCCTGTTGG - Intronic
949900951 3:8814384-8814406 GGATAAAAAGGGGCCCCTGAGGG - Intronic
953955073 3:47225657-47225679 GAATAAAGATGGCACCCTGAAGG - Intergenic
962395793 3:135014373-135014395 AGAAAAGGAAGGCCCCCTTTTGG - Intronic
965331841 3:167384718-167384740 GGATAAAGAAGGTCACATATGGG - Intergenic
965476026 3:169156161-169156183 GGATAAAGATAGCTCCCTCTTGG + Intronic
966086993 3:176080130-176080152 GTAAACAGAAGGCACCCTGTAGG + Intergenic
966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG + Intergenic
968265355 3:197358635-197358657 GGATCAAGAAGGATTCCTGTTGG + Intergenic
974736758 4:65945664-65945686 TGATAAAGAAGGCCCCTTATTGG + Intergenic
982213108 4:153057056-153057078 GGACAAAGAAGGCTTCCTGAAGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985536291 5:467485-467507 GGATCAGGAAGGCACCCTCTAGG - Intronic
994050533 5:95357301-95357323 GGATAAAGAAGGTCAGTTGTTGG - Intergenic
999124035 5:149233319-149233341 GAATAAAGAAGGCCCTTTGGTGG - Intronic
999276705 5:150336063-150336085 GAATCAAGAAGGGCCCCTGTGGG + Intronic
1003884158 6:10505735-10505757 GGAATAAACAGGCCCCCTGTGGG + Intronic
1004512815 6:16296558-16296580 GGATAATACAGGCCCACTGTTGG + Intergenic
1006470255 6:34224513-34224535 GTGTAAAGAAGGACCCCTGAGGG + Intergenic
1011189908 6:84717780-84717802 GGAGAAAGCTGGCCCCCTGAGGG - Intronic
1013031649 6:106339513-106339535 AGGTAAAGAACGCCCCCTGGAGG - Intergenic
1015019681 6:128457873-128457895 GGATAAAAAGGGCACACTGTAGG - Intronic
1023117750 7:36878941-36878963 GGATAAAGAGGGCTTCCTGGAGG - Intronic
1023727231 7:43156286-43156308 GGACAGAGCAGGCCCCCAGTAGG + Intronic
1025027026 7:55525025-55525047 GCAGAAAGAAGGCCCCGTGCTGG + Intronic
1030222928 7:107116624-107116646 GAATAAATAAGGCTTCCTGTGGG + Intronic
1032611639 7:133421546-133421568 GGAGAAAGAGGGCCCACTGCTGG + Intronic
1034352334 7:150424975-150424997 GCATAAAGAAGGCGCCATCTTGG + Intergenic
1037430200 8:18803983-18804005 GGATAAAAAATGCCATCTGTAGG - Intronic
1041087328 8:54268914-54268936 GGAGAAACCAGGGCCCCTGTGGG - Intergenic
1041218282 8:55623536-55623558 GGAAAAAAAAGACCCCCTGGGGG + Intergenic
1044896609 8:96899141-96899163 GGAAAAAGAAAGGCTCCTGTTGG + Intronic
1046345753 8:112924358-112924380 GGAGAAAGAAGGCCCAGTATAGG + Intronic
1047960766 8:130010174-130010196 TGAAAAAGAAGGCCCAATGTGGG - Intronic
1049773684 8:144395141-144395163 GGATGGAGAAGGCCTCCTGCTGG + Exonic
1050068386 9:1785432-1785454 GGAAAAAGAGGGCACCTTGTAGG - Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056717771 9:89046884-89046906 GTATCAAGAAAGCCCCCTGGAGG + Exonic
1057624611 9:96666418-96666440 GGGTAAAGATGGTCCCCTCTGGG + Intergenic
1058878243 9:109262808-109262830 GGACAAGGAAGGCCCATTGTGGG - Intronic
1203433360 Un_GL000195v1:113324-113346 GGATAAAGAAGCACAGCTGTAGG + Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185737501 X:2504283-2504305 GGATTAAGAAGGCTCCTTGTGGG + Intergenic
1188982440 X:36739121-36739143 GGATACAGAAAGCCTCTTGTAGG - Intergenic
1189604476 X:42661616-42661638 TGAGAAAGCAGGCCCTCTGTGGG - Intergenic
1190003398 X:46711090-46711112 AAATGGAGAAGGCCCCCTGTTGG + Intronic
1190759508 X:53427943-53427965 GGACATTGAAGGCCCCCTGCTGG + Intronic
1195928067 X:110046284-110046306 GGATAAAGAAGGCCCCCTGTTGG - Intronic
1199363671 X:146952195-146952217 GGATAAGGAAGTCCTCCTATAGG + Intergenic
1199694918 X:150337119-150337141 GGAGAAAGAAGGCTGCCTGCTGG + Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic