ID: 1195930197

View in Genome Browser
Species Human (GRCh38)
Location X:110066724-110066746
Sequence AGGACAAGGTTCTTTTTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195930191_1195930197 16 Left 1195930191 X:110066685-110066707 CCATGCCACACCAGGTATCAGGG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1195930197 X:110066724-110066746 AGGACAAGGTTCTTTTTGTTTGG 0: 1
1: 0
2: 4
3: 13
4: 240
1195930189_1195930197 17 Left 1195930189 X:110066684-110066706 CCCATGCCACACCAGGTATCAGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1195930197 X:110066724-110066746 AGGACAAGGTTCTTTTTGTTTGG 0: 1
1: 0
2: 4
3: 13
4: 240
1195930194_1195930197 6 Left 1195930194 X:110066695-110066717 CCAGGTATCAGGGAACTGATTTG 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1195930197 X:110066724-110066746 AGGACAAGGTTCTTTTTGTTTGG 0: 1
1: 0
2: 4
3: 13
4: 240
1195930193_1195930197 11 Left 1195930193 X:110066690-110066712 CCACACCAGGTATCAGGGAACTG 0: 1
1: 0
2: 2
3: 17
4: 187
Right 1195930197 X:110066724-110066746 AGGACAAGGTTCTTTTTGTTTGG 0: 1
1: 0
2: 4
3: 13
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195930197 Original CRISPR AGGACAAGGTTCTTTTTGTT TGG Intronic
900523864 1:3119098-3119120 AGGCCAAGGGCCTTTTTGGTGGG + Intronic
901695594 1:11005572-11005594 AGGACAATATTCTTGTTCTTAGG + Intergenic
907953157 1:59203426-59203448 AGGACAGGGTTCTTTCTAATAGG - Intergenic
908656373 1:66393597-66393619 TGCACATGGTTCTTTTTGCTTGG - Intergenic
908887150 1:68802298-68802320 AGCACAAGTTTATTTTTGTGAGG - Intergenic
909363207 1:74789394-74789416 AGAACAGAGTTCTTTTTGATAGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
911066793 1:93796711-93796733 AGGAAATGGATATTTTTGTTTGG - Intronic
911658445 1:100472757-100472779 AGGTCAAGCTTCTTTTTTTTTGG + Intronic
911749383 1:101479336-101479358 AGGACAATGTGATTTTTGTGGGG - Intergenic
913711012 1:121483487-121483509 AGGATTAAGTTCTTTTTGTAAGG - Intergenic
915013854 1:152714875-152714897 TGGACAAGTTATTTTTTGTTTGG + Intergenic
916779084 1:168004098-168004120 ATCACAAGGTTCTTATTGTGTGG + Intronic
917131503 1:171747320-171747342 AAGACAATGTTCTTGTTCTTAGG - Intergenic
917497493 1:175554489-175554511 AGCATAGGGTTCTATTTGTTTGG + Intronic
918000321 1:180487996-180488018 AAGAAAAGGTTCTTTTTCTTAGG + Intronic
919012542 1:191983605-191983627 AGGGCAAGGTGCATTCTGTTGGG + Intergenic
919180021 1:194068753-194068775 AGGACCAATTTTTTTTTGTTTGG + Intergenic
920324650 1:205153643-205153665 AGAACAATGTCCTTTTTCTTAGG + Intronic
920451275 1:206062901-206062923 AGGACAAGGCTTTGTCTGTTGGG - Intronic
922049179 1:221974093-221974115 ATGACAAGTTTTTTTTTGGTGGG + Intergenic
922138969 1:222862386-222862408 AAGAGAAGGTTCTTGTTCTTAGG - Intergenic
922660522 1:227425882-227425904 CGTACAAGGTTCCTTTTATTTGG - Intergenic
923613901 1:235520369-235520391 AGGACAAGTATCTTTTTGAGGGG + Intergenic
924602493 1:245503986-245504008 AGGACCAGGTTCCTTTCCTTAGG - Intronic
1064705714 10:18070358-18070380 AGGACAAGGTTATATTTCTGAGG + Intergenic
1065216777 10:23456688-23456710 AGCATAAGGTTTTTTTTGTAAGG - Intergenic
1065345299 10:24742443-24742465 AGGACAAGGTTTTTTGGGCTGGG + Intergenic
1065848609 10:29767473-29767495 AAGAGAATGTTCTTTTTCTTAGG + Intergenic
1065873418 10:29975885-29975907 AGGAGAATTTTCTTTTTCTTAGG + Intergenic
1066587026 10:36946904-36946926 AGGAAGAGCTTCTTTTTGTGAGG - Intergenic
1068352928 10:55872522-55872544 AGGCCAACGTTCTGTTTGATGGG + Intergenic
1069563595 10:69448995-69449017 AGGACAACTTTTTTTTTTTTTGG + Intergenic
1070414292 10:76175121-76175143 AGAACAATCTTCTTTTTTTTTGG - Intronic
1071973165 10:90928918-90928940 AGGAGAATGTCCTTATTGTTAGG + Intergenic
1072812067 10:98469736-98469758 AGTTCAAGGCTCATTTTGTTTGG - Intronic
1075171475 10:120119758-120119780 AGGACAAGGTTCTCTTTATTTGG - Intergenic
1076582617 10:131522597-131522619 GGGACAAGGTACTTTGTGTGGGG - Intergenic
1077515214 11:2997458-2997480 AGGAAATCCTTCTTTTTGTTGGG + Intergenic
1078286113 11:9957816-9957838 AAGAAGAGGTTCTTTTTGCTTGG - Intronic
1080797607 11:35579870-35579892 AGCACTAGTTTCCTTTTGTTGGG - Intergenic
1081260657 11:40956160-40956182 AGCACAAGGTTATTTGTTTTTGG - Intronic
1081538601 11:44014052-44014074 AGATAAGGGTTCTTTTTGTTTGG + Intergenic
1083731031 11:64652792-64652814 AGGGGAAGGTTCTGTTTCTTAGG + Intronic
1084292841 11:68186453-68186475 TGGGCAAGTTTCTTTTTGTCTGG - Intronic
1084699015 11:70774183-70774205 ATGACCAGCTTCTTTTAGTTAGG - Intronic
1085604151 11:77882309-77882331 AGCTCAAGGTTCTTTTTCCTAGG - Intronic
1085823623 11:79819448-79819470 ATGCCAAGGTAGTTTTTGTTAGG - Intergenic
1087432349 11:98069879-98069901 AAGACAAGGTTCTTTGTCTTAGG + Intergenic
1088111767 11:106269445-106269467 AGAACAAGATTCTTTTTTCTGGG - Intergenic
1088415577 11:109585406-109585428 AGCACAAGGTTCTGTCTTTTAGG - Intergenic
1090146023 11:124323576-124323598 ATTTGAAGGTTCTTTTTGTTGGG - Intergenic
1090527306 11:127551320-127551342 ATGACTAGGTTTTATTTGTTGGG + Intergenic
1091935379 12:4430682-4430704 AAGAAAATGTTCTTTTTGTTAGG + Intronic
1093789631 12:23233376-23233398 AGGGCAACACTCTTTTTGTTAGG - Intergenic
1093860535 12:24161034-24161056 AAGACATGATTCTATTTGTTGGG + Intergenic
1095660193 12:44723621-44723643 AGTATAAGTTTCATTTTGTTTGG + Intronic
1095790336 12:46160391-46160413 AGAACAAGATTCTTCATGTTGGG + Intergenic
1097202992 12:57295540-57295562 AGGACAAAGACCGTTTTGTTAGG + Intronic
1097276306 12:57815730-57815752 AGGACAAGCCTGTTTTTGTCTGG + Intronic
1098412158 12:70198096-70198118 AGTACATAGTTCTTTTTGTGTGG + Intergenic
1099210211 12:79776311-79776333 AAGACAAGCCTGTTTTTGTTAGG + Intronic
1099566910 12:84262372-84262394 AGGAAGATGTTCTTTATGTTTGG + Intergenic
1101034637 12:100693301-100693323 AGGAGAATGTCCTTTTTCTTAGG - Intergenic
1102774909 12:115510091-115510113 AGGACATGTTTCTGTTTGATGGG + Intergenic
1102868357 12:116392415-116392437 AGGAGAGGGTTTTGTTTGTTTGG - Intergenic
1103034590 12:117646504-117646526 AGGACAAGGTGCTGTTTCCTAGG + Intronic
1103128922 12:118449924-118449946 AGAAGAAAGTTCTTTTTCTTAGG - Intergenic
1103267499 12:119643381-119643403 AGGACAAAATGGTTTTTGTTGGG + Intergenic
1103271677 12:119678683-119678705 ATGACAAGATTCCTTTTGTAAGG + Intronic
1103428108 12:120856308-120856330 AAGAGAAGGTTCTTTTTTTGTGG + Intronic
1105555112 13:21440097-21440119 AAGACAATGTTCTTGTTCTTAGG + Intronic
1106289799 13:28350245-28350267 GGTACAAGGTTATTTTTATTTGG + Intronic
1107299338 13:38948697-38948719 AGGACAGGGGTCTTTTGGGTAGG - Intergenic
1110837235 13:80097509-80097531 AAGAAAAGTTTCTTTTTATTGGG + Intergenic
1111472971 13:88709363-88709385 AGGAAAAGATTCTTTTTTTGAGG - Intergenic
1112564541 13:100542033-100542055 GGGACAAGTTTCTTCCTGTTAGG - Intronic
1113912511 13:113850175-113850197 AGGACAAAGTGCTCTGTGTTTGG - Intronic
1117519827 14:56540218-56540240 AGAACAAGGTTCTGTTTCTCTGG + Intronic
1118140910 14:63081276-63081298 AAGAGAATGTTCTTTTTCTTAGG + Intronic
1118210623 14:63762735-63762757 AGGAGAATGTTCTTGTTCTTAGG + Intergenic
1118265123 14:64287485-64287507 AAGGCTAGGTGCTTTTTGTTTGG + Intronic
1118283539 14:64450528-64450550 AGGAAAAGGTTCTTATTATAGGG + Intronic
1120866373 14:89298882-89298904 TGGACAATGTTCCTCTTGTTGGG + Intronic
1125143668 15:36440444-36440466 AGGACAAAGTTTTTCTTGATTGG + Intergenic
1126335759 15:47584606-47584628 AGGATAAGGCTCTTTATTTTTGG + Intronic
1126484071 15:49159929-49159951 AGGAGAATGTTCTTATTTTTAGG - Intronic
1126781369 15:52141769-52141791 AGGAGAATGTTCTTATTTTTAGG - Intronic
1128532056 15:68461068-68461090 AGGACAGGGTTTTTTTTGGGGGG + Intergenic
1129193226 15:73949704-73949726 CGGACAAGGCTCTTTTTGATGGG - Intronic
1131586220 15:93695870-93695892 AGTACAAGGCTCTTAGTGTTTGG - Intergenic
1131681252 15:94725977-94725999 AGTCCAAGGTTTTTTTTTTTTGG - Intergenic
1132922337 16:2404006-2404028 ATGGCAAAGTTCATTTTGTTTGG - Intergenic
1134436247 16:14260921-14260943 AGGAGAAGGTTCTTCTTTTATGG - Exonic
1135633490 16:24054669-24054691 AGGAAAAGGTTCTTTTCTGTGGG + Intronic
1136351263 16:29709661-29709683 TGAACTAGCTTCTTTTTGTTAGG + Intergenic
1137305666 16:47197294-47197316 AGGCCAAGGTTCTTGTTATGTGG - Intronic
1140395393 16:74621910-74621932 TGGACAAGGCTTTTTTTCTTTGG + Exonic
1140458971 16:75123503-75123525 AGGAAAACATTCTTTTTTTTTGG + Intergenic
1142733763 17:1881127-1881149 AGAACAATGGGCTTTTTGTTAGG + Intronic
1144327268 17:14194047-14194069 AAGAGAAGGTTCTTGTTGCTTGG - Intronic
1144476154 17:15590910-15590932 AAGAGAAGGTTCTTGTTGCTTGG - Intronic
1148923142 17:51057559-51057581 AGCACAAGGTATGTTTTGTTTGG - Intronic
1150363213 17:64556663-64556685 AGGTGAAGGTTCTTTTTGGAGGG - Intronic
1153080836 18:1222642-1222664 AGGACAAGTTTCTTTATTCTTGG - Intergenic
1153277576 18:3382941-3382963 AGGAAAAGATCCTTTTTCTTAGG + Intergenic
1153952968 18:10072374-10072396 AGGAGCTGGTTCTTTTTTTTTGG + Intergenic
1155529033 18:26746952-26746974 AGGACTAGGTTATTATTTTTTGG - Intergenic
1156181855 18:34613994-34614016 AGGATAAGGTGCCTCTTGTTAGG + Intronic
1156665465 18:39400634-39400656 AAGACAATGTTATTTTTGTGAGG + Intergenic
1157427329 18:47595167-47595189 AGGACTAAGTGCTTGTTGTTGGG + Intergenic
1161527139 19:4763312-4763334 AGGACACGGTGCTTCATGTTAGG + Intergenic
1162569664 19:11463995-11464017 AGGATAAGGTTTTTTTTTTTTGG - Intronic
1165320885 19:35084527-35084549 AGGGCAAGGTTTTGTCTGTTTGG - Intergenic
1165998738 19:39864583-39864605 AGGATAACGTTGTTTTGGTTAGG - Intronic
1167300477 19:48674697-48674719 AGGAGACTGTTTTTTTTGTTGGG + Intergenic
925822990 2:7818817-7818839 ATAACATGGCTCTTTTTGTTAGG - Intergenic
926294007 2:11554190-11554212 AGGAGCACTTTCTTTTTGTTGGG + Intronic
928743924 2:34389333-34389355 AGGTCAGTGTTGTTTTTGTTTGG - Intergenic
929723673 2:44399812-44399834 CAGACCAGGTTCTTTTAGTTAGG + Intronic
930164346 2:48189623-48189645 AGGAAAATGTTCTTGTTCTTAGG + Intergenic
930356050 2:50321650-50321672 GAGGCAAGGTGCTTTTTGTTTGG + Intronic
931626325 2:64259313-64259335 AGGAGAAGGTTCTTGTTCTTGGG - Intergenic
931644104 2:64405890-64405912 AGGCCAAGGTTGTTTGTTTTTGG - Intergenic
932140846 2:69276435-69276457 AGCACAAGGTTCTTCTCTTTTGG + Intergenic
932192638 2:69753790-69753812 AGGAGAAACTTCTTTCTGTTTGG - Intronic
933141550 2:78796715-78796737 ATGAAATGGTTCTTTATGTTAGG + Intergenic
933785206 2:85834425-85834447 ATGAAAAGGTTTTTTTTTTTTGG + Intergenic
934767717 2:96889309-96889331 AGTACAAGGATCTTTATGGTGGG - Intronic
936089152 2:109489721-109489743 CGGACAAGGTTTTTTTTGGCGGG + Intronic
937422651 2:121771396-121771418 AGGAGAAGGTCATTTTGGTTGGG + Intergenic
937519679 2:122697045-122697067 AGGAAAAGTTTTCTTTTGTTTGG - Intergenic
938115393 2:128599794-128599816 AGGACATGATTCTTGGTGTTGGG - Intergenic
939594866 2:144110687-144110709 TGCACAAGGTTTTTTTTTTTTGG - Intronic
940455717 2:153897136-153897158 AGGGCAATATTCTTTTTCTTAGG - Intronic
941420261 2:165275486-165275508 AGGGCAAGGTTTTGTCTGTTTGG + Intronic
941915779 2:170813006-170813028 AGGACAGGGTGATTTGTGTTTGG - Intergenic
942181239 2:173383234-173383256 AGTACCAGGTTCTTATTCTTGGG + Intergenic
942840410 2:180353591-180353613 AGGCCAATCTTCATTTTGTTGGG - Intergenic
944928929 2:204496120-204496142 ATCTCAAGTTTCTTTTTGTTGGG + Intergenic
945280685 2:208032851-208032873 GGGCCAAGATTCTTTTTTTTGGG + Intergenic
946472671 2:219977011-219977033 AGCACAAGGTGGTTTTTGTGCGG + Intergenic
948606643 2:239139919-239139941 ATGGCCATGTTCTTTTTGTTGGG - Intronic
1169644208 20:7790993-7791015 AAGACAATGTTCTTGTTTTTAGG + Intergenic
1169939524 20:10921772-10921794 AAGACAACCTTTTTTTTGTTAGG + Intergenic
1176982234 21:15396655-15396677 AGGACACTTTTCTTTTTATTTGG + Intergenic
1177545905 21:22559083-22559105 AGCAAATTGTTCTTTTTGTTAGG + Intergenic
950158465 3:10741628-10741650 CAGACAAAGTTCTATTTGTTTGG - Intergenic
952824189 3:37511199-37511221 AGAACCAGGTTTTTTTTGTTTGG - Intronic
953917900 3:46932346-46932368 AGTACAGGGATGTTTTTGTTTGG + Intronic
955868288 3:63409027-63409049 AGGACAAGGTTCACCTGGTTTGG - Intronic
956103172 3:65789445-65789467 AGGACAAGGAACATTTTGCTTGG + Intronic
956205199 3:66748078-66748100 AAGAAAAGCTGCTTTTTGTTTGG - Intergenic
956271681 3:67454631-67454653 AGGACAATGTTCCTATTTTTAGG - Intronic
958587280 3:96105145-96105167 ATTACATGTTTCTTTTTGTTTGG + Intergenic
959996001 3:112680917-112680939 AGACCAAAGTTCTTTTTTTTTGG + Intergenic
960373227 3:116866705-116866727 AGGACATGGTCCTTTATGGTTGG + Intronic
961072664 3:123949573-123949595 AGGCCAAGATTTTGTTTGTTTGG - Intronic
961990130 3:131180918-131180940 AGGACAGGGTTATATTTGTAAGG + Intronic
963557399 3:146810215-146810237 AGGATAAACTTATTTTTGTTAGG - Intergenic
963869696 3:150402082-150402104 AAGACAAGTTTCTTTTTGTAGGG - Intergenic
963934687 3:151040041-151040063 AGGACTAGTTTCATTCTGTTAGG + Intergenic
964438813 3:156682323-156682345 AGGACAGGGTTTTTTTCTTTTGG + Intronic
964725704 3:159812537-159812559 AGGACAAGGTTCATTTGGACTGG - Intronic
965364467 3:167781584-167781606 AATACAGTGTTCTTTTTGTTAGG + Intronic
969947906 4:10803556-10803578 AGAACAAGATTCTTTTTATTGGG - Intergenic
972364025 4:38356695-38356717 AGGTCAAGATTCTTTTTGGAGGG - Intergenic
972475327 4:39444483-39444505 AGTACAAGGTCCTTTTGGTGGGG + Intronic
974866337 4:67585512-67585534 AGGTCATGGTTCTTTGTGTAAGG + Intronic
975112861 4:70646424-70646446 AGGGCAAGATTCCTTTTCTTAGG - Exonic
978955747 4:114610639-114610661 AGGACAAGGTTGTATTAGATAGG - Intronic
981540077 4:145837471-145837493 ATGACAAGTTTTTTTTTGGTGGG - Intronic
984463599 4:180069496-180069518 AAGAAAATTTTCTTTTTGTTTGG + Intergenic
988906285 5:35793774-35793796 AGGAGCAGGTTTTTTTTCTTTGG + Intronic
989975319 5:50578940-50578962 AGGAAAAAATTCATTTTGTTTGG - Intergenic
989987759 5:50721784-50721806 AGGAAAAAGTTCTTATTGGTTGG + Intronic
991022090 5:61989994-61990016 AGAAAAAGGTTCATTTTGTCTGG + Intergenic
992611873 5:78515043-78515065 AGGAAAATGTTCTTATTTTTAGG - Intronic
993737656 5:91497247-91497269 AGGAAAAAGTTTTTTTTTTTTGG + Intergenic
995653486 5:114398138-114398160 AGTACAGGGTTTTTATTGTTTGG + Intronic
996000126 5:118351103-118351125 AGGTCAAGGTCTTTTGTGTTGGG - Intergenic
996099844 5:119435180-119435202 AGGACAAGCTTCTTTGCTTTCGG - Intergenic
996781110 5:127187490-127187512 AGGTCAGAGTTCTTTATGTTCGG - Intergenic
997528783 5:134569791-134569813 AGGACAAGGTTGGCTTTGGTGGG - Intronic
998551833 5:143085180-143085202 AGGACAAGCTTCTTGATGATAGG + Intronic
998771614 5:145552135-145552157 AGGACCAGGTTGTCTTTCTTGGG + Intronic
999393382 5:151211060-151211082 AGCACTAGGTTATTTTAGTTGGG - Intronic
1000045750 5:157520672-157520694 AAGACAAGGGTCTTTGTGCTTGG + Intronic
1000592715 5:163177795-163177817 AGGACAAAGTTCATTTTGTTTGG + Intergenic
1001043993 5:168357084-168357106 ATCACAAGTTTCTCTTTGTTGGG + Intronic
1001944209 5:175765053-175765075 AGGTCAAGGTTCTTTTTTTTTGG - Intergenic
1002763656 6:220596-220618 AGGAGAATGTCCTTGTTGTTAGG - Intergenic
1003469284 6:6413711-6413733 AGGAAAAGATTCTCTTGGTTAGG + Intergenic
1005121602 6:22396040-22396062 AAGACAATGTTATTTTTATTTGG - Intergenic
1007609915 6:43142631-43142653 AGGACAAGGTTCTTTTCTCCAGG + Intronic
1007939237 6:45761885-45761907 ATGACCAGTATCTTTTTGTTTGG - Intergenic
1007942344 6:45793584-45793606 AGATCAAGGTTCTTTTTTATGGG - Intergenic
1008464784 6:51818183-51818205 AGGCCAGGATTCTGTTTGTTGGG - Intronic
1008786827 6:55177945-55177967 AGGGTAAGGTTCTTTTTGGAAGG + Intronic
1011897383 6:92246818-92246840 AGCGGCAGGTTCTTTTTGTTGGG + Intergenic
1012151242 6:95757310-95757332 AGCACAAGGTACTATTTGTGAGG + Intergenic
1015084959 6:129279446-129279468 ATGGCAAGGTTGCTTTTGTTTGG + Intronic
1016241502 6:141936631-141936653 AGGACATGGATCTATATGTTTGG + Intergenic
1017105222 6:150881141-150881163 TGGACAAGGTTTTTTTGGATAGG - Intronic
1017869756 6:158477089-158477111 CAGACAAGGTTGTTTTTGTCAGG + Intronic
1018420644 6:163637940-163637962 ACAACAATGTTCTTTATGTTGGG + Intergenic
1020398261 7:7742990-7743012 TGCACTAGGTTGTTTTTGTTTGG + Intronic
1021657470 7:22886530-22886552 AGGAAAATGTTCTTCTTTTTAGG - Intergenic
1021790665 7:24201910-24201932 AAGACAATGTTCTTTTTATGTGG - Intergenic
1023227582 7:37987060-37987082 AGGAAAAAGTTCTTTATGATAGG - Intronic
1023502097 7:40861711-40861733 AAGACAAGTTCCTATTTGTTTGG - Intergenic
1024822512 7:53349920-53349942 AGTACAGACTTCTTTTTGTTGGG + Intergenic
1025774020 7:64542226-64542248 AGGTAAAGATTTTTTTTGTTGGG - Intronic
1028110301 7:86932581-86932603 GAGAAAAGGTTGTTTTTGTTTGG - Intronic
1028508658 7:91597434-91597456 AGGACAAGTTTCTTCTACTTTGG + Intergenic
1030280751 7:107772292-107772314 AGGAGAAGGGTTCTTTTGTTTGG - Intronic
1030380484 7:108805063-108805085 AGTACCAGGTTCTTTTTATGAGG - Intergenic
1030708660 7:112722784-112722806 AGGACAGGGTTTATTTTGTTTGG + Intergenic
1031769678 7:125828410-125828432 AAGATAATGTTCTTTTTCTTGGG - Intergenic
1031922196 7:127610476-127610498 AAGACAAGTTTCTTGTTTTTTGG + Exonic
1032683453 7:134208899-134208921 AGGAGAAAGCTCTTTTTGATGGG - Intronic
1033433844 7:141314375-141314397 AGGACAAGGTTCCTTCTGATGGG + Intronic
1034848998 7:154476317-154476339 AGCACAGAGGTCTTTTTGTTTGG + Intronic
1035219687 7:157398711-157398733 AGATCAAGTTTCTTTTTATTGGG - Intronic
1037738292 8:21583945-21583967 TGCACAATGTTCTTTCTGTTGGG + Intergenic
1043676382 8:82961074-82961096 AGAAAAAGGTTCATTTTGTAAGG + Intergenic
1044707508 8:95023378-95023400 AGGACAAGGTGCTTTACCTTGGG + Intronic
1046271443 8:111902604-111902626 AGGACAAGGTTCTTGGCATTGGG - Intergenic
1046292143 8:112176961-112176983 ATATCAAGGTTCTTTTAGTTGGG + Intergenic
1052171899 9:25409640-25409662 AGTATAAGGTTTTTATTGTTAGG - Intergenic
1053092971 9:35296826-35296848 AAGATAAAGTTCTTTTTCTTAGG - Intronic
1053680257 9:40481504-40481526 GGGACAAGCTTCTCTTTATTGGG + Intergenic
1053930248 9:43109814-43109836 GGGACAAGCTTCTCTTTATTGGG + Intergenic
1054283455 9:63143431-63143453 GGGACAAGCTTCTCTTTATTGGG - Intergenic
1054293337 9:63317014-63317036 GGGACAAGCTTCTCTTTATTGGG + Intergenic
1054391365 9:64621507-64621529 GGGACAAGCTTCTCTTTATTGGG + Intergenic
1054504364 9:65894820-65894842 GGGACAAGCTTCTCTTTATTGGG - Exonic
1055726979 9:79240883-79240905 AAGCCAAGGTTCTTTTTAGTGGG - Intergenic
1057479889 9:95436507-95436529 AGTTTAAGGTTCTTTTTGTCAGG + Intergenic
1058975944 9:110125648-110125670 AGGACAGGGGTCTTTTTTTGAGG + Intronic
1185991426 X:4896301-4896323 ATGACAAGTTTTTTTTTGGTGGG - Intergenic
1186065410 X:5758381-5758403 CTGACAGGGTTCTTTGTGTTAGG + Intergenic
1186831426 X:13394206-13394228 AGGAAAATGTTCTTTTTTATAGG + Intergenic
1188359876 X:29240122-29240144 AGGACATGGATCTTTTTGTTGGG + Intronic
1189185921 X:39054876-39054898 AGGACAATGTTCTTGCTCTTAGG - Intergenic
1191010784 X:55755819-55755841 AGGACAATATTCTTTTTCATAGG + Exonic
1191212699 X:57905725-57905747 AGGACAAATTTTTTTTTTTTAGG - Intergenic
1192314283 X:70039937-70039959 AGGACAATGTTCCTTTTGGCAGG - Intergenic
1193947670 X:87758320-87758342 AGGAGAATGTTCATTTTTTTTGG + Intergenic
1194706691 X:97183450-97183472 AGGACAAAGTTCATATTGTAAGG + Intronic
1195115323 X:101692129-101692151 AGGTCAATGTCCTTTTTCTTGGG - Intergenic
1195930197 X:110066724-110066746 AGGACAAGGTTCTTTTTGTTTGG + Intronic
1197517858 X:127458439-127458461 ACAACAATGTTCTTCTTGTTTGG + Intergenic
1199322652 X:146458951-146458973 AGTGCAAGGTTTTTTTTGTTTGG - Intergenic
1200780374 Y:7210191-7210213 AGGGCAATGTTCTTCTTCTTGGG - Intergenic
1200957512 Y:8966859-8966881 AAGATAAAGTTATTTTTGTTAGG - Intergenic
1201963005 Y:19702827-19702849 AGGAGAATGTTCTTGTTCTTAGG + Intergenic
1202202520 Y:22367931-22367953 AAGATAAAGTTATTTTTGTTAGG - Intronic