ID: 1195931913

View in Genome Browser
Species Human (GRCh38)
Location X:110086871-110086893
Sequence GAGGAATACCATAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195931913 Original CRISPR GAGGAATACCATAATGGGGA TGG Intronic
902118236 1:14139536-14139558 GTGGAATAGAATAATGGGGCTGG - Intergenic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
904031365 1:27535508-27535530 GAGGAATGACATCATGGGGAGGG + Intronic
904465217 1:30703669-30703691 GAGGAGTTCCCTAGTGGGGATGG + Intergenic
904643444 1:31947697-31947719 AGGGAAAACCATTATGGGGAAGG + Intergenic
905691597 1:39947295-39947317 GAGAAATACTCTAATGGGGATGG - Intergenic
905891327 1:41520323-41520345 GAGGAAAACCCAAATTGGGAAGG - Intronic
905974377 1:42164410-42164432 GAGGAATAACCATATGGGGAAGG - Intronic
906318982 1:44805197-44805219 AAGGCATACACTAATGGGGAGGG + Intronic
909758592 1:79260596-79260618 GAGGTAGACCAGAATGAGGAAGG + Intergenic
913658520 1:120984851-120984873 GAGGAAAACCATAATTGGGTTGG - Intergenic
914009887 1:143767960-143767982 GAGGAAAACCATAATTGGGTTGG - Intergenic
914523133 1:148436090-148436112 GAGGAAAACCATAATTGGGTTGG - Intergenic
914648507 1:149676621-149676643 GAGGAAAACCATAATTGGGTTGG - Intergenic
915433827 1:155887957-155887979 GGGGACTACCAGAAGGGGGAGGG - Intergenic
915715757 1:157943130-157943152 GAGGAAGACCATAATGAACATGG - Intergenic
915772490 1:158442542-158442564 GAGGATGACCATGATGGTGATGG - Intergenic
915867827 1:159524097-159524119 GAGCAATACAATAATGGTGGGGG - Intergenic
916293385 1:163190412-163190434 GAGAAACACTCTAATGGGGATGG + Intronic
916305742 1:163329589-163329611 GAGCAAAAGCACAATGGGGAAGG + Intronic
917678370 1:177341240-177341262 GAGGAAGAAGGTAATGGGGAAGG - Intergenic
917832520 1:178908089-178908111 GAGCATTACCAGAGTGGGGAGGG - Intronic
918797342 1:188918286-188918308 CAGGAATACCATACTGAAGAAGG - Intergenic
920653816 1:207859787-207859809 CAGGAAGAACATATTGGGGAGGG + Intergenic
920770288 1:208878233-208878255 GAGGATTCCTATAATGGGAATGG + Intergenic
921158863 1:212458791-212458813 GAGAAAGACACTAATGGGGAAGG - Intergenic
921685977 1:218089550-218089572 GAGGAATACTAGAGAGGGGAGGG + Intergenic
923536852 1:234859101-234859123 TAGGAAAACCATAATTGGGGTGG - Intergenic
1064983238 10:21185088-21185110 GAGACATACCATTATGGGAAGGG - Intergenic
1067914347 10:50380443-50380465 GAAGAATACAATCATAGGGATGG + Intronic
1068026980 10:51658358-51658380 CAGGATTACCATAATAGGGCAGG + Intronic
1068793488 10:61052554-61052576 GAGGAACACCAGGAGGGGGAAGG - Intergenic
1069178183 10:65321451-65321473 GGGTAATACAATAATGGAGAAGG - Intergenic
1069349931 10:67513201-67513223 AAGGAGTACCAGAATGGGTATGG - Intronic
1070641947 10:78176720-78176742 GAGGAAGACTGTGATGGGGAGGG + Intergenic
1071901212 10:90121872-90121894 GAGGTATAGAATAAGGGGGAAGG - Intergenic
1073569220 10:104562184-104562206 GAGGGATACAAAAAGGGGGAAGG - Intergenic
1075448194 10:122528461-122528483 GAGGATGAACATAATGGTGAGGG - Intergenic
1077422166 11:2457614-2457636 GGGGAATACAAGAGTGGGGAGGG + Intronic
1078280778 11:9898945-9898967 GAGGAAAATCAAGATGGGGAAGG + Intronic
1078720726 11:13881034-13881056 CAGGAAATCCATAATGGGGCAGG + Intergenic
1079465513 11:20725903-20725925 GAGGACTACTAGAGTGGGGAAGG - Intronic
1085879116 11:80444625-80444647 GAGGAAGCCCATGATGGAGAAGG + Intergenic
1086597914 11:88596091-88596113 CAGGAATAGAAAAATGGGGATGG - Intronic
1088461659 11:110089941-110089963 GAGGAATACCAATATTGTGATGG - Intergenic
1091895784 12:4103129-4103151 GAGGATTACCACAAAGGGGCAGG - Intergenic
1093048453 12:14480395-14480417 GAGGAATACCAGAGTAGAGAAGG + Intronic
1093106945 12:15098245-15098267 GAAGAATACAAGAATGGGGAGGG - Intergenic
1093993062 12:25611423-25611445 GAGGAATACAGTGATGAGGAGGG + Intronic
1095866022 12:46972907-46972929 TAGGAATACCAGAATGGTGGTGG + Intergenic
1096235088 12:49921009-49921031 GAGGAGAACCATAATGGCAATGG - Intergenic
1096637678 12:52971431-52971453 AAGGAAAACCACAGTGGGGAGGG - Intergenic
1096748759 12:53745490-53745512 GAGGAATCCTAGATTGGGGATGG + Intergenic
1100844974 12:98648742-98648764 CAGGAATGCCATCATGGAGAAGG - Exonic
1101920146 12:108925792-108925814 GAGGAAATTCATCATGGGGAGGG - Intronic
1102561090 12:113762787-113762809 GAGGAATAAAATCCTGGGGATGG - Intergenic
1103035791 12:117655232-117655254 GTGGAATACCATGATGGTGGTGG - Intronic
1104621970 12:130321053-130321075 GTGTAATACCATAATGAAGAAGG - Intergenic
1105947642 13:25203132-25203154 GAGGGATGGCAGAATGGGGAGGG + Intergenic
1108391895 13:49955186-49955208 GAGGAACATTCTAATGGGGATGG - Intergenic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1114537493 14:23432273-23432295 GAGGAAAAACATGAAGGGGATGG + Intronic
1115848472 14:37565761-37565783 GAGGAACACCACAAGGGGGCAGG - Intergenic
1117122560 14:52584044-52584066 GAGGAATACTAGAATGGAGTGGG - Intronic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1119109833 14:71961096-71961118 TAGGAATTCCGTCATGGGGAGGG + Intronic
1121606718 14:95245986-95246008 AGGGAATATCATAATGGGCATGG - Intronic
1123166056 14:106325889-106325911 GAGGAAGAAAATAATTGGGAAGG - Intergenic
1124880604 15:33639102-33639124 GAGGAATACTATAGAGGGGAGGG + Intronic
1125882812 15:43208673-43208695 GATGAATACTATAATGAGGAGGG - Exonic
1132131548 15:99285067-99285089 CAGAAATACCATAATGTGAATGG - Intronic
1133696194 16:8265230-8265252 GAGGAATTCCCAAATGGAGATGG + Intergenic
1133722814 16:8510748-8510770 GGGGACTACCAGAGTGGGGAGGG - Intergenic
1135843445 16:25896986-25897008 GAGGAATACAAGATGGGGGAGGG + Intronic
1138532049 16:57639803-57639825 GAGGAAAAAGATAAAGGGGAAGG - Intronic
1140738549 16:77921166-77921188 CAGGAATAGCATCATGGGGCTGG + Intronic
1144158346 17:12530893-12530915 GGGAAATACCATACTGGGGATGG - Intergenic
1144797417 17:17901646-17901668 GAGCAAGATAATAATGGGGAGGG - Intronic
1146239500 17:31205034-31205056 GAGGAATCCCAAAACTGGGAGGG - Intronic
1146643898 17:34563634-34563656 GAGGAAGACCAGGTTGGGGAGGG - Intergenic
1146940049 17:36838149-36838171 GAGGAAAACTGTGATGGGGAAGG - Intergenic
1147874855 17:43613923-43613945 GAGGAAGAAGATGATGGGGAAGG + Intergenic
1149513453 17:57261375-57261397 AAGAAATCCCATCATGGGGAGGG - Intronic
1150088746 17:62300703-62300725 GAGGAATACAAGAGCGGGGAGGG - Intergenic
1151443528 17:74148811-74148833 AAGGAATAGGATGATGGGGAAGG - Intergenic
1152007338 17:77690938-77690960 GATTAATGCCATAATCGGGAGGG - Intergenic
1155816332 18:30315901-30315923 GAGGAAAAAGATGATGGGGAAGG + Intergenic
1157407296 18:47432865-47432887 GAGAAATACTACAATGGGGAGGG + Intergenic
1158381336 18:56933213-56933235 GAGAAATACAATAATAGGGAAGG - Intronic
1160117554 18:76095588-76095610 GAGGACTACCAGAGAGGGGAGGG + Intergenic
1167103492 19:47418114-47418136 GAGAAACACCATTATGGGGTAGG + Intronic
1167485895 19:49762859-49762881 GAGGAAGAAGGTAATGGGGATGG - Intronic
1167485904 19:49762889-49762911 GAGGAAGAAGGTAATGGGGATGG - Intronic
1168076983 19:53985986-53986008 GAGGAAGAGCAAGATGGGGAGGG + Exonic
1168546044 19:57250526-57250548 GAGTAAGACCATAAGGGGGCCGG - Intronic
927775569 2:25900221-25900243 GAGGAATACCAAAGTGGGCCGGG - Intergenic
927816566 2:26222694-26222716 GTGGGATACCATAATGGTGTGGG - Intronic
928942841 2:36743961-36743983 GGGGAATACAAGAAGGGGGAAGG - Intronic
930844621 2:55888870-55888892 GAGGCATCCCATAATAGGGCGGG - Intronic
931007199 2:57865240-57865262 GAGGAAGAGGAGAATGGGGATGG + Intergenic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931573631 2:63696914-63696936 GAGGAATGCAGTGATGGGGATGG - Intronic
932722734 2:74149538-74149560 GGGGAATACAAGACTGGGGAAGG - Intergenic
933864709 2:86505699-86505721 GAGGACTACCATTTTGGAGAAGG - Exonic
936882250 2:117267730-117267752 GAAGAATTGCATGATGGGGAAGG + Intergenic
938897576 2:135767418-135767440 GAGGGAATCCATAATTGGGAAGG - Intronic
942037444 2:172024315-172024337 GATTAATACCAAAAAGGGGAAGG + Intronic
943840886 2:192579056-192579078 GAAGAAAACCTTAGTGGGGAAGG + Intergenic
946324800 2:218979868-218979890 GAGGAAAACAACACTGGGGAAGG - Intergenic
946651779 2:221899209-221899231 GATGAATACTAAGATGGGGAAGG - Intergenic
1169222861 20:3836579-3836601 GAGCAATTCCATAATGGTGGAGG - Intergenic
1169684356 20:8253773-8253795 GGGGAATACTAGAGTGGGGAGGG - Intronic
1173763987 20:45589374-45589396 GAGGAACACCAAATTGGGAAAGG - Intergenic
1174516345 20:51095313-51095335 GAGGAATACAAGAAGGGAGAGGG - Intergenic
1176672349 21:9746181-9746203 GAGGATTGGCATAATGGGAACGG + Intergenic
1178223026 21:30682730-30682752 GAGGATTACTAGAGTGGGGAAGG - Intergenic
1182332688 22:29562009-29562031 GTGGAAGACCATGCTGGGGAGGG + Intronic
1183178676 22:36243967-36243989 GAGAAATACCATCAGGTGGAGGG + Intergenic
949179407 3:1110341-1110363 CAGGTATACCATCATGGGGAAGG + Intronic
950546879 3:13643383-13643405 AAGAAACACCCTAATGGGGAGGG - Intergenic
953721223 3:45356879-45356901 GAGGACTACTAGAGTGGGGAAGG - Intergenic
956542035 3:70350789-70350811 CAGAAATACCATACTGTGGACGG + Intergenic
957219322 3:77362047-77362069 AATAAATACAATAATGGGGAAGG + Intronic
957878380 3:86178764-86178786 AAGGAAGACCATATTGAGGAGGG - Intergenic
959433076 3:106278745-106278767 GAGGAAGACAATCATGGGGGAGG + Intergenic
960367223 3:116787254-116787276 GAGGACTACAAGAAGGGGGAGGG - Intronic
962698618 3:137975318-137975340 GAAAAATACTCTAATGGGGATGG - Intergenic
967326916 3:188250262-188250284 GAGGAATACTATAATTGTAAAGG - Intronic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
970838003 4:20434182-20434204 GTGAAATACGAAAATGGGGAAGG + Intronic
974242255 4:59265152-59265174 AAGTAATACCATAAAGGGGAAGG - Intergenic
975349267 4:73327832-73327854 GAGAAATAGTCTAATGGGGATGG - Intergenic
975599001 4:76079696-76079718 GTGGGAAGCCATAATGGGGAGGG + Intronic
976197584 4:82548171-82548193 GAGGACTACCAGAGAGGGGAGGG + Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
978228137 4:106363869-106363891 ACAGAATACCATAATGGGGGGGG + Intergenic
979162715 4:117484236-117484258 GAGGAATACCAACCTGGGAAAGG + Intergenic
979232084 4:118357529-118357551 GAGGCAGAGCATGATGGGGAGGG - Intergenic
979527415 4:121731913-121731935 AAATAATATCATAATGGGGAAGG - Intergenic
979906451 4:126299922-126299944 GAGGAAGACCAGATTTGGGAGGG - Intergenic
981447511 4:144857096-144857118 GGGGACTACTAGAATGGGGAGGG + Intergenic
981565839 4:146100469-146100491 GGGGACTACTAGAATGGGGAGGG - Intergenic
983654555 4:170069581-170069603 GAACAAGACCATAATGAGGATGG + Intronic
984537273 4:180992051-180992073 GAAGAATCCCAGCATGGGGAAGG + Intergenic
985402380 4:189605667-189605689 GAGGATTGGCATAATGGGAACGG - Intergenic
987270592 5:16304484-16304506 CAGGAATACCAGAATGAGCAAGG + Intergenic
987875648 5:23677167-23677189 GAGGAGTACTAGAGTGGGGAAGG + Intergenic
992519756 5:77538457-77538479 GGGGAATACTATAGTGGGGAGGG - Intronic
993507067 5:88722533-88722555 GTGCTATACCTTAATGGGGAAGG - Exonic
993719437 5:91307954-91307976 GGGGAATACAAGATTGGGGAAGG + Intergenic
994994773 5:107045997-107046019 GAGGGATACCATAAAGTAGAAGG - Intergenic
997922773 5:137998811-137998833 GAAGAGGACCATGATGGGGATGG - Intronic
999720591 5:154396467-154396489 GAGGAAGACCATGATAGGGTGGG + Intronic
1002305840 5:178282352-178282374 GTGGAATACAATAGTTGGGAAGG + Intronic
1004931161 6:20464454-20464476 CAGGAACACTGTAATGGGGATGG - Intronic
1008112792 6:47511227-47511249 GAAGAATACCACAAAGGTGAAGG - Intronic
1008213694 6:48758397-48758419 GGGGACTACTAAAATGGGGAGGG + Intergenic
1008793718 6:55273328-55273350 AAGGAATACCATAAGGGGAAAGG + Intronic
1009291262 6:61885855-61885877 AAGGAAGGCCATAGTGGGGAGGG - Intronic
1012914453 6:105154627-105154649 GAGGAATAGCCCCATGGGGATGG + Intergenic
1013173451 6:107657946-107657968 TTGGAATACCATAATGAGTAGGG - Intronic
1013650713 6:112192023-112192045 GATCTATAACATAATGGGGAGGG - Intronic
1013653783 6:112224338-112224360 GAGGCAGACAATAAAGGGGAGGG - Intronic
1015811213 6:137163783-137163805 AAGGAAAACCATTTTGGGGATGG + Intronic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1017527069 6:155250701-155250723 GATGAATAACATAAAGGTGAAGG - Intronic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1018567974 6:165177430-165177452 GAAAAATACCATAGTGGGAAAGG + Intergenic
1019104789 6:169659537-169659559 CAGGAAGAACATGATGGGGAGGG + Intronic
1020618903 7:10495461-10495483 GAGGACTACTAGAGTGGGGAGGG - Intergenic
1020946157 7:14610365-14610387 GGGGACTACCAGAGTGGGGAAGG + Intronic
1021383682 7:20001576-20001598 GTGGACTACTAAAATGGGGAGGG + Intergenic
1021618362 7:22525313-22525335 GAGGAATACCCTAAAGGTGGTGG + Intronic
1025106849 7:56178110-56178132 CAGGAATAACATCATGAGGAAGG - Intergenic
1026328642 7:69333100-69333122 AAGGACTACCGTAATGAGGACGG + Intergenic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1027556272 7:79668489-79668511 GAGGCATTCCATCATGGGGGTGG - Intergenic
1028334188 7:89630548-89630570 GGGGAATACTAGAGTGGGGAGGG + Intergenic
1028922886 7:96326405-96326427 GAGGAATTCTAGAATGAGGAGGG - Intergenic
1031626232 7:123996089-123996111 GAGTTATGCCATAGTGGGGAGGG + Intergenic
1031762272 7:125728669-125728691 GAGGAATATCAGATGGGGGAGGG + Intergenic
1039816460 8:41099131-41099153 GTGGGATATCAGAATGGGGAGGG - Intergenic
1040516665 8:48141312-48141334 GAGCAAAACCATTTTGGGGACGG - Intergenic
1042065025 8:64865088-64865110 GAGGTATACCAGAATGGGAAGGG - Intergenic
1044036634 8:87311933-87311955 GGGGACTACCAGAGTGGGGAGGG + Intronic
1046776484 8:118169035-118169057 GGGGAATAATATAGTGGGGAGGG + Intergenic
1047084282 8:121499062-121499084 GAGGAATGACAAAATGGGGAGGG + Intergenic
1051099681 9:13506521-13506543 CTGAAATGCCATAATGGGGAGGG - Intergenic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1060102981 9:120856589-120856611 GAGGGAAACCAAAATTGGGAGGG - Exonic
1188583424 X:31743677-31743699 GAGGACTACTAGAGTGGGGAGGG + Intronic
1188889504 X:35592852-35592874 GTGGACTACCAGAGTGGGGAAGG - Intergenic
1189672500 X:43425905-43425927 GAGGAATAAGATAAGGGGGAGGG - Intergenic
1190002406 X:46701674-46701696 AAAGTATACCATAATTGGGAAGG + Intronic
1190870077 X:54417491-54417513 GGGGACTACCAGAATGGGGAGGG + Intergenic
1194320439 X:92440311-92440333 GAGGACTACCAGAGTGGGGAGGG - Intronic
1194833529 X:98655547-98655569 GAGGAATAGAATATTAGGGATGG + Intergenic
1195931913 X:110086871-110086893 GAGGAATACCATAATGGGGATGG + Intronic
1197575823 X:128210061-128210083 GAGGAATACAATAATAGTGGGGG + Intergenic
1199912316 X:152299990-152300012 GGGGAATACCAGAGTGGAGATGG + Intronic
1200628553 Y:5553441-5553463 GAGGACTACCAGAGTGGGGAGGG - Intronic