ID: 1195933261

View in Genome Browser
Species Human (GRCh38)
Location X:110100952-110100974
Sequence CTGTTGTTCATGAGGAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1951
Summary {0: 1, 1: 0, 2: 7, 3: 234, 4: 1709}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195933261 Original CRISPR CTGTTGTTCATGAGGAATAT TGG Intronic
900515641 1:3080980-3081002 CTTTTGTTCATGAGGACACTCGG - Intronic
900699653 1:4037683-4037705 TTCATGTTCATCAGGAATATTGG - Intergenic
901958321 1:12804370-12804392 TCGATGTTCATCAGGAATATTGG + Intergenic
904816813 1:33209347-33209369 TTGATGTTCATCAGGGATATTGG + Intergenic
904854261 1:33484930-33484952 TCTTTGTTCATGAGGAATATTGG + Intronic
905525113 1:38631575-38631597 TTGATGTTCATCAGGGATATTGG + Intergenic
906736576 1:48135290-48135312 TTGATGTTCATCAGGGATATTGG + Intergenic
906739623 1:48169760-48169782 TTGATGTTCATCAGGGATATTGG + Intergenic
906883479 1:49618684-49618706 TTGATGTTCATCAGGTATATTGG - Intronic
906939390 1:50242921-50242943 TTGATGTTCATCAGGGATATTGG + Intergenic
907003682 1:50888791-50888813 TTGATGTTCATCAGGGATATTGG + Intronic
907369808 1:53993448-53993470 ATCTATTTCATGAGGAATATTGG - Intergenic
907435732 1:54445692-54445714 TTGATGTTCATCAGGGATATTGG + Intergenic
907566009 1:55434395-55434417 TCAATGTTCATGAGGAATATTGG - Intergenic
907685961 1:56611725-56611747 CTGATGTTCATCAGGGATATTGG - Intronic
907876415 1:58492980-58493002 TTGATGTTCATCAGGGATATTGG - Intronic
908083395 1:60604859-60604881 TTGATGTTCATCAGGGATATTGG - Intergenic
908178073 1:61575804-61575826 TTGATGTTCATCAGGGATATTGG + Intergenic
908283599 1:62569302-62569324 TTGATGTTCATTAGGGATATTGG - Intronic
908543328 1:65141882-65141904 CTGTTGCTCATGGAGAATAGTGG + Intergenic
908576382 1:65464452-65464474 TTGATGTTCATGAGGGATATTGG + Intronic
908677826 1:66625541-66625563 CTGTTGTTCATCACCCATATTGG - Intronic
908723701 1:67152875-67152897 TTGATGTTCATTAGGGATATTGG + Intronic
908895476 1:68893761-68893783 TTGATGTTCATCAGGGATATTGG - Intergenic
908972726 1:69856827-69856849 TTGATGTTCATCAGGGATATTGG - Intronic
909081899 1:71122568-71122590 CTGATGTTCATCAGGAATATTGG - Intergenic
909208744 1:72795012-72795034 CTGTTGTGCATGTGGGATACAGG + Intergenic
909230578 1:73084041-73084063 TTGATGTTCATGAGGGATATTGG + Intergenic
909236281 1:73155777-73155799 TTATTGTCCATCAGGAATATTGG - Intergenic
909297256 1:73966649-73966671 CTGATGTTCGTCAGGGATATTGG + Intergenic
909309791 1:74131439-74131461 TTGATGTTCATCAGGGATATTGG - Intronic
909396666 1:75178102-75178124 CTGATGTTCATCAGGGATATTGG + Intergenic
909689810 1:78394670-78394692 TTGATGTTCATCAGGGATATTGG + Intronic
910127481 1:83860414-83860436 CTATTTTACATGAGGAATAAAGG - Intergenic
910306882 1:85774297-85774319 TTGATGTTCATCAGGGATATTGG + Intronic
910308114 1:85789977-85789999 TTGATGTTCAGCAGGAATATTGG + Intronic
910314885 1:85871410-85871432 CTGAAGTTCATCAGGGATATTGG - Intronic
910336145 1:86133777-86133799 TTGATGTTCATCAGGGATATTGG + Intronic
910353883 1:86332527-86332549 TTGATGTTCATGAGGGATATTGG - Intergenic
910571937 1:88715200-88715222 TTGATGTTCATCAGGGATATTGG + Intronic
910632577 1:89371377-89371399 TTGATGTTCATCAGGGATATTGG - Intronic
910812127 1:91248996-91249018 TTGATGTTCATCAGGGATATTGG + Intergenic
910816902 1:91300498-91300520 TTGGTGTTCATCAGGGATATTGG - Intronic
910827470 1:91424801-91424823 TTGATGTTCATCAGGGATATTGG + Intergenic
910912875 1:92256468-92256490 TTGATGTTCATCAGGGATATTGG - Intronic
910929924 1:92433187-92433209 CTGATGTTCATCAGGGATATTGG + Intergenic
910942131 1:92548061-92548083 TTGATGTTCATCAGGGATATTGG - Intronic
910949636 1:92632107-92632129 TTGATGTTCATCAGGGATATTGG + Intronic
910957190 1:92719260-92719282 TTGATGTTCATGAGGGATGTTGG - Intronic
911079377 1:93913150-93913172 TTGATGTTCATCAGGGATATTGG + Intergenic
911106621 1:94137816-94137838 TTGATGTTCATCAGGGATATTGG - Intergenic
911120321 1:94289919-94289941 TTGATGTTCATCAGGGATATTGG + Intergenic
911240191 1:95456853-95456875 TTGATGTTCATCAGGGATATTGG - Intergenic
911279842 1:95910991-95911013 ATGTTCATCATCAGGAATATTGG + Intergenic
911311465 1:96297063-96297085 CTGTTGTGCCTGAGAAAGATGGG - Intergenic
911504346 1:98729973-98729995 CTGATGTTCATCAGGGATACTGG - Intronic
911508938 1:98787774-98787796 CTGATGTTCATCAGGGATATTGG - Intergenic
911516856 1:98878022-98878044 CCGATGTTCATCAGGGATATTGG + Intergenic
911555323 1:99337840-99337862 TTGATGTTCATCAGGGATATGGG + Intergenic
911633009 1:100203665-100203687 TTGATGTTCATCAGGGATATTGG - Intronic
911851827 1:102830209-102830231 TTGATGTTCATCAGGGATATTGG - Intergenic
911946063 1:104110934-104110956 CCTGTGTTCATGAGAAATATCGG + Intergenic
911963267 1:104334432-104334454 TTGATGTTCATCAGGGATATTGG + Intergenic
912003682 1:104865895-104865917 TTGATGTTCATCAGGGATATTGG - Intergenic
912093773 1:106114388-106114410 CTGATGTTCATCAGGGATATTGG - Intergenic
912150853 1:106856928-106856950 TTGATGTTCATCAGGGATATTGG - Intergenic
912226100 1:107735921-107735943 TTGATGTTCATCAGGGATATTGG - Intronic
912264833 1:108146842-108146864 TTGATGTTCATCAGGGATATTGG + Intronic
912303928 1:108545574-108545596 TTGATGTTCATCAGGGATATTGG - Intergenic
912614833 1:111087964-111087986 TTTATGTTCATCAGGAATATTGG + Intergenic
912742662 1:112215356-112215378 TTGATGTTCATCAGGGATATTGG - Intergenic
912959737 1:114185056-114185078 TTGATGTTCATCAGGGATATTGG + Intergenic
912967077 1:114245520-114245542 TTGATGTTCATCAGGGATATTGG - Intergenic
912973599 1:114307668-114307690 TTGATGTTCATCAGGGATATTGG - Intergenic
913020707 1:114786750-114786772 TTGATGTTCATCAGGGATATTGG + Intergenic
913108314 1:115635896-115635918 TTGCTGTTCATCAGGGATATTGG + Intergenic
913512854 1:119577903-119577925 TTGATGTTCATCAGGGATATTGG - Intergenic
914208022 1:145551776-145551798 TTGATGTTCATTAGGGATATTGG + Intergenic
915061014 1:153185132-153185154 TCGATGTTCATCAGGAATATTGG + Intergenic
915089170 1:153410696-153410718 CTGATATTCATCAGGGATATTGG - Intergenic
915649453 1:157297944-157297966 TTGATGTTCATCAGGGATATTGG - Intergenic
915653273 1:157335467-157335489 CTGGTTTGCATGAGGAATAGAGG - Intergenic
915688798 1:157665317-157665339 TCGATGTTCATCAGGAATATTGG - Intergenic
915869388 1:159541809-159541831 TTGATGTTCATCAGGGATATTGG - Intergenic
915998752 1:160593553-160593575 TTGATGTTCATCAGGTATATTGG + Intergenic
916182846 1:162102373-162102395 CTGATGTTCATCAAGGATATTGG + Intronic
916298316 1:163245245-163245267 GTGTAGTACATGAGGGATATAGG - Intronic
916372976 1:164120336-164120358 TTGATGTTCATCAGGGATATTGG - Intergenic
916469128 1:165105645-165105667 TTGATGTTCATCAGGGATATTGG + Intergenic
916614511 1:166425883-166425905 TTGATGTTCATCAGGGATATTGG + Intergenic
916625219 1:166548552-166548574 TCGATGTTCATCAGGAATATTGG + Intergenic
916916430 1:169411599-169411621 TTGATGTTCATCAGGGATATTGG - Intronic
916938874 1:169659957-169659979 TTGATGTTCATCAGGGATATTGG - Intergenic
916944582 1:169713186-169713208 ATGATGTTCATCAGGGATATTGG - Intronic
917079396 1:171241058-171241080 TTGATGTTCATCAGGGATATTGG - Intergenic
917313274 1:173699386-173699408 TTGATGTTCATCAGGGATATTGG - Intergenic
917316326 1:173729437-173729459 TTGATGTTCATCAGGGATATTGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917356081 1:174127893-174127915 TTGATGTTCATCAGGGATATTGG + Intergenic
917568243 1:176234321-176234343 TTGATGTTCATCAGGGATATTGG + Intergenic
917572632 1:176284686-176284708 CTGATGTTCATCAGGGATATTGG + Intergenic
917682429 1:177381321-177381343 TTGATGTTCATCAGGGATATTGG + Intergenic
917713980 1:177715120-177715142 TTGATGTTCATCAGGGATATTGG - Intergenic
917736785 1:177928651-177928673 CCTTTGTTAATGAGGAATCTAGG - Intronic
917757299 1:178114938-178114960 CCTATATTCATGAGGAATATTGG + Intronic
918159611 1:181885925-181885947 ATGATGTTCATGAGGGATATTGG - Intergenic
918536448 1:185580248-185580270 TTGATGTTCATCAGGGATATTGG + Intergenic
918537502 1:185590101-185590123 TTGATGTTCATTAGGGATATTGG - Intergenic
918890045 1:190255200-190255222 TTGATGTTCATCAGGGATATTGG + Intronic
918973072 1:191445201-191445223 CTGATGTTCATCAGGGATATTGG + Intergenic
919060284 1:192623267-192623289 ATGATGTTCATCAGGGATATTGG + Intergenic
919128823 1:193428917-193428939 TTGATGTTCATCAGGGATATTGG + Intergenic
919146446 1:193641836-193641858 CGGATGTTCATGAGGGATATTGG + Intergenic
919254976 1:195109358-195109380 TTGATGTTCATCAGGGATATTGG - Intergenic
919382333 1:196874605-196874627 GTTTTTTTCATGGGGAATATAGG - Intronic
919395767 1:197045728-197045750 TCGATGTTCATCAGGAATATTGG - Intronic
919599521 1:199605384-199605406 GTGATGTTCATCAGGGATATTGG - Intergenic
919602240 1:199636558-199636580 TTGATGTTCATCAGGGATATTGG - Intergenic
919717914 1:200799095-200799117 TTGATGTTCATCAGGGATATTGG + Intronic
921289227 1:213639825-213639847 TCTCTGTTCATGAGGAATATTGG + Intergenic
921469937 1:215535925-215535947 TTGATGTTCATCAGGGATATTGG - Intergenic
921881369 1:220258299-220258321 CTGATGTTCATCAGGAATATTGG - Intronic
921981118 1:221259878-221259900 TTGATGTTCATCAGGGATATTGG + Intergenic
922066567 1:222149409-222149431 TTGATGTTCATCAGGGATATTGG - Intergenic
922147376 1:222961183-222961205 TTGATGTTCATCAGGGATATTGG - Intronic
922253019 1:223867268-223867290 TTGATGTTCATCAGGGATATTGG + Intergenic
922319739 1:224475808-224475830 TCAATGTTCATGAGGAATATTGG - Intronic
922383532 1:225057956-225057978 TTGATGTTCATCAGGGATATTGG + Intronic
922387692 1:225104312-225104334 TTGATGTTCATCAGGGATATTGG + Intronic
922391690 1:225150321-225150343 CTGATGTTCATGAAGGATATTGG + Intronic
922600009 1:226843639-226843661 TCCATGTTCATGAGGAATATTGG + Intergenic
922610971 1:226927817-226927839 TTGATGTTCATCAGGGATATTGG - Intronic
922692245 1:227703330-227703352 CTGATGTTCATCAGGGATATTGG - Intergenic
922826347 1:228523119-228523141 TTGATGTTCATCAGGGATATTGG + Intergenic
923060906 1:230473071-230473093 TTGCTGTTCATCAGGGATATTGG + Intergenic
923081041 1:230655525-230655547 TTGATGTTCATCAGAAATATTGG + Intronic
923416421 1:233766594-233766616 TCGATGTTCATCAGGAATATTGG + Intergenic
923422069 1:233825943-233825965 TTGATGTTCATCAGGGATATCGG - Intergenic
923431380 1:233924071-233924093 TCGTTGTTCATCAGGAATATTGG + Intronic
923587264 1:235284869-235284891 TTTTTGCTCATGAGGGATATTGG - Intronic
923902618 1:238344418-238344440 TTGATGTTCATAAGGGATATTGG + Intergenic
923982845 1:239345154-239345176 CTGTTATTCATGAGTAAGAATGG - Intergenic
924298856 1:242616318-242616340 TTGATGTTCATCAGGGATATTGG - Intergenic
924652613 1:245943696-245943718 CTGATGTTCATCAGGAGTATTGG - Intronic
924731701 1:246717900-246717922 TTGATGTTCATCAGGGATATTGG - Intergenic
924828685 1:247569633-247569655 TTGATGTTCATCAGGGATATTGG + Intronic
924873739 1:248077269-248077291 TTGATGTTCATCAGGGATATTGG + Intronic
924955517 1:248922884-248922906 TTGATGTTCATCAGGAATACTGG + Intergenic
1062810768 10:462738-462760 TTGATGTTCATCAGGGATATCGG - Intronic
1063044471 10:2377556-2377578 GTGTTGTTGATGAGGACTCTTGG - Intergenic
1063305607 10:4896877-4896899 TTGATGTTCATCAGGGATATTGG + Intergenic
1063350396 10:5348893-5348915 CTGTTATGTATGAGAAATATAGG - Intergenic
1064202052 10:13293058-13293080 CTCTTGTGTATAAGGAATATTGG + Intronic
1064563522 10:16616578-16616600 TTGATCTTCATCAGGAATATTGG - Intronic
1065077237 10:22093020-22093042 TTGATGTTCATCAGGGATATTGG - Intergenic
1065080212 10:22121854-22121876 TTGATGTTCATCAGGGATATTGG + Intergenic
1065414870 10:25473382-25473404 TTGATGTTCATCAGGGATATTGG + Intronic
1065463363 10:25992935-25992957 TTGATGTTCATCAGGGATATTGG + Intronic
1066151559 10:32625674-32625696 CAGTTATTCACGAGGAATAAAGG - Intronic
1066168874 10:32819530-32819552 TCGATGTTCATGAGGGATATTGG - Intronic
1066318235 10:34271267-34271289 TTCATATTCATGAGGAATATTGG - Intronic
1066583799 10:36909889-36909911 TTGATGTTCATCAGGGATATTGG + Intergenic
1066595649 10:37046955-37046977 TTGATGTTCATCAGGGATATTGG + Intergenic
1066709676 10:38219968-38219990 CTGATGTTCATCAGAGATATTGG - Intergenic
1067042872 10:42965610-42965632 CTGAAGTTCATGAGAAATGTTGG + Intergenic
1067127301 10:43529895-43529917 TTGATGTTCATCAGGGATATTGG + Intergenic
1067342006 10:45413156-45413178 TTGATGTTCATCAGGGATATTGG - Intronic
1068144107 10:53044348-53044370 CTGGGGTTCCTGAGGAAGATGGG - Intergenic
1068214947 10:53971001-53971023 TTGATGTTCATCAGGGATATTGG - Intronic
1068377908 10:56209093-56209115 TTGATGTTCATCAGGGATATTGG + Intergenic
1068408458 10:56624626-56624648 ATTTTCTTCATCAGGAATATAGG + Intergenic
1068413508 10:56687515-56687537 TTGATGTTCATCAGGGATATTGG - Intergenic
1068490675 10:57719801-57719823 TTGCTGTTCATCAGGGATATTGG - Intergenic
1068504682 10:57885652-57885674 TCGATGTTCATCAGGAATATTGG - Intergenic
1068651922 10:59531914-59531936 TTGATGTTCATCAGGGATATTGG - Intergenic
1068728422 10:60328847-60328869 TTGATGTTCATCAGGGATATTGG - Intronic
1068951965 10:62786348-62786370 TTGATGTTCATCAGGGATATTGG - Intergenic
1069120448 10:64563574-64563596 TTGATGTTCATCAGGGATATTGG + Intergenic
1069198976 10:65589533-65589555 TTGATATTCATCAGGAATATTGG + Intergenic
1069336993 10:67364039-67364061 TTGATGTTCATCAGGCATATTGG - Intronic
1069355592 10:67581486-67581508 TTGATGTTCATCAGGGATATTGG + Intronic
1069573803 10:69511002-69511024 TCGTTGTTCATCAGGGATATTGG + Intergenic
1070003406 10:72399007-72399029 TTGATGTTCATCAGGGATATTGG - Intronic
1070032221 10:72688094-72688116 CTGTGGTTCGTGATAAATATTGG + Intergenic
1070062026 10:72993289-72993311 TTGATGTTCATCAGGGATATTGG - Intergenic
1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG + Intronic
1071134208 10:82434871-82434893 CTGATGTTCATCAGGGATATTGG + Intronic
1071884409 10:89933961-89933983 TTGATGTTCATCAGGGATATTGG + Intergenic
1072053923 10:91734205-91734227 TTGATGTTCATCAGGGATATTGG + Intergenic
1072226520 10:93375151-93375173 TTGATGTTCATAAGGAATACAGG + Intronic
1072387805 10:94949904-94949926 TTGGTGTTCATCAGGGATATTGG - Intronic
1072388472 10:94957335-94957357 TTGATGTTCATCAGGGATATTGG + Intronic
1072397596 10:95061068-95061090 TTGATGTTCATCAGGGATATTGG + Intronic
1072849662 10:98875037-98875059 CTGATGTTCATTAGGGATATTGG + Intronic
1072869541 10:99102696-99102718 TCGTTGTTCATCAGGGATATTGG - Intronic
1072953161 10:99866125-99866147 TTGATGTTCATCAGGGATATCGG + Intergenic
1073228876 10:101949785-101949807 CTAGTATTCATGAGGTATATTGG - Intronic
1073364004 10:102922539-102922561 CTTTTGTAAATGAGGAATTTAGG - Intronic
1073927712 10:108536299-108536321 TTGATGTTCATCAGGGATATTGG - Intergenic
1073933940 10:108607812-108607834 TCATTGTTCATCAGGAATATTGG + Intergenic
1073979203 10:109135119-109135141 TTGATGTTCATCAGGGATATTGG - Intergenic
1074283445 10:112075480-112075502 CTGTTCTTCAGTGGGAATATCGG - Intergenic
1074480201 10:113812800-113812822 TTGATGTTCATCAGGGATATTGG - Intergenic
1074638661 10:115351700-115351722 ATCTTGTTCATGAGTGATATTGG + Intronic
1075010435 10:118864385-118864407 TTGATGTTCATCAGGGATATTGG - Intergenic
1076093401 10:127709704-127709726 TCGATGTTCATCAGGAATATTGG - Intergenic
1076748876 10:132530734-132530756 ATAGTGTTCATCAGGAATATTGG + Intergenic
1077742103 11:4857789-4857811 TTGATGTTCATCAGGGATATTGG - Intronic
1077762119 11:5113300-5113322 TTGATGTTCATCAGGGATATAGG + Intergenic
1077855406 11:6119291-6119313 TGGATGTTCATCAGGAATATTGG - Intergenic
1078032565 11:7767853-7767875 TTGATGTTCATCAGGGATATTGG - Intergenic
1078034477 11:7788757-7788779 CTGATGTTCATCAGGGATATTGG - Intergenic
1078121986 11:8520057-8520079 TCGATGTTCATGAGGGATATTGG - Intronic
1078429429 11:11276938-11276960 TTGATGTTCATCAGGGATATTGG + Intronic
1078484976 11:11713720-11713742 TTGATGTTCATCAGGGATATTGG + Intergenic
1078691642 11:13586341-13586363 CTGATATTCATCAGGGATATTGG - Intergenic
1078796485 11:14597172-14597194 TTGATGTTCATCAGGGATATTGG + Intronic
1078833146 11:14995878-14995900 TTGATGTTCATCAGGGATATTGG - Intronic
1078911523 11:15737044-15737066 CTGATGTTTATGAGGAATCAAGG - Intergenic
1078952034 11:16145064-16145086 TTGATGTTCATCAGGGATATTGG - Intronic
1078978033 11:16500024-16500046 TTGATGTTCATCAGGGATATTGG - Intronic
1079037222 11:17030929-17030951 TTGATGTTCATCAGGGATATGGG + Intergenic
1079257199 11:18841561-18841583 TTGATGTTCATCAGGGATATCGG - Intergenic
1079262213 11:18894023-18894045 CTGATGTTCATCTGGGATATTGG + Intergenic
1079262798 11:18899863-18899885 TTGATGTTCATCAGGGATATTGG - Intergenic
1079276609 11:19043708-19043730 TTGATGTTCATCAGGGATATTGG - Intergenic
1079516509 11:21275614-21275636 TTGATGTTCATCAGGCATATTGG - Intronic
1079578150 11:22028653-22028675 CTGATGTTCATCAGGGATATTGG - Intergenic
1079752892 11:24220799-24220821 TTGATGTTCATCAGGGATATTGG - Intergenic
1079757376 11:24281495-24281517 CTGATGTTCATCAGGGATATTGG + Intergenic
1079832212 11:25282320-25282342 TTGATGTTCATCAGGGATATTGG - Intergenic
1079864776 11:25721168-25721190 ACGATGTTCATCAGGAATATTGG + Intergenic
1079971040 11:27035525-27035547 CTGATGTTCATCAAGGATATTGG - Intergenic
1080130563 11:28789755-28789777 TTGATGTTCATCAGGGATATTGG + Intergenic
1080138194 11:28883271-28883293 TTGGTGTTCATCAGGGATATTGG - Intergenic
1080185452 11:29478749-29478771 ATGATTTTCATGAGAAATATTGG - Intergenic
1080235518 11:30064064-30064086 TTGATGTTCATCAGGGATATTGG + Intergenic
1080409499 11:32010252-32010274 AGGTTGCTCATGAGGAAGATGGG - Intronic
1080489154 11:32744335-32744357 CTGATGTTCATCAGGGATATTGG + Intronic
1080706106 11:34695474-34695496 TTTATGTTCATTAGGAATATTGG + Intergenic
1080736975 11:35025685-35025707 TTGATGTTCATCAGGGATATTGG - Intergenic
1080744287 11:35094344-35094366 TTGATGTTCATCAGGGATATTGG - Intergenic
1080914512 11:36642571-36642593 TCGATGTTCATGAGGGATATTGG - Intronic
1081151115 11:39633816-39633838 TTGATGTTCATCAGGGATATTGG + Intergenic
1081221952 11:40473167-40473189 TTGATGTTCATCAGGGATATTGG - Intronic
1081317404 11:41647495-41647517 TCGATGTTCATCAGGAATATTGG + Intergenic
1081480358 11:43481323-43481345 TTTATGTTCATGAGGGATATTGG + Intronic
1082136605 11:48555995-48556017 TTGATGTTCATCAGGGATATTGG + Intergenic
1082182920 11:49142377-49142399 TTGATGTTCATCAGGGATATTGG - Intergenic
1082559079 11:54597724-54597746 TTGATGTTCATCAGGAATATTGG + Intergenic
1082617331 11:55376989-55377011 TTGATGTTCATCAGGGATATTGG - Intergenic
1082674344 11:56077393-56077415 CTGATGTTTATTAGGGATATTGG + Intergenic
1082684175 11:56218205-56218227 TTGATGTTCATCAGGGATATTGG + Intergenic
1082914195 11:58413857-58413879 TTGATGTTCATCAGGGATATTGG - Intergenic
1082924961 11:58535235-58535257 TTGATGTTCATCAGGGATATTGG - Intronic
1083003345 11:59317894-59317916 TTGATGTTCATCAGGGATATTGG + Intergenic
1083095907 11:60251140-60251162 TCGATGTTCATCAGGAATATTGG + Intergenic
1083383635 11:62290390-62290412 TTGATGTTCATCAGGGATATTGG - Intergenic
1083507351 11:63170878-63170900 TTGATGTTCATCAGGGATATTGG - Intronic
1083510569 11:63205862-63205884 CTAATGTTCATCAGGAATATTGG - Intronic
1083522721 11:63330513-63330535 CTGATATTCATCAGGGATATTGG + Intronic
1083604030 11:63966716-63966738 ATGTTGTTTGTAAGGAATATTGG - Intergenic
1085133532 11:74063342-74063364 TTGATGTTCATCAGGGATATTGG - Intronic
1085207900 11:74748069-74748091 GTTTTGTACATGAGGAATGTAGG + Intergenic
1085434268 11:76485260-76485282 TTGATGTTCATCAGGGATATTGG - Intronic
1085594481 11:77796224-77796246 TTGATGTTCATCAGGGATATTGG - Intronic
1085672642 11:78482953-78482975 TTGATGTTCATCAGGGATATTGG - Intronic
1085884763 11:80508805-80508827 TTGATGTTCATCAGGGATATTGG - Intergenic
1085908521 11:80793723-80793745 TTGATGTTCATCAGGTATATTGG - Intergenic
1086030183 11:82345331-82345353 TTGATGTTCATCAGGGATATTGG - Intergenic
1086243936 11:84728517-84728539 TCGATGTTCATCAGGAATATTGG + Intronic
1086280091 11:85175180-85175202 TCGATGTTCATCAGGAATATTGG - Intronic
1086308261 11:85505646-85505668 TTGATGTTCATCAGGGATATTGG + Intronic
1086411060 11:86544872-86544894 TTGATGTTCATCAGGGATATTGG - Intronic
1086522727 11:87688971-87688993 TTGATGTTCATCAGGAATATTGG - Intergenic
1086530813 11:87782960-87782982 TTGATGTTCATCAGGGATATTGG - Intergenic
1086532005 11:87797554-87797576 TTGGTGTTCATGAGGGATACTGG - Intergenic
1086586638 11:88460275-88460297 TTGATGTTCATCAGGGATATTGG + Intergenic
1086612543 11:88774872-88774894 TTGATGTTCATCAGGGATATTGG + Intronic
1086790631 11:91033751-91033773 TCGATGTTCATCAGGAATATTGG + Intergenic
1086906803 11:92427796-92427818 CTGATGTTCATCAGGAATATTGG + Intronic
1086914707 11:92516202-92516224 TTGATGTTCATCAGGGATATTGG - Intronic
1086962469 11:92992852-92992874 TCTTTGTTCATGAGAAATATTGG - Intergenic
1087052397 11:93899233-93899255 TTGATGTTCATCAGGGATATTGG - Intergenic
1087089308 11:94251745-94251767 TTGATGTTCATCAGGGATATGGG - Intergenic
1087207207 11:95409505-95409527 TTGATGTTCATCAGGGATATTGG - Intergenic
1087316676 11:96611543-96611565 TCGATGTTCATCAGGAATATTGG + Intergenic
1087337239 11:96860112-96860134 CTGATGTTCATCAAGAATATTGG + Intergenic
1087383454 11:97438780-97438802 CTGATATTCATCAGGGATATTGG - Intergenic
1087391494 11:97540773-97540795 TTGATGTTCATCAGGGATATTGG - Intergenic
1087442369 11:98202623-98202645 TTGATGTTCATTAGGAATATTGG - Intergenic
1087518036 11:99191267-99191289 CCTGTGTTCATCAGGAATATTGG + Intronic
1087560673 11:99785558-99785580 TCGATGTTCATCAGGAATATCGG - Intronic
1087569498 11:99906573-99906595 TTGATGTTCATTAGGAATATTGG + Intronic
1087740043 11:101876974-101876996 CCGATGTTCATCAGGGATATTGG + Intergenic
1087888124 11:103504179-103504201 TTGATGTTCATCAGGGATATTGG - Intergenic
1087950305 11:104212819-104212841 TTGATGTTCATCAGGGATATTGG - Intergenic
1087954518 11:104268417-104268439 TTGATGTTCATCAGGGATATTGG - Intergenic
1088066801 11:105729572-105729594 TTGATGTTCATCAGGTATATTGG - Intronic
1088077966 11:105875341-105875363 TTGATGTTCATCAGGGATATTGG + Intronic
1088084224 11:105958540-105958562 TTGATGTTCATCAGGGATATTGG + Intronic
1088307504 11:108425711-108425733 TTGATGTTCATCAGGTATATTGG - Intronic
1088380734 11:109189809-109189831 TTGATGTTCATCAGGGATATTGG + Intergenic
1088509200 11:110557262-110557284 TCGATGTTCATCAGGAATATTGG + Intergenic
1088656991 11:112009523-112009545 TTGATGTTCATCAGGGATATTGG - Intronic
1088696871 11:112374098-112374120 TTGATGTTCATCAGGGATATTGG + Intergenic
1089285089 11:117401406-117401428 TTGATGTTCATCAGGGATATTGG + Intronic
1089765675 11:120762865-120762887 TCGATGTTCATCAGGAATATTGG + Intronic
1090184969 11:124732121-124732143 CTGCTGTTTATGAGGAATTAAGG - Intergenic
1090313048 11:125759666-125759688 TTGATGTTCATCAGGGATATTGG - Intergenic
1090545138 11:127757091-127757113 TTGATGTTCATCAGGGATATTGG + Intergenic
1090567431 11:128010178-128010200 TTGATGTTCATCAGGGATATTGG - Intergenic
1090689207 11:129159785-129159807 TTGATGTTCATCAGGGATATTGG - Intronic
1090723319 11:129497199-129497221 CTGATGTTCATCAAGGATATTGG - Intergenic
1090740635 11:129656972-129656994 TTGATGTTCATCAGGGATATTGG - Intergenic
1090842355 11:130502364-130502386 TTTATATTCATGAGGAATATTGG + Intergenic
1090946684 11:131436214-131436236 TTGATGTTCATCAGGGATATTGG + Intronic
1091052633 11:132387118-132387140 TTGATGTTCATCAGGGATATTGG - Intergenic
1091365205 11:135013614-135013636 TTGATGTTCATCAGGGATATTGG + Intergenic
1091811347 12:3400722-3400744 CTGATGTTCATCAAGGATATTGG - Intronic
1091867598 12:3854846-3854868 TTGATGTTCATCAGGGATATTGG - Intronic
1092402993 12:8193619-8193641 TTGATGTTCATCAGGGATATTGG + Intergenic
1092417667 12:8303492-8303514 CCGATGTTCATCAGGGATATTGG + Intergenic
1092562351 12:9629696-9629718 TTGATGTTCATCAGGGATATTGG + Intergenic
1092567557 12:9684807-9684829 TTGATGTTCATCAGGAATATTGG + Intronic
1092647205 12:10588461-10588483 CTTTAAGTCATGAGGAATATGGG - Intergenic
1092703588 12:11260035-11260057 CTGATGTTCATCAGGGATATTGG - Intergenic
1092706162 12:11287303-11287325 TTGATGTTCATGAGGGATATTGG - Intergenic
1093160665 12:15742475-15742497 TTGATGTTCATTAGGGATATTGG - Intronic
1093248626 12:16771459-16771481 CTGATGGTCATCAGGGATATTGG + Intergenic
1093660251 12:21748594-21748616 TTGATGTTCATCAGGGATATTGG - Intronic
1093664116 12:21791982-21792004 TTGATGTTCATCAGGGATATTGG + Intergenic
1093666828 12:21824418-21824440 ATGATGTTCATCAGGGATATTGG + Intronic
1093806368 12:23437982-23438004 TTGATGTTCATCAGGGATATTGG - Intergenic
1093835289 12:23821748-23821770 TTGATGTTCATCAGGGATATTGG + Intronic
1094130883 12:27073906-27073928 TTGATGTTCATCAGGGATATTGG + Intergenic
1094139692 12:27168255-27168277 TTGATGTTCATCAGGGATATTGG + Intergenic
1094273010 12:28638077-28638099 TTGATGTTCATCAGGGATATTGG - Intergenic
1094730382 12:33167779-33167801 CCGATGTTCATCAGGGATATTGG - Intergenic
1095224732 12:39666493-39666515 TCGATGTTCATCAGGAATATTGG + Intronic
1095230014 12:39728573-39728595 TTGATGTTCATCAGGCATATTGG + Intronic
1095442453 12:42251334-42251356 TTGATGTTCATCAGGGATATTGG + Intronic
1095505926 12:42898271-42898293 TCGATGTTCATCAGGAATATTGG + Intergenic
1095564806 12:43610538-43610560 TTGATGTTCATCAGGGATATTGG - Intergenic
1095827166 12:46542367-46542389 TTGATGTTCATCAGGAATATTGG + Intergenic
1095913613 12:47454225-47454247 TTGATGTTCATCAGGGATATTGG + Intergenic
1095918163 12:47501266-47501288 TTGATGTTCATCAGGGATATTGG - Intergenic
1095935574 12:47676956-47676978 TTGATGTTCATCAGGGATATTGG - Intronic
1096015736 12:48272535-48272557 TTGATGTTCATCAGGGATATTGG + Intergenic
1096027699 12:48381537-48381559 CTGATATTCATCAGGGATATTGG + Intergenic
1096035330 12:48463643-48463665 CTGATGTTCATCAAGGATATTGG - Intergenic
1096894693 12:54809370-54809392 CTGATGTTCATCAGGGATATTGG + Intergenic
1097301050 12:58019559-58019581 TTGATGTTCATCAGGAATATTGG + Intergenic
1097470469 12:59984592-59984614 TTGATGTTCATCAAGAATATTGG - Intergenic
1097499417 12:60383392-60383414 CTGATGTTTATCAGGGATATTGG + Intergenic
1097530549 12:60794354-60794376 TTGATGTTCATCAGGGATATTGG + Intergenic
1097619858 12:61926409-61926431 TTGATGTTCATCAGGGATATTGG - Intronic
1097634870 12:62110405-62110427 TTGATGTTCATCAGGGATATTGG + Intronic
1097701345 12:62823462-62823484 TCGATGTTCATCAGGAATATTGG - Intronic
1097722088 12:63032709-63032731 TTGATGTTCATCAGGGATATTGG + Intergenic
1097749903 12:63340579-63340601 TTGATGTTCATCAGGGATATTGG - Intergenic
1097752280 12:63368845-63368867 TTGATGTTCATCAGGGATATTGG + Intergenic
1097792680 12:63831341-63831363 TTGATGTTCATCAGGGATATTGG - Intergenic
1097911964 12:64980196-64980218 TTGATGTTCATCAGGGATATTGG + Intergenic
1097948467 12:65400029-65400051 TTGATGTTCATCAGGGATATTGG + Intronic
1098004427 12:65980930-65980952 TTGATGTTCATCAGGGATATTGG - Intergenic
1098452016 12:70630132-70630154 TTGATGTTCATCAGGGATATTGG - Intronic
1098475642 12:70899284-70899306 TTTGTGTTCATGAGCAATATTGG - Intronic
1098609655 12:72440186-72440208 TTTATGTTCATCAGGAATATTGG + Intronic
1098776866 12:74631499-74631521 CTGAAGTTCATCAGGGATATTGG - Intergenic
1098830337 12:75353705-75353727 TTGATGTTCATCAGGGATATTGG - Intronic
1098927077 12:76362249-76362271 TCGATGTTCATCAGGAATATTGG - Intronic
1099086636 12:78254449-78254471 TTGATGTTCATCAGGGATATTGG + Intergenic
1099216973 12:79865032-79865054 TCGATGTTCATCAGGAATATTGG - Intronic
1099344210 12:81477830-81477852 TTGATGTTCATCAGGAATATTGG + Intronic
1099388541 12:82049552-82049574 TTGATGTTCATCAGGGATATTGG - Intergenic
1099427956 12:82547602-82547624 TTGATGTTCATCAGGGATATTGG + Intergenic
1099489746 12:83273848-83273870 TTGATGTTCATCAGGGATATTGG + Intergenic
1099502247 12:83428503-83428525 TCGCTGTTCATCAGGAATATTGG + Intergenic
1099540605 12:83903311-83903333 TTGATGTTCATCAGGGATATTGG - Intergenic
1099549042 12:84020212-84020234 TTGATGTTCATCAGGAATATTGG - Intergenic
1099556091 12:84109451-84109473 TTGATGTTCATCAGGTATATTGG - Intergenic
1099590235 12:84577815-84577837 TTGATGTTCATCAGGGATATTGG - Intergenic
1099687327 12:85907306-85907328 CCTATGTTCATCAGGAATATTGG + Intergenic
1099740702 12:86630466-86630488 TCGATGTTCATCAGGAATATTGG - Intronic
1099753477 12:86808343-86808365 CTAATGTTCATCAGGGATATTGG - Intronic
1100381681 12:94067970-94067992 TTGATGTTCATCAGGGATATTGG - Intergenic
1100740386 12:97585094-97585116 TTGATGTTCATCAGGGATATTGG - Intergenic
1100765346 12:97858396-97858418 CTGTAGTTCATTAGGGATATTGG - Intergenic
1100896610 12:99189407-99189429 TTGATGTTCATCAGGGATATTGG - Intronic
1100907464 12:99318092-99318114 TCATTGTTCATCAGGAATATTGG + Intronic
1101183975 12:102253566-102253588 TTGATGTTCATCAGGGATATTGG + Intergenic
1101201992 12:102446149-102446171 TTGATGTTCATCAGGGATATTGG + Intronic
1101243243 12:102859537-102859559 TTGATGTTCATCAGGGATATTGG - Intronic
1101362147 12:104037859-104037881 CTGATGTTCATAAGGGATATTGG - Intronic
1101472320 12:105009891-105009913 TTGATGTTCATCAGGGATATTGG + Intronic
1101596193 12:106167153-106167175 CTGGTGTTCATCAGGGATATTGG - Intergenic
1101653900 12:106702934-106702956 CAGGTGTTCATGAGGAAGACTGG - Intronic
1101660572 12:106761593-106761615 CTCATGTTCATTAGGAAAATGGG - Exonic
1102911327 12:116716449-116716471 CTGAGGTTCGTGAGGAATATAGG + Exonic
1102983212 12:117258725-117258747 CTGATGTAGATGAGGAACATGGG - Intronic
1103032232 12:117625630-117625652 TTGATGTTCATCAGGGATATTGG + Intronic
1103168812 12:118795545-118795567 CTGATGTTCACCAGGGATATTGG + Intergenic
1103187120 12:118968448-118968470 TTGATGTTCATTAGGGATATTGG + Intergenic
1104086615 12:125480823-125480845 TTGATGTTCATCAGGGATATTGG - Intronic
1104651134 12:130534900-130534922 CTGTGGTCCATGAGGAACATGGG + Intronic
1105244279 13:18634539-18634561 TTGATGTTCATCAGGGATATTGG - Intergenic
1105552272 13:21409035-21409057 TTGATGTTCATCAGGGATATTGG + Intronic
1105769769 13:23597811-23597833 TTGATGTTCATCAGGGATATTGG - Intronic
1105776221 13:23663443-23663465 TTGGTGTTCATCAGGGATATTGG + Intronic
1105789414 13:23783170-23783192 CTGATGTTCATCAGGGATATTGG - Intronic
1105963216 13:25361559-25361581 TTGATGTTCATCAGGGATATTGG - Intergenic
1105992940 13:25640818-25640840 TTGATGTTCATCAGGGATATTGG - Intronic
1106026012 13:25955839-25955861 CTGATGTTCATCAGGGATATTGG - Intronic
1106377048 13:29199617-29199639 TTGATGTTCATCAGGGATATGGG + Intronic
1106492944 13:30245118-30245140 TTGATGTTCATCGGGAATATTGG - Intronic
1106617585 13:31344128-31344150 TTGATGTTCATCAGGGATATTGG - Intergenic
1106638907 13:31562034-31562056 TTGATGTTCATCAGGGATATTGG + Intergenic
1106690333 13:32108334-32108356 GTGTTGATGATGAGGAAGATAGG + Intronic
1106983513 13:35318528-35318550 TTGGTGTTCATCAGGGATATTGG + Intronic
1107175988 13:37398733-37398755 CTGATGTTCATCAAGGATATTGG - Intergenic
1107226089 13:38049101-38049123 TCTTTGTTCATCAGGAATATTGG - Intergenic
1107244255 13:38273614-38273636 TTGATGTTCATCAGGGATATTGG - Intergenic
1107395270 13:40009157-40009179 TTGATGTTCATCAGGGATATTGG + Intergenic
1107487140 13:40839433-40839455 TTGATGTTCATCAGGGATATTGG - Intergenic
1107492112 13:40890655-40890677 TTGATGTTCATCAGGGATATTGG - Intergenic
1107613791 13:42143325-42143347 TTGATGTTCATCAGGGATATTGG + Intronic
1107968504 13:45618794-45618816 TTGATGTTCATCAGGGATATTGG + Intergenic
1108012299 13:46029815-46029837 CTATTATTCATGAGAGATATTGG - Intronic
1108095813 13:46899583-46899605 CTGTTCTTCATGAGAAATAATGG - Intergenic
1108154106 13:47567604-47567626 TCGATGTTCATGAGGGATATTGG - Intergenic
1108384193 13:49883437-49883459 TTGATGTTCATCAGGGATATTGG - Intergenic
1108445549 13:50505467-50505489 TTGATGTTCATCAGGTATATTGG + Intronic
1108477175 13:50831912-50831934 TTGATGTTCATCAGGGATATTGG + Intronic
1108567017 13:51710001-51710023 CTGATGTTCATCAGGGATATTGG - Intronic
1108892175 13:55274992-55275014 TTGATGTTCATCAGGGATATTGG + Intergenic
1108957992 13:56185227-56185249 TTGATGTTCATCAGGGATATTGG - Intergenic
1109216381 13:59594347-59594369 TTGATGTTCATCAGGGATATTGG - Intergenic
1109504647 13:63284655-63284677 TTGAAGTTCATCAGGAATATTGG + Intergenic
1109531524 13:63654861-63654883 CTGATGTTTATCAGGGATATTGG + Intergenic
1109563782 13:64083635-64083657 ACTATGTTCATGAGGAATATTGG - Intergenic
1109731432 13:66419263-66419285 TTGATGTTCATCAGGGATATTGG - Intronic
1109839034 13:67899160-67899182 TTGATGTTCATCAGGGATATTGG - Intergenic
1110149067 13:72228198-72228220 TTGATGTTCATCAGGGATATTGG + Intergenic
1110199370 13:72830701-72830723 TTGATGTTCATCAGGGATATTGG + Intronic
1110457929 13:75711226-75711248 TTGATGTTCATCAGGGATATTGG + Intronic
1110606621 13:77440250-77440272 TTGATGTTCATCAGGGATATTGG + Intergenic
1110737120 13:78950247-78950269 CTGATGTTCATCAGGGATATTGG + Intergenic
1110768111 13:79303624-79303646 CTGATGTTTATCAGGGATATTGG - Intergenic
1110826657 13:79978934-79978956 TCGATGTTCATGAGGGATATTGG - Intergenic
1110968522 13:81731719-81731741 TTGATGTTCATAAGGGATATTGG + Intergenic
1111056407 13:82956348-82956370 CTGATGTTCATCAGGGATATTGG - Intergenic
1111114525 13:83757835-83757857 TTGATGTTCATCAGGAATATTGG - Intergenic
1111286795 13:86104423-86104445 TTGATGTTCATCAGGCATATTGG + Intergenic
1111434960 13:88194332-88194354 TTGATGTTCATCAGGGATATTGG + Intergenic
1111575180 13:90144265-90144287 CTGATGTTCATCAGGGATATTGG - Intergenic
1111704754 13:91734254-91734276 TTGATGTTCATCAGGGATATTGG + Intronic
1111747113 13:92284455-92284477 TTGATGTTCATCAGGGATATCGG - Intronic
1112069144 13:95828883-95828905 TTGATGTTCATCAGGGATATTGG - Intronic
1112075791 13:95911800-95911822 TTGATGTTCATCAGGGATATTGG - Intronic
1112087696 13:96049046-96049068 TTGATGTTCATCAGGGATATTGG - Intronic
1112231991 13:97597689-97597711 TCTATGTTCATGAGGAATATTGG - Intergenic
1112363157 13:98735047-98735069 GTGATGTTCATCAGGGATATTGG - Intronic
1112482407 13:99788627-99788649 CTGATGTTCATCAGGGATTTTGG + Intronic
1112647954 13:101356752-101356774 TTGATGTTCATCAGGGATATTGG - Intronic
1112668183 13:101600865-101600887 TTGATGTTCATCAGGGATATTGG + Intronic
1112713379 13:102156224-102156246 TTGATGTTCATCAGGGATATTGG - Intronic
1113383442 13:109825499-109825521 TTGATGTTCATCAGGGATATTGG + Intergenic
1113528047 13:110997262-110997284 CTGATGTTCATCAGGGATATTGG - Intergenic
1114386287 14:22258786-22258808 TTGATGTTCATCAGGGATATTGG + Intergenic
1114677142 14:24449979-24450001 TTGATGTTCATCAGGGATATTGG + Intergenic
1114688777 14:24560818-24560840 TTGATGTTCATCAGGGATATTGG - Intergenic
1114763135 14:25339755-25339777 TTGATGTTCATCAGGGATATTGG + Intergenic
1114818010 14:25982901-25982923 TTGATGTTCATCAGGGATATTGG - Intergenic
1114844446 14:26304127-26304149 CTGTTGTTGTTGATGATTATAGG - Intergenic
1114845230 14:26312611-26312633 TTGATGTTCATCAGGGATATTGG - Intergenic
1114914825 14:27250083-27250105 CTGATGTTCATCAGGGATACTGG - Intergenic
1114964597 14:27941593-27941615 TTGATGTTCATCAGGGATATTGG - Intergenic
1115184268 14:30667119-30667141 TTGATGTTCATCAGGGATATTGG - Intronic
1115362618 14:32520904-32520926 TTGATGTTCATCAGGGATATTGG - Intronic
1115717414 14:36121611-36121633 CTGATGTTCATCAGGGATATTGG + Intergenic
1115728977 14:36247500-36247522 TTGATGTTCATCAGGGATATTGG - Intergenic
1115743810 14:36415408-36415430 TTGATGTTCATCAGGGATATTGG - Intergenic
1115927543 14:38452476-38452498 TTGATGTTCATCAGGGATATTGG - Intergenic
1115947100 14:38674586-38674608 TTGATGTTCATCAGGGATATTGG - Intergenic
1116033400 14:39599990-39600012 TTGATGTTCATCAGGGATATTGG - Intergenic
1116247369 14:42433176-42433198 TTGATGTTCATCAGGGATATTGG - Intergenic
1116312401 14:43342883-43342905 TCGATGTTCATCAGGAATATTGG + Intergenic
1116362922 14:44024790-44024812 TTGATGTTCATCAGGGATATTGG - Intergenic
1116571526 14:46523148-46523170 CCTATGTTCATGAGAAATATTGG - Intergenic
1116671626 14:47849628-47849650 TTGATGTTCATCAGGGATATTGG - Intergenic
1116681055 14:47970573-47970595 TTGATGTTCATCAGGGATATTGG + Intergenic
1116690528 14:48100486-48100508 TTGATGTTCATCAGGGATATTGG - Intergenic
1116711027 14:48368681-48368703 TTGATGTTCATCAGGGATATTGG + Intergenic
1116726916 14:48572656-48572678 TTGATGTTCATCAGGGATATTGG + Intergenic
1116730082 14:48610408-48610430 TTGATGTTCATCAGGGATATTGG - Intergenic
1116754599 14:48930741-48930763 TCTATGTTCATGAGGAATATTGG - Intergenic
1116766672 14:49080353-49080375 CTTATGTTCATCAGGGATATTGG + Intergenic
1116894167 14:50299537-50299559 ATAGTGTTCATCAGGAATATTGG - Intronic
1116985597 14:51216037-51216059 TTGATGTTCATCAGGGATATTGG + Intergenic
1117005338 14:51415580-51415602 TTGATGTTCATCAGGGATATTGG + Intergenic
1117081998 14:52161504-52161526 TTGATGTTCATCAGGGATATTGG - Intergenic
1117121477 14:52572311-52572333 TTGATGTTCATCAGGGATATTGG - Intronic
1117170385 14:53088384-53088406 TTGATGTTCATCAGGGATATTGG - Intronic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117614144 14:57515988-57516010 TTGATGTTCATCAGGGATATTGG + Intergenic
1117655801 14:57955006-57955028 TTGCTGTTCATCAGGGATATTGG - Intronic
1117688912 14:58285001-58285023 CTCCTGTTTAGGAGGAATATAGG - Intronic
1117822201 14:59661465-59661487 TTGATGTTCATCAGGGATATTGG - Intronic
1117822673 14:59667173-59667195 TTGATGTTCATCAGGGATATTGG - Intronic
1117887968 14:60385357-60385379 TTGATGTTCATCAGGGATATTGG - Intergenic
1117892968 14:60446763-60446785 TTGATGTTCATCAGGGATATTGG - Intronic
1117900307 14:60525678-60525700 TTGATATTCATCAGGAATATTGG + Intergenic
1117928339 14:60809783-60809805 TTTTTGTTCATCAGGGATATTGG + Intronic
1117952271 14:61094691-61094713 TTGATGTTCATCAGGGATATTGG + Intergenic
1118036067 14:61868084-61868106 TTCTTGTTCATGAAAAATATTGG + Intergenic
1118450437 14:65896047-65896069 TTGGTGTTCATCAGGGATATTGG - Intergenic
1118479329 14:66147827-66147849 TTGATGTTCATCAGGAATATTGG - Intergenic
1118483025 14:66186161-66186183 TTGATGTTCATCAGGGATATTGG + Intergenic
1118484781 14:66204169-66204191 TTGATGTTCATCAGGGATATTGG - Intergenic
1118498788 14:66336488-66336510 TTGATGTTCATCAGGGATATTGG - Intergenic
1118515745 14:66526902-66526924 CTGATGTTCATCAGGGATATTGG + Intronic
1118926620 14:70196414-70196436 CTGATGTTCATCAGGGATATTGG + Intergenic
1119016908 14:71067036-71067058 TTGATGTTCATCAGGTATATTGG + Intronic
1119079471 14:71678568-71678590 CTGATGTTCATCAGGGATATTGG + Intronic
1119146703 14:72322606-72322628 CTGATATTCATAAGCAATATTGG - Intronic
1119930238 14:78539041-78539063 TTGATGTTCATCAGGGATATTGG + Intronic
1120408348 14:84117460-84117482 TTGATGTTCATCAGGGATATTGG + Intergenic
1120478599 14:85020802-85020824 CTGATGTTCATCAGGGATATTGG + Intergenic
1120507373 14:85369357-85369379 TTGATGTTCATCAGGGATATTGG + Intergenic
1120559317 14:85971463-85971485 TTGATGTTCATCAGGGATATTGG + Intergenic
1120725101 14:87930040-87930062 TTGATGTTCATCAGGGATATTGG - Intronic
1122453646 14:101832920-101832942 CTGTTCTTCATTTGGAAAATGGG + Intronic
1122839920 14:104452811-104452833 TCATTGTTCATGAGGGATATTGG - Intergenic
1123140931 14:106077671-106077693 TTGATGTTCATCAGGGATATTGG + Intergenic
1123148799 14:106160901-106160923 TTGATGTTCATCAGGGATATTGG + Intergenic
1123576282 15:21672920-21672942 TTGATGTTCATCAGGGATATTGG + Intergenic
1123612905 15:22115388-22115410 TTGATGTTCATCAGGGATATTGG + Intergenic
1123810839 15:23924569-23924591 CTCTGTTTCATGAGGCATATTGG + Intergenic
1123884776 15:24715296-24715318 CTGATGTTCATCAGGAATATTGG + Intergenic
1124148488 15:27154760-27154782 CATATATTCATGAGGAATATTGG + Intronic
1124474326 15:30019261-30019283 TTGATGTTCATCAGGGATATTGG + Intergenic
1124586060 15:31008595-31008617 TCTATGTTCATGAGGAATATTGG + Intronic
1124599584 15:31121883-31121905 TTTATGTTCATGAGAAATATTGG - Intronic
1124894313 15:33761822-33761844 TCGATGTTCATCAGGAATATTGG - Intronic
1124987172 15:34631734-34631756 CTGATGTTCATCAGGGATATTGG - Intergenic
1125055463 15:35354708-35354730 TTGATGTTCATCAGGGATATTGG + Intronic
1125128890 15:36258271-36258293 TCGATGTTCATGAGGGATATTGG - Intergenic
1125210825 15:37213301-37213323 CTGAAGTTCATGAGGGATATTGG - Intergenic
1125331239 15:38584422-38584444 TTGATGTTCATCAGGGATATTGG - Intergenic
1125388118 15:39160064-39160086 CTGGTGGTCAGGAGGAACATTGG + Intergenic
1125985084 15:44042492-44042514 TTGATGTTCATCAGGGATATTGG - Intronic
1126239805 15:46428619-46428641 TTGATGTTCATCAGGGATATTGG - Intergenic
1126278120 15:46908935-46908957 CTGATGTTCATCAGGGATATTGG + Intergenic
1126336941 15:47595508-47595530 TTGATGTTCATCAGGGATATTGG + Intronic
1126554421 15:49969836-49969858 CTGATGTTCATCAGGGATATTGG - Intronic
1126715284 15:51509770-51509792 TTGATGTTCATCAGGGATATTGG - Intronic
1126854779 15:52827698-52827720 TTGATGTTCATCAGGGATATTGG - Intergenic
1126889284 15:53186777-53186799 TTGATGTTCATCAGGGATATTGG - Intergenic
1127014784 15:54672038-54672060 TTTTTGTTCATCAGGCATATTGG - Intergenic
1127021431 15:54752972-54752994 ATGATGTTCATCAGGAATATTGG - Intergenic
1127030362 15:54854768-54854790 CTGATGTTCATCAGGGACATTGG - Intergenic
1127056689 15:55139232-55139254 TTGATGTTCATCAGGGATATTGG - Intergenic
1127326598 15:57901673-57901695 TTGATGTTCATCAGGGATATTGG + Intergenic
1127330072 15:57930352-57930374 CCGATGTTCATCAGGGATATTGG + Intergenic
1127368902 15:58317523-58317545 CTGATGTTCATAAAGGATATTGG + Intronic
1127395092 15:58538046-58538068 CTCTAGGTCATAAGGAATATAGG - Intronic
1127657312 15:61067911-61067933 AGGTTGTTCTTGAGGAGTATTGG + Intronic
1128618869 15:69132148-69132170 CTGTTTTTCATGAAGAAGAAGGG - Intergenic
1128817426 15:70623115-70623137 TCTATGTTCATGAGGAATATTGG + Intergenic
1129012232 15:72430785-72430807 TTGATGTTCATCAGGGATATTGG + Intergenic
1129058672 15:72842223-72842245 TTTATATTCATGAGGAATATTGG + Intergenic
1129085630 15:73087431-73087453 TCTTTGTTCATGAGGAATATTGG + Intronic
1129548483 15:76423047-76423069 TTGATGTTCATCAGGGATATTGG + Intronic
1130177075 15:81584560-81584582 TTGATGTTCATCAGGGATATTGG - Intergenic
1130364799 15:83225201-83225223 TTGATGTTCATCAGGGATATTGG - Intergenic
1130400070 15:83543405-83543427 TTGATGTTCATGAGATATATTGG + Intronic
1130432683 15:83864327-83864349 TTGATGTTCATCAGGGATATTGG - Intronic
1130442257 15:83966745-83966767 TTGATGTTCATCAGGGATATTGG - Intronic
1130751884 15:86721213-86721235 TCGATGTTCATCAGGAATATTGG - Intronic
1130798091 15:87232196-87232218 ATGATGTTCATCAGGGATATTGG + Intergenic
1130891490 15:88137412-88137434 CTGATGTTCATGCGGAAGAGAGG + Exonic
1131591541 15:93754607-93754629 TTGCTGTTCATCAGGGATATTGG + Intergenic
1131862160 15:96665460-96665482 TTGATGTTCATCAGGGATATTGG - Intergenic
1131903060 15:97110074-97110096 TTGATGTTCATTAGGGATATTGG - Intergenic
1132134954 15:99326820-99326842 CTTATGTTCATGAGGGATATTGG + Intronic
1202985150 15_KI270727v1_random:407165-407187 TTGATGTTCATCAGGGATATTGG + Intergenic
1133082737 16:3336319-3336341 TTTATGTTCATCAGGAATATTGG + Intergenic
1133956591 16:10449238-10449260 TTGATGTTCATCAGGGATATTGG + Intronic
1134312586 16:13089228-13089250 TTGATGTTCATCAGGGATATTGG + Intronic
1135301444 16:21331450-21331472 TTGATGTTCATCAGGGATATTGG + Intergenic
1135838704 16:25853781-25853803 TTGATGTTCATTAGAAATATTGG + Intronic
1136600225 16:31281145-31281167 TTGATGTTCATCAGGGATATTGG + Intronic
1136681428 16:31966711-31966733 TTGATGTTCATCAGGGATATTGG - Intergenic
1136781737 16:32908222-32908244 TTGATGTTCATCAGGGATATTGG - Intergenic
1136888056 16:33945631-33945653 TTGATGTTCATCAGGGATATTGG + Intergenic
1137525439 16:49231787-49231809 TTGATGTTCATCAGGGATATTGG - Intergenic
1137808870 16:51333505-51333527 TTGATGTTCATCAGGGATATTGG - Intergenic
1137890633 16:52158205-52158227 TTGATGTTCATCAGGCATATTGG + Intergenic
1138102327 16:54262980-54263002 TTGATGTTCATGAGGGATATTGG + Intronic
1138145668 16:54608671-54608693 TTTTTGTTCATGAGGGATACTGG - Intergenic
1138702175 16:58875549-58875571 TTGATGTTCATCAGGGATATTGG + Intergenic
1138784756 16:59833125-59833147 TTGATGTTCATCAGGGATATTGG + Intergenic
1138883532 16:61046988-61047010 TTGATGTTCATCAAGAATATTGG + Intergenic
1138998809 16:62483709-62483731 TTTATGTTCATCAGGAATATTGG + Intergenic
1139004534 16:62554291-62554313 TTGTTGTTCATCAGGGATATTGG - Intergenic
1139024111 16:62792501-62792523 CTTATGTTCATCAGGAAAATTGG + Intergenic
1140569722 16:76089167-76089189 CCGATGTTCATCAGGGATATTGG + Intergenic
1140603879 16:76510681-76510703 CTGTATTTCATTATGAATATAGG + Intronic
1140839455 16:78825642-78825664 CTGTGGTTCATCATGAATAGGGG + Intronic
1140954904 16:79853968-79853990 TTGTTATTCATCAGGGATATTGG + Intergenic
1141060934 16:80869026-80869048 TTTATGTTCGTGAGGAATATTGG - Intergenic
1141234834 16:82206200-82206222 TTGATGTTCATCAGGGATATTGG + Intergenic
1203084393 16_KI270728v1_random:1172207-1172229 TTGATGTTCATCAGGGATATTGG - Intergenic
1142938654 17:3361843-3361865 TTGATGTTCATCAGGGATATTGG + Intergenic
1143431145 17:6885810-6885832 TTGATGTTCATCAGGGATATTGG + Intronic
1143579223 17:7815415-7815437 CTTTTCATCATGAGGAATATGGG - Intronic
1143915335 17:10287953-10287975 CTTATGTTCATCAGGGATATTGG + Intergenic
1144218486 17:13078967-13078989 CTGTTTTTCAAGAGGAAGAAAGG - Intergenic
1144231828 17:13214104-13214126 CACATGTTCATGAGAAATATTGG - Intergenic
1145103005 17:20092272-20092294 GTGGTGTTCATGAGGATTTTAGG + Intronic
1145292577 17:21560235-21560257 CCTATGTTCATGAGGAATATTGG - Intronic
1145387388 17:22425711-22425733 CCTATGTTCATGAGGATTATTGG + Intergenic
1145738667 17:27252910-27252932 TTGATGTTCATCAGGGATATTGG - Intergenic
1146103935 17:30013229-30013251 TTGATGTTCATCAGGGATATTGG + Intronic
1146368695 17:32250294-32250316 CCTATGTTCATGAGGGATATTGG + Intronic
1146436874 17:32858123-32858145 ATGTTGTGCATCTGGAATATTGG - Intronic
1146614220 17:34339717-34339739 TTTATGTTCATCAGGAATATTGG + Intergenic
1146760524 17:35473579-35473601 ATGATGTTCATCAGGGATATTGG + Intronic
1146825588 17:36019988-36020010 ATGATGTTCATCAGGGATATTGG + Intergenic
1148774340 17:50087233-50087255 CTGTTGTTCATCTGTAAAATGGG - Intronic
1148952914 17:51330168-51330190 TTGATGTTCATCAGGGATATTGG - Intergenic
1149255738 17:54824378-54824400 TTGATGTTCATCAGGGATATTGG - Intergenic
1149280880 17:55104553-55104575 TTGTCGTTCATCAGGGATATTGG + Intronic
1149359214 17:55875713-55875735 TTGATGTTCATCAGGGATATTGG + Intergenic
1149721439 17:58848700-58848722 TTGATGTTCATCAGGGATATTGG + Intronic
1150480897 17:65509312-65509334 TTCATGTTCATGAGAAATATTGG - Intergenic
1151108413 17:71646491-71646513 TTGATGTTCATCAGGAATATTGG - Intergenic
1151394063 17:73808920-73808942 TTGATGTTCATCAGGGATATTGG - Intergenic
1203162762 17_GL000205v2_random:66136-66158 TCGATGTTCATGAGGAATATTGG + Intergenic
1153090664 18:1338913-1338935 TTGATGTTCATCAGGGATATTGG - Intergenic
1153114938 18:1643610-1643632 TTGATGTTCATCAGGGATATTGG + Intergenic
1153644382 18:7181736-7181758 TTGATGTTCATCAGGGATATTGG - Intergenic
1153918784 18:9770116-9770138 TTGGTGTTCATCAGGGATATGGG + Intronic
1154320341 18:13345509-13345531 TTGATGTTCATCAGGGATATTGG + Intronic
1154414262 18:14166356-14166378 TTGATGTTCATCAGGGATATTGG - Intergenic
1154444660 18:14425363-14425385 TTGATGTTCATCAGGGATATTGG + Intergenic
1154459222 18:14562987-14563009 GTGGTGTTCATCAGGGATATTGG + Intergenic
1155101949 18:22619929-22619951 TTGATGTTCATCAGGGATATTGG - Intergenic
1155179055 18:23327768-23327790 TTGATGTTCATCAGGGATATTGG - Intronic
1155181038 18:23346947-23346969 CCTGTGTTCATGAGGAATATTGG + Intronic
1155427318 18:25720168-25720190 TTGATGTTCATCAGGGATATTGG - Intergenic
1155701476 18:28749486-28749508 CTGATGTTCATCAGGGATATTGG - Intergenic
1155723649 18:29051319-29051341 TTGATGTTCATCAGGGATATTGG + Intergenic
1155755654 18:29492243-29492265 CTGCTGTTCATCAAGAATTTGGG - Intergenic
1155893094 18:31290346-31290368 CTTATGTTCATCAGGGATATTGG + Intergenic
1156114642 18:33773226-33773248 TTGATGTTCATCAGGGATATTGG + Intergenic
1156166394 18:34426393-34426415 TTGATGTTCATCAGGGATATTGG + Intergenic
1156308446 18:35901188-35901210 TTGATGTTCATCAGGGATATTGG - Intergenic
1156380315 18:36553246-36553268 TTGATGTTCATCAGGGATATTGG + Intronic
1156433233 18:37098501-37098523 TTGATGTTCATGAGGTATATTGG + Intronic
1156626550 18:38916713-38916735 CTGATGTTCATCAAGGATATTGG + Intergenic
1156799248 18:41088842-41088864 TTGGTGTTCATCAGGAATATTGG - Intergenic
1157037061 18:43987743-43987765 TTGATGTTCATCAGGGATATTGG - Intergenic
1157071427 18:44413109-44413131 TTGATGTTCATCAGGGATATTGG - Intergenic
1157295660 18:46440830-46440852 TCTTTGTTCATGAGTAATATTGG + Intronic
1158023122 18:52867306-52867328 CCGATGTTCATCAGGGATATTGG + Intronic
1158025896 18:52897104-52897126 CTCTTGGTCATGGGGATTATAGG + Intronic
1158053988 18:53257637-53257659 CAGATGTTCATCAGGGATATTGG + Intronic
1158059136 18:53317407-53317429 TTGATGTTCATCAGGGATATCGG + Intronic
1158087345 18:53667738-53667760 CAAATGTTCATGAGGAATACTGG + Intergenic
1158105317 18:53879293-53879315 TTGATGTTCATCAGGGATATTGG + Intergenic
1159337528 18:67089295-67089317 TCGATGTTCATCAGGAATATTGG + Intergenic
1159349456 18:67252894-67252916 CTGATGTTCATCAGGGATATTGG + Intergenic
1159686040 18:71422113-71422135 TCAATGTTCATGAGGAATATTGG - Intergenic
1159902108 18:74056937-74056959 TTGATGTTCATCAGGGATATTGG - Intergenic
1159979045 18:74753780-74753802 TTGATGTTCATCAGGGATATTGG + Intronic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160068529 18:75602773-75602795 TTTATGTTCATGAGGAATATTGG - Intergenic
1160237138 18:77094688-77094710 CTGTTTGTCATGAGAAAAATTGG - Intronic
1160289816 18:77581458-77581480 TTGATGTTCATCAGGAATATTGG - Intergenic
1160296331 18:77640825-77640847 TTGATGTTCATCAGGGATATTGG - Intergenic
1160466401 18:79081046-79081068 TTGATGTTCATCAGGGATATTGG + Intronic
1162245980 19:9401349-9401371 TTGATGTTCATCAGGGATATTGG - Intergenic
1163075228 19:14884840-14884862 TTGATGTTCATCAGGGATATTGG - Intergenic
1163890384 19:20007495-20007517 CTGTGGTTGAAGAGGAAGATGGG + Intronic
1163940323 19:20486137-20486159 CTGATGTTCATCAGTGATATTGG - Intergenic
1163976242 19:20855758-20855780 TTGATGTTCATCAGGGATATTGG - Intronic
1163990208 19:20991911-20991933 TTGATGTTCATCAGGGATATTGG - Intergenic
1164152039 19:22562783-22562805 TTGATGTTCATCAGGGATATTGG + Intergenic
1164688339 19:30187085-30187107 TTGATGTTCATCAGGGATATTGG + Intergenic
1165234121 19:34406744-34406766 CAGTTATTCAGGAGGAATGTGGG - Intronic
1165600418 19:37051148-37051170 TCGATGTTCATCAGGAATATTGG + Intronic
1166632901 19:44423296-44423318 TTGATGTTCATCAGGGATATTGG + Intronic
1167973746 19:53206765-53206787 TAGATGTTCATGAGGGATATTGG + Intergenic
1168136983 19:54358768-54358790 CTGTTTCACATGAGGAATTTGGG + Intronic
1168161101 19:54510361-54510383 CTGTTTCACATGAGGAATTTGGG - Intronic
1168551210 19:57296675-57296697 TTTATGTTCATCAGGAATATTGG + Intergenic
925344854 2:3164072-3164094 TCTTTCTTCATGAGGAATATTGG - Intergenic
925516388 2:4687830-4687852 CTGTTTTTCATCATGATTATTGG + Intergenic
925630937 2:5892546-5892568 TTGATGTTCATCAGGGATATTGG + Intergenic
925637888 2:5959731-5959753 CTGGTGCTCATGAAAAATATTGG - Intergenic
926366264 2:12135873-12135895 TTGATGTTCATCAGGGATATTGG + Intergenic
926454208 2:13044027-13044049 TTGATGTTTATCAGGAATATTGG - Intergenic
926508922 2:13748862-13748884 CTGATGTTCACCAGGCATATTGG - Intergenic
926557739 2:14379229-14379251 TTGATGTTCATCAGGGATATTGG - Intergenic
926873499 2:17449283-17449305 TTGATGTTCATCAGGGATATTGG - Intergenic
926925734 2:17985544-17985566 TTGATGTTCATTAGGGATATTGG + Intronic
926928678 2:18014431-18014453 TTGATGTTCATTAGGGATATTGG + Intronic
927010989 2:18904059-18904081 CTGTTGTTCATCAGGAATTCGGG + Intergenic
927016234 2:18964981-18965003 TTGATGTTCATGAGGGATATTGG - Intergenic
927221554 2:20715094-20715116 CTGATGTTCATCAGCGATATTGG - Intronic
927350331 2:22105022-22105044 TTTATGTTCATGAGGAGTATTGG - Intergenic
927564423 2:24098846-24098868 TTGATGTTCATCAGGGATATTGG - Intronic
927610440 2:24533870-24533892 TCGTTGTTCATCAGGGATATTGG + Intronic
928083456 2:28329896-28329918 CTGATGTTCATCAGGAGTATTGG - Intronic
928464412 2:31508774-31508796 TTTATGTTCATGAGGGATATTGG - Intergenic
928464724 2:31513288-31513310 CTGTAGTTCATGTGGTTTATGGG - Intergenic
928470470 2:31570092-31570114 CTGATGTTCATCAGGGATATTGG - Intronic
928501177 2:31897644-31897666 CTGATATTCATCAGGGATATTGG + Intronic
928522386 2:32102897-32102919 TTGATGTTCATCAGGGATATTGG + Intronic
928616649 2:33046541-33046563 TTGATGTTCATCAGGGATATTGG + Intronic
928754587 2:34508954-34508976 TTGATGTTCATGAGGGATATTGG - Intergenic
928758644 2:34556069-34556091 CTGATGTTCATCAGGGATATTGG + Intergenic
928763018 2:34606701-34606723 CTATAGTTCTTGATGAATATGGG + Intergenic
928817933 2:35322182-35322204 TAGATGTTCATCAGGAATATTGG + Intergenic
928878032 2:36064231-36064253 TCGATGTTCATGAGGGATATTGG - Intergenic
928880748 2:36093498-36093520 TTGATGTTCATCAGGGATATTGG - Intergenic
928892162 2:36216704-36216726 TTGATGTTCATCAGGGATATTGG - Intergenic
929025412 2:37596594-37596616 TTGATGTTCATCAGGGATATTGG + Intergenic
929262190 2:39878117-39878139 TTGATGTTCATCAGGGATATTGG + Intergenic
929331205 2:40683261-40683283 CTGATGTTCATCAGGGATATTGG - Intergenic
929838215 2:45427678-45427700 TTGATGTTCATCAGGGATATTGG - Intronic
929838368 2:45429358-45429380 TCGATGTTCATCAGGAATATTGG - Intronic
929926969 2:46221330-46221352 TTGATGTTCATCAGGGATATTGG - Intergenic
930203808 2:48568744-48568766 CTGTTGTTCTTGAGCAACCTTGG + Intronic
930211128 2:48638290-48638312 GTGATGTTCAACAGGAATATTGG - Intronic
930544315 2:52747191-52747213 CTGACGTTCAGGAGGCATATTGG + Intergenic
930577101 2:53164438-53164460 TCGATGTTCATCAGGAATATTGG - Intergenic
930885444 2:56320854-56320876 TTGATGTTCATCAGGGATATTGG - Intronic
931204327 2:60132620-60132642 TTGATGTTCATCAGGGATATTGG + Intergenic
931887917 2:66637770-66637792 CTGATGTTCATCAAGGATATCGG - Intergenic
932013884 2:68004544-68004566 TTGATGTTCATCAGGGATATTGG - Intergenic
932051231 2:68400161-68400183 TTGATGTTCATCAGGAACATTGG + Intergenic
932080867 2:68713912-68713934 TTGATGTTCATCAGGGATATTGG + Intronic
932328323 2:70879612-70879634 TTGATGTTCATCAGGGATATTGG - Intergenic
932914227 2:75837686-75837708 TTGATGTTCATCAGGGATATTGG - Intergenic
933129832 2:78658527-78658549 TTGATGTTCATCAGGGATATTGG - Intergenic
933145075 2:78842028-78842050 CTGTTGCTCATGAGGAGAACTGG + Intergenic
933261225 2:80133926-80133948 CTGTTCCTCATTAGTAATATGGG + Intronic
933324562 2:80818849-80818871 TTGATGTTCATCAGGAATATTGG - Intergenic
933412848 2:81947607-81947629 CTGATGTTCATCAGGGATATTGG + Intergenic
933421055 2:82044920-82044942 TTTTTGTTCATCAGGGATATTGG - Intergenic
933435344 2:82242679-82242701 TTGATGTTCATCAGGGATATTGG - Intergenic
934570549 2:95369385-95369407 CCTGTGTTCATGAAGAATATTGG + Intronic
934698535 2:96419085-96419107 TAGATGTTCATCAGGAATATTGG + Intergenic
935450565 2:103204250-103204272 TTGATGTTCATCAGGGATATTGG - Intergenic
935526580 2:104177155-104177177 CTTCAGTTCATGAGGAATATTGG + Intergenic
935604398 2:104956030-104956052 TTGATGTTCATCAGGGATATCGG + Intergenic
935964336 2:108458341-108458363 TTGGTGTTCATCAGGGATATTGG + Intronic
935983253 2:108647528-108647550 TTGATGTTCATCAGGGATATTGG - Intronic
936142968 2:109956663-109956685 CCGATGTTCATCAGGGATATTGG - Intergenic
936179656 2:110254629-110254651 CCGATGTTCATCAGGGATATTGG - Intergenic
936201720 2:110414804-110414826 CCGATGTTCATCAGGGATATTGG + Intronic
936701351 2:115015065-115015087 TCGATGTTCATCAGGAATATTGG - Intronic
937186440 2:120048088-120048110 TTGATGTTCATCAGGGATATTGG + Intronic
937429128 2:121823923-121823945 AAGTTATTCATGAGAAATATAGG - Intergenic
937429253 2:121824756-121824778 AAGTTATTCATGAGAAATATAGG - Intergenic
937633218 2:124126623-124126645 TTGATGTTCATCAGGGATATTGG - Intronic
937741585 2:125361062-125361084 TCGATGTTCATCAGGAATATTGG - Intergenic
937762703 2:125625082-125625104 TTGATGTTCATCAGGGATATTGG - Intergenic
937825621 2:126365667-126365689 CTGTTGAGCATGAAGCATATTGG + Intergenic
937848803 2:126613694-126613716 TTAATGTTCATCAGGAATATTGG + Intergenic
937978323 2:127594900-127594922 TCGATGTTCATCAGGAATATTGG + Intronic
938085651 2:128399257-128399279 TTTATGTTCATAAGGAATATTGG + Intergenic
938145192 2:128828413-128828435 TTGATGTTCATCAGGGATATTGG - Intergenic
938166657 2:129035073-129035095 CAGTTTTTCATGAGGAACATTGG - Intergenic
938559109 2:132454908-132454930 TTGATGTTCATCAGGGATATTGG + Intronic
938651198 2:133385474-133385496 TTGATGTTCATCAGGGATATTGG + Intronic
939188655 2:138889663-138889685 TTGATGTTCATCAGGGATATTGG - Intergenic
939192568 2:138933042-138933064 TTGATGTTCATCAGGGATATTGG - Intergenic
939224595 2:139348856-139348878 CTGATGTTCATCAGGGATATTGG + Intergenic
939640502 2:144635087-144635109 TCGATGTTCATCAGGAATATTGG + Intergenic
939686920 2:145211737-145211759 TTGATGTTCATCAGGAATATAGG + Intergenic
939759167 2:146153037-146153059 TCGATGTTCATCAGGAATATTGG - Intergenic
939912721 2:148003326-148003348 TTGATGTTCATCAGGGATATTGG - Intronic
939937419 2:148310072-148310094 TTGATGTTCATCAGGGATATTGG + Intronic
939947321 2:148425600-148425622 CCGATGTTCATCAGGGATATTGG - Intronic
940016071 2:149106214-149106236 TCTATGTTCATGAGGAATATTGG + Intronic
940066908 2:149640301-149640323 TTGATGTTCATCAGGGATATTGG + Intergenic
940087631 2:149879018-149879040 TTGATGTTCATCAGGGATATTGG + Intergenic
940167816 2:150794136-150794158 TTGATGTTCATCAGGGATATTGG - Intergenic
940272985 2:151911602-151911624 CTGATGTTCATCAGGGATATTGG + Intronic
940411095 2:153363952-153363974 TTGATGTTCATCAGAAATATTGG - Intergenic
940564809 2:155347951-155347973 TTTTTGTTCATCAGGAATATAGG + Intergenic
940616128 2:156050800-156050822 TTGATGTTCATCAGGGATATTGG - Intergenic
940703106 2:157071313-157071335 TTGATGTTCATGCGGGATATTGG - Intergenic
940720430 2:157276248-157276270 TTGATGTTCATCAGGGATATTGG + Intronic
940730978 2:157391121-157391143 TTGATGTTCATCAGGGATATTGG + Intergenic
940745466 2:157562685-157562707 TTGATGTTCATCAGGGATATTGG - Intronic
940821730 2:158363378-158363400 CTGATTTTCATCAGGGATATTGG - Intronic
941041120 2:160625007-160625029 TTGATGTTCATCAGGAATATTGG + Intergenic
941276938 2:163501385-163501407 TTGATGTTCATCAGGGATATTGG - Intergenic
941681952 2:168409460-168409482 TTGATGTTCATCAGGGATATTGG + Intergenic
942362815 2:175190442-175190464 TTGATGTTCATCAGGGATATTGG - Intergenic
942372162 2:175296573-175296595 TTGATGTTCATCAGGGATATTGG - Intergenic
942411394 2:175712828-175712850 TTGATGTTCATCAGGGATATTGG - Intergenic
942581766 2:177426794-177426816 TTGATGTTCATCAGGGATATTGG + Intronic
942669215 2:178355801-178355823 CTGATGTTCATCAGGGATATTGG - Intronic
942875028 2:180784837-180784859 TTGATGTTCATCAGGGATATTGG + Intergenic
942924416 2:181414858-181414880 TTGATGTTCATCAGGGATATTGG - Intergenic
942927487 2:181451161-181451183 TTGATGTTCATCAGGGATATTGG + Intergenic
943074372 2:183176788-183176810 TTGATGTTCATCAGGGATATTGG + Intergenic
943095209 2:183420150-183420172 ATGATGTTCATCAGGGATATTGG - Intergenic
943140372 2:183974909-183974931 TTGATGTTCATCAGGGATATTGG + Intergenic
943286865 2:186012489-186012511 TTGATGTTCATCAGGGATATTGG - Intergenic
943305123 2:186252093-186252115 TTGATGTTCATCAGGAATATTGG + Intergenic
943352815 2:186815535-186815557 CAATTGTTCATCAGGGATATTGG - Intergenic
943443516 2:187953397-187953419 TTGATGTTCATCAGGGATATTGG - Intergenic
943654588 2:190494563-190494585 TTGATGTTCATCAGGGATATTGG - Intronic
943876905 2:193078528-193078550 CTCTTTTTCATGATGAATTTTGG - Intergenic
943996413 2:194771763-194771785 ATCTTGTTCATCAGGGATATTGG + Intergenic
944347746 2:198688487-198688509 TCGATGTTCATCAGGAATATTGG - Intergenic
944375076 2:199032153-199032175 TTGATGTTCATCAGGGATATTGG - Intergenic
944393264 2:199242017-199242039 TTGATGTTCATCAGGGATATTGG + Intergenic
944919184 2:204393507-204393529 CTTATGTTCATCATGAATATTGG + Intergenic
945343231 2:208682779-208682801 TTGATGTTCATCAGGGATATTGG + Intronic
945349521 2:208760831-208760853 TTGATGTTCATCAGGGATATTGG + Intronic
945349784 2:208763828-208763850 TTGATGTTCATCAGGGATATTGG - Intronic
945409528 2:209492009-209492031 TTGATGTTCATCAGGGATATTGG - Intronic
945524348 2:210869653-210869675 TCGATGTTCATCAGGAATATTGG - Intergenic
945533167 2:210981219-210981241 TTGATGTTCATTAGGGATATTGG + Intergenic
945615275 2:212058504-212058526 TTGATGTTCATCAGGGATATTGG - Intronic
945667063 2:212756484-212756506 TTGATGTTCATCAGGGATATTGG - Intergenic
945873857 2:215256671-215256693 TTGATGTTCATCAGGGATATTGG - Intergenic
945998277 2:216458396-216458418 TTGATGTTCATCAGGGATATTGG - Intronic
946064962 2:216979147-216979169 TTGATGTTCATCAGGGATATTGG + Intergenic
946513368 2:220384644-220384666 TTGATGTTCATCAGGGATATTGG + Intergenic
946553426 2:220828256-220828278 TTGATGTTCATGAGGGATATTGG - Intergenic
947068136 2:226253787-226253809 TTGATGTTCGTCAGGAATATTGG - Intergenic
947124591 2:226854204-226854226 GAGTTGTTGATGAGTAATATAGG - Intronic
947449301 2:230191849-230191871 TTGATGTTCATCAGGGATATTGG - Intronic
947483905 2:230529141-230529163 TTGATGTTCATCAGGGATATTGG - Intronic
947515767 2:230802969-230802991 TTGATGTTCATCAGGGATATTGG - Intronic
947600547 2:231446082-231446104 TTATGTTTCATGAGGAATATTGG + Intergenic
1169319633 20:4621417-4621439 TTGATGTTCATCAGGGATATTGG + Intergenic
1169420993 20:5459853-5459875 TCGATGTTCATCAGGAATATTGG + Intergenic
1169428517 20:5514698-5514720 TCGATGTTCATGAGGGATATTGG - Intergenic
1169940403 20:10931043-10931065 TAGATGTTCATCAGGAATATTGG - Intergenic
1169972255 20:11280568-11280590 CTGTTTTTCTTTAGGAACATTGG + Intergenic
1169984079 20:11422718-11422740 TTGATGTTCATCAGGGATATTGG + Intergenic
1170265326 20:14460847-14460869 TTGATGTTCATCAGGGATATTGG + Intronic
1170483303 20:16790254-16790276 TTGATGTTCATCAGGGATATTGG + Intergenic
1170496928 20:16934336-16934358 TTGATGTTCATCAGGGATATTGG - Intergenic
1171311136 20:24145458-24145480 TTATTGATCATGATGAATATAGG + Intergenic
1171441759 20:25169648-25169670 TTGATGTTCATCAGGGATATTGG - Intergenic
1171513050 20:25703119-25703141 CTGATGTTAATCAGGGATATTGG + Intergenic
1171513809 20:25710917-25710939 TTGGTGTTCATCAGGGATATTGG + Intergenic
1172455961 20:35073699-35073721 TTGATGTTCATCAGGGATATTGG + Intronic
1172829133 20:37817597-37817619 CTGTTATAGATGAGGAATCTGGG - Intronic
1172966960 20:38842912-38842934 TTGCTGTTCAGGGGGAATATGGG - Intronic
1173296492 20:41763710-41763732 TTGATGTTCATAAGGGATATTGG + Intergenic
1173378248 20:42510341-42510363 CTATTATTCAAGAAGAATATAGG - Intronic
1174968453 20:55246667-55246689 CTGATGTTCATGATGGATATCGG - Intergenic
1175591672 20:60197835-60197857 TTGATGTTCATCAGGGATATTGG + Intergenic
1176344124 21:5725482-5725504 TCGATGTTCATGAGGGATATTGG + Intergenic
1176350938 21:5846066-5846088 TCGATGTTCATGAGGGATATTGG + Intergenic
1176451323 21:6864500-6864522 CTGATGTTCATCAGGGATATTGG - Intergenic
1176500703 21:7598974-7598996 TCGATGTTCATGAGGGATATTGG - Intergenic
1176538445 21:8123551-8123573 TCGATGTTCATGAGGGATATTGG + Intergenic
1176642018 21:9314333-9314355 TTGATGTTCATCAGGCATATTGG - Intergenic
1176744007 21:10634780-10634802 ATGATGTTCATCAGGGATATTGG - Intergenic
1176814918 21:13590358-13590380 CTGATGTTCATCAGGGATATTGG - Intergenic
1176829492 21:13729551-13729573 CTGATGTTCATCAGGGATATTGG - Intergenic
1176858769 21:13991892-13991914 TTGATGTTCATCAGGGATATTGG + Intergenic
1176930460 21:14803791-14803813 TTGATGTTCATCAGGGATATTGG - Intergenic
1177130005 21:17244173-17244195 TTGATGTTCATCAGGGATATTGG - Intergenic
1177136762 21:17312621-17312643 TTGATGTTCATCAGGAATATTGG - Intergenic
1177463549 21:21444260-21444282 CCGATGTTCATCAGGGATATTGG + Intronic
1177494364 21:21870319-21870341 TCAGTGTTCATGAGGAATATTGG + Intergenic
1177556337 21:22693901-22693923 TTGATGTTCATCAGGGATATTGG + Intergenic
1177878588 21:26665970-26665992 TTGATGTTCATCAGGGATATTGG + Intergenic
1177956247 21:27602838-27602860 TTGATGTTCATCAGGGATATAGG + Intergenic
1177964245 21:27707159-27707181 TTGATGTTCATCAGGGATATAGG + Intergenic
1178026166 21:28470451-28470473 GTCTTGTTCATCAGGAATATTGG - Intergenic
1178057186 21:28812565-28812587 TTGATGTTCATCAGGGATATTGG + Intergenic
1178372912 21:32042020-32042042 TTGATGTTCATTAGGGATATTGG - Intronic
1178394006 21:32223842-32223864 TTGATGTTCATCAGGGATATTGG - Intergenic
1179056709 21:37943198-37943220 TGTTTGTTCATGAGGGATATTGG + Intergenic
1179388250 21:40962271-40962293 CTGTTGTTCATGTGTCAGATTGG - Intergenic
1180047335 21:45314468-45314490 TTGGTGTTCATCAGGGATATTGG + Intergenic
1180351029 22:11803687-11803709 TTGATGTTCATCAGGGATATTGG - Intergenic
1180387172 22:12188388-12188410 TTGATGTTCATCAGGGATATTGG + Intergenic
1180570304 22:16710288-16710310 TTGATGTTCATCAGCAATATTGG - Intergenic
1180578344 22:16803271-16803293 CTGTGGTTCATAAAGGATATTGG - Intronic
1180596573 22:16978745-16978767 TTGATGTTCATCAGGGATATTGG - Intronic
1180598742 22:16999067-16999089 TTGATGTTCATCAGGGATATTGG + Intronic
1180599258 22:17004392-17004414 TTGATGTTCATTAGGGATATTGG - Intronic
1180640612 22:17295724-17295746 TTGATGTTCATCAGGGATATTGG + Intergenic
1180724333 22:17934171-17934193 TTGATGTTCATCAGGGATATTGG - Intronic
1180724917 22:17939592-17939614 CTGTTCTTCATAAGGTATAGAGG - Intronic
1182040285 22:27233165-27233187 TTGATGTTCATCAGGGATATTGG + Intergenic
1182152623 22:28040301-28040323 CTGATGTTCATCAGGGATATTGG - Intronic
1182814782 22:33151855-33151877 ATCTAGTTCATGAGGAATATTGG + Intergenic
1182870650 22:33644125-33644147 TTGATGTTCATCAGGGATATTGG - Intronic
1183039837 22:35169368-35169390 TTGATGTTCATCAGGGATATTGG - Intergenic
1183901511 22:41009504-41009526 CTGCTGTAAATGAGGAACATTGG - Intergenic
1184625609 22:45726079-45726101 CTGATGTTCATCAGGGATATTGG + Intronic
1184809378 22:46819664-46819686 TTGATGTTCATCAGGGATATTGG + Intronic
949427813 3:3938291-3938313 CTGATGTTCCTCAGGGATATTGG + Intronic
949440499 3:4075059-4075081 TTGATGTTCATCAGGGATATTGG - Intronic
949795925 3:7851025-7851047 CTGTTATTCAGTAGGAATTTTGG - Intergenic
949800172 3:7895240-7895262 TTGATGTTCATCAGGGATATTGG + Intergenic
950299549 3:11864410-11864432 ATGATGTTCATCAGGAATATTGG + Intergenic
950302644 3:11894688-11894710 TTGATGTTCATCAGGGATATTGG + Intergenic
950815495 3:15697678-15697700 TTGATGTTCATCAGGGATATTGG + Intronic
950842941 3:15985549-15985571 TCTTTGTTCATCAGGAATATTGG + Intergenic
951191589 3:19778451-19778473 ATGATGTTCATCAGGGATATTGG - Intergenic
951241547 3:20291627-20291649 TTTGTGTTCATCAGGAATATTGG + Intergenic
951254142 3:20429547-20429569 TTGTTGTTCATCAGGGACATTGG + Intergenic
951286288 3:20817829-20817851 TTGATGTTCATCAGGGATATTGG + Intergenic
951311244 3:21128592-21128614 TTGATGTTCATCAGGGATATTGG - Intergenic
951389538 3:22085768-22085790 TTGATGTTCATCAGGAATATTGG - Intronic
951471273 3:23059043-23059065 TTGATGTTCATCAGGGATATTGG + Intergenic
951628769 3:24695845-24695867 TTGATGTTCATCAGGGATATTGG + Intergenic
951687264 3:25358906-25358928 TTGATGTTCATCAGGGATATTGG + Intronic
951740664 3:25919294-25919316 CCTATGTTCATCAGGAATATTGG + Intergenic
951742040 3:25935206-25935228 TCGATGTTCATCAGGAATATTGG - Intergenic
951776796 3:26319360-26319382 CTGATGTTCATCAGGGATATTGG + Intergenic
951972043 3:28456898-28456920 CTGATGTTCATCAAGGATATTGG + Intronic
951980022 3:28555373-28555395 CTGATGTTCATCAAGGATATTGG + Intergenic
952098277 3:29981854-29981876 TTGATGTTCATCAGGGATATTGG + Intronic
952103399 3:30041178-30041200 TTGATGTTCATTAGGAATATTGG - Intergenic
952133213 3:30388109-30388131 CCGATGTTCATCAGGGATATTGG + Intergenic
952290868 3:32014159-32014181 TTGTTATTCATCAGGGATATTGG - Intronic
952291935 3:32025434-32025456 CCTATGTTCATGAGGAATATTGG + Intronic
952575244 3:34766785-34766807 TCGATGTTCATCAGGAATATTGG - Intergenic
953254986 3:41281365-41281387 TTGATGTTCATCAGGGATATTGG - Intronic
953815574 3:46153546-46153568 CTGTGGGTCATGAGGAACAGGGG + Intergenic
954491106 3:50906190-50906212 TCGATGTTCATCAGGAATATTGG + Intronic
954536777 3:51365914-51365936 TTGATGTTCATCAGGGATATTGG + Intronic
954769740 3:52955919-52955941 TTGATGTTCATCAGGAATATTGG - Intronic
954836173 3:53470394-53470416 TTGATGTTCATCAGGGATATTGG + Intergenic
955477813 3:59357218-59357240 TTGATGTTCATCAGGGATATCGG + Intergenic
955635351 3:61022558-61022580 TTGATGTTCATCAGGGATATTGG - Intronic
956038759 3:65123763-65123785 TTGATGTTCATCAGGGATATTGG - Intergenic
956157573 3:66314543-66314565 TTGATGTTCATCAGGGATATTGG + Intronic
956207069 3:66766086-66766108 CTGATGTTCATCGGGGATATTGG + Intergenic
956222304 3:66917462-66917484 TTGATGTTCATCAGGGATATTGG - Intergenic
956317220 3:67951505-67951527 TTGATGTTCATCAGGGATATTGG - Intergenic
956569491 3:70678099-70678121 TTGATGTTCATCAGGGATATTGG + Intergenic
956570496 3:70689233-70689255 TTGATGTTCATCAGGGATATTGG - Intergenic
956763352 3:72462942-72462964 CTGTTATTTATGTGGAAGATTGG + Intergenic
957092749 3:75748403-75748425 TTGATGTTCATCAGGGATATTGG - Intronic
957098106 3:75796319-75796341 TTGATGTTCATCAGGGATATTGG + Intergenic
957147724 3:76445603-76445625 TTGATGTTCATCAGGGATATTGG - Intronic
957306471 3:78464329-78464351 TTGCTGTTCATCAGGGATATTGG + Intergenic
957433797 3:80148762-80148784 TTGATGTTCATCAGGGATATTGG + Intergenic
957454036 3:80418010-80418032 TTGATGTTCATCAGGGATATTGG + Intergenic
957565741 3:81881828-81881850 TTGATGTTCATCAGGAATATTGG - Intergenic
957589414 3:82175948-82175970 TTGTTGTGCATGAGAAATGTTGG + Intergenic
957626676 3:82661388-82661410 TTGATGTTCATCAGGGATATTGG + Intergenic
957700416 3:83702932-83702954 TTGATGTTCATCAGGGATATTGG - Intergenic
957776848 3:84764734-84764756 TTGATGTTCATCAGGGATATTGG - Intergenic
957786437 3:84888696-84888718 CTGATGTTCATCAGGGATATTGG - Intergenic
957872180 3:86103404-86103426 TTGATGTTCATCAGGGATATTGG + Intergenic
957906036 3:86557108-86557130 GTTATGTTCATGAGGAACATTGG - Intergenic
957908216 3:86584697-86584719 TCGATGTTCATCAGGAATATTGG - Intergenic
957973084 3:87407687-87407709 CTGATGTTCATAAAGGATATTGG - Intergenic
958015829 3:87939300-87939322 TTGATGTTCATCAGGGATATTGG + Intergenic
958046904 3:88296042-88296064 TTGGTGTTCATCAGGGATATTGG + Intergenic
958106111 3:89075651-89075673 CCGATGTTCATTAGGGATATTGG - Intergenic
958434186 3:94077364-94077386 TTGATGTTCATCAGGGATATTGG + Intronic
958607209 3:96374445-96374467 ATGATGTTCATCAGGGATATCGG + Intergenic
958624200 3:96603764-96603786 TTGATGTTCATCAGGGATATTGG + Intergenic
958694230 3:97507590-97507612 TTGATGTTCATCAGGGATATTGG + Intronic
958812036 3:98871701-98871723 CCTATGTTCATTAGGAATATTGG + Intronic
958861812 3:99453739-99453761 TTGATGTTCATCAGGGATATTGG - Intergenic
959091479 3:101907844-101907866 CTGATGTTCATCAGGGATATTGG + Intergenic
959307957 3:104693372-104693394 TTGATGTTCATCAGGGATATTGG + Intergenic
959339515 3:105111365-105111387 TTGATATTCATCAGGAATATTGG - Intergenic
959373771 3:105562562-105562584 TCTATGTTCATGAGGAATATTGG + Intronic
959724158 3:109525051-109525073 TCGATGTTCATCAGGAATATGGG - Intergenic
959736800 3:109668505-109668527 TTGATGTTCATCAGGGATATTGG - Intergenic
959843219 3:111002311-111002333 TTGATGTTCATCAGGGATATTGG - Intergenic
959922035 3:111878979-111879001 TTGATGTTCATTAGGGATATTGG + Intronic
959954052 3:112214923-112214945 TCGATGTTCATCAGGAATATTGG - Intronic
960221502 3:115115651-115115673 CTGTTCTTCAAGAGCAATAATGG - Intronic
960233803 3:115258359-115258381 TTGATGTTCATCAGGGATATTGG - Intergenic
960276888 3:115738801-115738823 TTGATGTTCATCAGGGATATTGG + Intergenic
960277911 3:115748095-115748117 TCGTTGTTCATCAGGGATATTGG - Intergenic
960731726 3:120734971-120734993 TTGATGTTCATCAGGGATATTGG + Intronic
960734254 3:120760852-120760874 TCGATGTTCATCAGGAATATTGG + Intronic
960768997 3:121170905-121170927 TTGATGTTCATCAGGGATATTGG - Intronic
960771700 3:121199910-121199932 TTGATGTTCATCAGGGATATTGG + Intronic
960772817 3:121213639-121213661 TTGATGTTCATCAGGGATATTGG + Intronic
960866800 3:122209804-122209826 TTGATGTTCATCAGGGATATTGG - Intronic
961286288 3:125807209-125807231 TTTGTGTTCATTAGGAATATTGG + Intergenic
961395779 3:126588406-126588428 TTGATGTTCATCAGGGATATTGG + Intronic
961895356 3:130162867-130162889 TTGATGTTCATCAGGGATATTGG + Intergenic
961992739 3:131209404-131209426 TTGATGTTCATCAGGAATATTGG + Intronic
962064718 3:131966937-131966959 TTGTTGTTCATCAGGGATATTGG - Intronic
962604292 3:137019619-137019641 CTGATGTTCATCAGGGGTATTGG + Intergenic
962666382 3:137657902-137657924 TTGATGTTCATCAGGGATATTGG - Intergenic
962690038 3:137886504-137886526 GTGATGTTCATCAGGGATATTGG - Intergenic
962699546 3:137983542-137983564 ATGATGTTCATCAGGGATATTGG - Intergenic
962861633 3:139408297-139408319 TTGATGTTCATCAGGGATATTGG - Intergenic
963282063 3:143394166-143394188 TTGATGTTCATCAGGGATATTGG - Intronic
963455727 3:145544151-145544173 CAGTTGTTCATCAGGGATATTGG + Intergenic
963527897 3:146437203-146437225 CTGATGTTCATCAGGGATATTGG + Intronic
963620148 3:147596257-147596279 TTGATGTTCATCAGGGATATTGG + Intergenic
964100595 3:152983934-152983956 TTGATGTTCATCAGGGATATTGG - Intergenic
964245491 3:154647893-154647915 TTGATGTTCATCAGGGATATTGG - Intergenic
964377685 3:156065631-156065653 TTGATGTTCATCAGGGATATTGG + Intronic
964390924 3:156197229-156197251 TTGATGTTCATCAGGGATATTGG + Intronic
964464029 3:156969836-156969858 TTGATGTTCATCAGGGATATTGG - Intronic
964543042 3:157800947-157800969 TTGATGTTCATCAGGGATATTGG + Intergenic
964561537 3:158002116-158002138 TTGATGTTCATCAGGGATATTGG + Intergenic
964966712 3:162503220-162503242 CTGGTGTTCATCAGGAATATTGG - Intergenic
965019336 3:163207437-163207459 CTTTTGTTCATGACAAATCTAGG - Intergenic
965027396 3:163319542-163319564 TTGATGTTCATCAGGGATATTGG + Intergenic
965050502 3:163641232-163641254 TTGATGTTCATCAGGGATATTGG - Intergenic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
965271399 3:166621134-166621156 CTGGTGTTCATCAGGGATATTGG - Intergenic
965278401 3:166717633-166717655 TTGATGTTCATCAGGGATATGGG - Intergenic
965295292 3:166937670-166937692 TTGATGTTCATTAGGGATATTGG + Intergenic
965318097 3:167215693-167215715 TCGATGTTCATGAAGAATATTGG - Intergenic
965445278 3:168766879-168766901 TTGATGTTCATCAGGGATATTGG + Intergenic
965511287 3:169570553-169570575 TTGATGTTCATCAGGGATATTGG - Intronic
965652655 3:170949525-170949547 TTTGTGTTCATGAGGGATATTGG + Intergenic
966231943 3:177661790-177661812 CTGATGTTCATCAAGGATATTGG + Intergenic
966255474 3:177912172-177912194 TTGATGTTCATCAGGGATATTGG - Intergenic
966487581 3:180488399-180488421 TTGATGTTCATCAGGGATATTGG - Intergenic
966637575 3:182153123-182153145 TCGTTGTTCATCAGGGATATTGG + Intergenic
966753542 3:183346134-183346156 TTGATGTTCATTAGGGATATTGG - Intronic
967181146 3:186905939-186905961 TGGATGTTCATCAGGAATATTGG + Intergenic
967343316 3:188425373-188425395 ATGATGTTCATCAGGGATATTGG + Intronic
967637741 3:191823881-191823903 CTGATGTTCATCAAGGATATTGG - Intergenic
967715947 3:192761777-192761799 TTGATGATCATGAGGGATATTGG - Intronic
968217901 3:196909474-196909496 CCGATGTTCATCAGGGATATTGG - Intronic
1202744876 3_GL000221v1_random:90685-90707 TTGATGTTCATCAGGGATATTGG + Intergenic
968388525 4:168277-168299 TTGATGTTCATCAGGGATATTGG + Intergenic
968828704 4:2919259-2919281 TTGATGTTCATCAGGGATATTGG + Intronic
969123553 4:4928310-4928332 ATGATGTTCATCAGGGATATTGG - Intergenic
969807524 4:9621615-9621637 TTGATGTTCATCAGGGATATTGG - Intergenic
969952303 4:10850560-10850582 TTGATGTTCATCAGGGATATTGG + Intergenic
970181470 4:13400992-13401014 TTTATGTTCATGAGGAATATTGG + Intronic
970182045 4:13408439-13408461 CTGATGGTCATCAGGGATATTGG + Intronic
970336336 4:15048159-15048181 TTTGTGTTCATGAGGGATATTGG + Intronic
970496581 4:16632147-16632169 TTGATGTTCATCAGGGATATTGG - Intronic
970552803 4:17200034-17200056 GTTATGTTCATGAGGGATATTGG + Intergenic
970862359 4:20718759-20718781 TTGATGTTCATCAGGGATATTGG + Intronic
970917797 4:21355866-21355888 TCGATGTTCATGAGGGATATTGG - Intronic
971096141 4:23405902-23405924 CCTATGTTCATTAGGAATATTGG + Intergenic
971186801 4:24385956-24385978 CTGATGTTCATCAGGGGTATTGG - Intergenic
971285695 4:25287538-25287560 TTGATGTTCATCAGGAATATTGG + Intergenic
971429718 4:26552961-26552983 TCGATGTTCATGAGGAATATTGG + Intergenic
971433328 4:26592052-26592074 TTGATGTTCATCAGGGATATTGG - Intronic
971492756 4:27231307-27231329 TCGATGTTCATCAGGAATATTGG + Intergenic
971706214 4:30046946-30046968 TTGATGTTCATCAGGAGTATTGG - Intergenic
971801079 4:31291868-31291890 TTTTTGTTCATCAGTAATATTGG + Intergenic
971853389 4:32012434-32012456 TTGATGTTCATCAGGGATATTGG - Intergenic
972014708 4:34228707-34228729 ATCATGTTCATCAGGAATATTGG + Intergenic
972178455 4:36436525-36436547 TTGATGTTCATCAGGGATATTGG + Intergenic
972196502 4:36659744-36659766 TTGATGTTCATCAGGGATATTGG - Intergenic
972208322 4:36804925-36804947 TTGATGTTCATCAGGAATATTGG + Intergenic
972219651 4:36939326-36939348 TTGATGTTCATCAGGGATATTGG - Intergenic
972372121 4:38434624-38434646 TTGATGTTCATGAGGGATATTGG + Intergenic
972373132 4:38445218-38445240 TTGATGTTCATCAGGGATATTGG + Intergenic
972376862 4:38480168-38480190 TTGATGTTCATCAGGGATATTGG - Intergenic
972837085 4:42884865-42884887 CCTATGTTCATCAGGAATATTGG + Intergenic
972859643 4:43151730-43151752 TTGATGTTCATCAGGGATATTGG - Intergenic
972895829 4:43619186-43619208 GTGTTGTTCATCAGGAATACTGG - Intergenic
972917036 4:43893925-43893947 TTGATGTTCATCAGGGATATTGG + Intergenic
973050371 4:45588161-45588183 TTGATGTTCATCAGGGATATTGG - Intergenic
973149364 4:46867798-46867820 TTGATGTTCATCAAGAATATTGG + Intronic
973288419 4:48445325-48445347 TCGATGTTCATGAGGAATATTGG - Intergenic
973548759 4:52009904-52009926 CCTATGTTCATGAGGAATATTGG - Intronic
973746785 4:53971230-53971252 TTGATGTTCATCAGGGATATTGG - Intronic
973858876 4:55041230-55041252 TTTATGTTCATGAGCAATATTGG - Intergenic
973957255 4:56075113-56075135 TTGATGTTCATCAGGGATATTGG + Intergenic
974024002 4:56716327-56716349 TTGATGTTCATCAGGGATATTGG - Intergenic
974105922 4:57469826-57469848 TTGATGTTCATCAGGGATATTGG + Intergenic
974177300 4:58340788-58340810 TTGATGTTCATCAGGGATATTGG - Intergenic
974222287 4:58991109-58991131 TTGATGTTCATCAAGAATATTGG - Intergenic
974254443 4:59430937-59430959 TTGATGTTCATCAGGGATATTGG - Intergenic
974307587 4:60160890-60160912 TTGATGTTCATCAGGGATATTGG - Intergenic
974504156 4:62746567-62746589 TTGGTGTTCATCAGGGATATTGG - Intergenic
974600518 4:64073843-64073865 TTGATGTTCATCAGGCATATTGG - Intergenic
974622700 4:64381819-64381841 TCTTTGTTCATCAGGAATATTGG + Intronic
974760700 4:66269944-66269966 TTGATGTTCATCAGGGATATTGG - Intergenic
974885614 4:67813381-67813403 CTGATGTTCATCAGGAATATTGG - Intergenic
974959494 4:68679928-68679950 TTGATGTTCATCAGGGATATTGG + Intergenic
975036999 4:69696526-69696548 TTGATGTTCATCAGGGATATTGG + Intergenic
975227853 4:71895189-71895211 TCGATGTTCATCAGGAATATTGG - Intergenic
975236202 4:71999758-71999780 CTGATGTTCATCAGGGATATTGG - Intergenic
975295917 4:72734270-72734292 CTGATGTTCATCAGGGATATTGG - Intergenic
975301895 4:72799880-72799902 TTGATGTTCATCAGGGATATTGG - Intergenic
975750781 4:77521144-77521166 CGGGTGTTCATCAGGGATATTGG + Intronic
975765026 4:77658414-77658436 TTGATGTTCATCAGGGATATTGG - Intergenic
976024629 4:80672431-80672453 TTGATGTTCATCAGGGATATTGG + Intronic
976156901 4:82155674-82155696 ATGATGTTCATCAGGGATATTGG - Intergenic
976395794 4:84554135-84554157 TTGATGTTCATCAAGAATATTGG - Intergenic
976532098 4:86167432-86167454 TCGATGTTCATCAGGAATATTGG - Intronic
976580203 4:86727240-86727262 TTGATGTTCATCAGGGATATTGG + Intronic
976760390 4:88542651-88542673 TTGATGTTCATCAGCAATATTGG - Intronic
976769769 4:88638306-88638328 CTGATGTTCATCAAGGATATTGG - Intronic
976809577 4:89086534-89086556 CTGATGTACATCAGGGATATTGG + Intronic
976837585 4:89392911-89392933 TTGATGTTCATCAGGGATATTGG - Intergenic
976968993 4:91081122-91081144 TCGATGTTCATGAGGGATATTGG - Intronic
976974577 4:91150897-91150919 TTGATGTTCATCAGGGATATTGG + Intronic
976976957 4:91177246-91177268 TTGATGTTCATCAGGGATATTGG + Intronic
976994682 4:91415836-91415858 TTGATGTTCATCAGGGATATTGG + Intronic
977002698 4:91523301-91523323 TTGATGTTCATCAGGGATATTGG + Intronic
977057565 4:92212813-92212835 TTGATGTTCATCAGGTATATTGG - Intergenic
977108359 4:92918778-92918800 TTGATGTTCATGAGGGATATTGG + Intronic
977109973 4:92940995-92941017 TTGATGTTCATGAGGGATATTGG + Intronic
977425890 4:96866571-96866593 TTGATGTTCATCAGGGATATTGG - Intergenic
977457064 4:97274863-97274885 TTGATGTTCATCAGGGATATTGG - Intronic
977468943 4:97417980-97418002 TTGCTGTTCATCAGGGATATAGG - Intronic
977496507 4:97781646-97781668 TTGATGTTCATCAGGGATATTGG - Intronic
977497593 4:97797615-97797637 TTGATGTTCATCAGGGATATTGG + Intronic
977511520 4:97968500-97968522 TTGATGTTCATCAGGGATATTGG - Intronic
977629444 4:99225508-99225530 TTGATGTTCATCAGGGATATTGG + Intergenic
977629787 4:99229553-99229575 CTGATGTTCATCAGGGATATTGG + Intergenic
977863649 4:101997357-101997379 CTGATGTTCATCAGTGATATTGG + Intronic
977923602 4:102673024-102673046 CTGATGTGCACTAGGAATATAGG - Intronic
977951189 4:102972204-102972226 TTGATGTTCATCAGGGATATTGG - Intronic
977973734 4:103240509-103240531 TTGATGTTCATCAGGGATATTGG + Intergenic
978140711 4:105314462-105314484 TTGATGTTCATCAGGGATATTGG - Intergenic
978196800 4:105981490-105981512 CAGATGTTCATCAGGGATATTGG + Intronic
978277987 4:106975169-106975191 CTGATGTTCATCAGGGACATTGG + Intronic
978418734 4:108506794-108506816 TTGATGTTCATCAAGAATATTGG - Intergenic
978464873 4:108997688-108997710 TTGATGTTCATCAGGTATATTGG - Intronic
978590933 4:110324248-110324270 TTGATGTTCATCAGGGATATTGG + Intergenic
979009701 4:115352061-115352083 TTGATGTTCATCAGGGATATTGG + Intergenic
979045322 4:115855599-115855621 CTGATGTTCATCAAGGATATTGG - Intergenic
979050488 4:115924275-115924297 GATTTGTTCATCAGGAATATTGG - Intergenic
979062502 4:116080944-116080966 TTGATGTTCATCAGGGATATTGG + Intergenic
979091326 4:116486824-116486846 ATGATGTTCATGAGAAATATTGG + Intergenic
979115610 4:116818761-116818783 TTGATGTTCATCAGGGATATTGG - Intergenic
979236602 4:118407388-118407410 TTGATGTTCATCAGGGATATTGG - Intergenic
979337946 4:119485257-119485279 CTGATGTTCATCAGGGATATTGG - Intergenic
979423299 4:120532810-120532832 TCGATGTTCATGAGGGATATTGG + Intergenic
979457948 4:120947786-120947808 TTGATGTTCATCAGGGATATTGG - Intergenic
979487814 4:121288501-121288523 TTGATGTTCATCAGGGATATTGG - Intergenic
979501333 4:121443809-121443831 TTGATGTTCATCAGGGATATTGG - Intergenic
979512568 4:121571017-121571039 TTGATGTTCATCAGGGATATTGG - Intergenic
979554633 4:122031083-122031105 TTGGTGTTCATCAGGGATATTGG + Intergenic
979581717 4:122368489-122368511 ATGATGTTCATCAGGGATATTGG - Intergenic
979583547 4:122388294-122388316 TTGATGTTCATCAGGTATATTGG + Intronic
979705619 4:123716773-123716795 TTGATGTTCATCAGGGATATTGG - Intergenic
979735383 4:124076314-124076336 CCAATGTTCATCAGGAATATTGG - Intergenic
979742723 4:124171197-124171219 CTGATATTCATTAGGAATGTTGG - Intergenic
979747959 4:124240944-124240966 TTGATGTTCATCAGGGATATTGG - Intergenic
979819094 4:125148824-125148846 TTGATGTTCATCAGGGATATTGG + Intergenic
979886482 4:126033661-126033683 TTGATGTTCATCAGGGATATTGG - Intergenic
979944676 4:126814092-126814114 TTGATGTTCATCAGCAATATTGG - Intergenic
979981641 4:127263511-127263533 TTGATGTTCATCAGGGATATTGG + Intergenic
980021791 4:127719409-127719431 TTGATGTTCATCAGGGATATTGG + Exonic
980184995 4:129449774-129449796 TTGATGTTCATCAGGAATAATGG - Intergenic
980196145 4:129591437-129591459 TTGATGTTCATCAGGGATATTGG - Intergenic
980222969 4:129944377-129944399 GTGATGTTCATCAGGGATATTGG + Intergenic
980312789 4:131155410-131155432 TGTTTGTTTATGAGGAATATTGG - Intergenic
980333307 4:131437482-131437504 TTGATGTTCATCAGGGATATTGG + Intergenic
980529797 4:134038249-134038271 TTGATGTTCATCAGGGATATTGG + Intergenic
980540310 4:134185251-134185273 TTGATGTTCATCAGGGATATTGG - Intergenic
980548033 4:134295244-134295266 TTGATGTTCATCAGGGATATTGG - Intergenic
980626158 4:135377326-135377348 CTGATGTTCATCAGAGATATTGG + Intergenic
980633587 4:135470365-135470387 CTGATGGTCATCAGGGATATTGG + Intergenic
980649190 4:135688066-135688088 TCGATGTTCATCAGGAATATTGG + Intergenic
980660166 4:135847610-135847632 CTGATGTTCATCAGAGATATTGG - Intergenic
980696317 4:136361255-136361277 TCGATGTTCATCAGGAATATTGG - Intergenic
981096251 4:140785097-140785119 CTGATGTTCATCAGGGATATTGG + Intergenic
981183826 4:141778303-141778325 CTGTTGGTGATTATGAATATTGG + Intergenic
981201854 4:141989444-141989466 TTGATGTTCATCAGGGATATTGG + Intergenic
981257169 4:142675561-142675583 TTGATGTTCATCAGGGATATTGG - Intronic
981415313 4:144486147-144486169 TTGATGTTCATCAGGGATATTGG - Intergenic
981423192 4:144574880-144574902 TTGTTAATCATTAGGAATATAGG - Intergenic
981446133 4:144840391-144840413 TTGATGTTCATCAGGGATATTGG - Intergenic
981454407 4:144937092-144937114 TTGATGTTCATAAGGAATATTGG + Intergenic
981460483 4:145008400-145008422 CCGATGTTCATCAGGGATATTGG - Intronic
981479695 4:145225507-145225529 TTGATGTTCATCAGGGATATTGG + Intergenic
981514603 4:145593746-145593768 CTGATGTTCATTAGGGAAATTGG + Intergenic
981810036 4:148763453-148763475 ATGATGTTCATCAGGGATATTGG - Intergenic
981903774 4:149896084-149896106 CCGATGTTCATCAGGGATATTGG - Intergenic
981940289 4:150274993-150275015 TTGATGTTCATTAGGCATATTGG - Intronic
982119064 4:152122595-152122617 TTTATGTTCATGAGGAATATTGG + Intergenic
982120760 4:152141234-152141256 TTGATGTTCATCAGGGATATTGG - Intergenic
982304245 4:153913056-153913078 CCTATGTTCATGAGAAATATTGG - Intergenic
982575525 4:157104484-157104506 TCTTTGTTCATCAGGAATATTGG + Intronic
982614490 4:157623537-157623559 TTGATGTTCATCAGGGATATTGG - Intergenic
982725226 4:158899275-158899297 TTGATGTTCATCAGGGATATTGG + Intronic
982733046 4:158977022-158977044 CTGATGTTCATCAGGGATATTGG + Intronic
982734223 4:158988452-158988474 CTGATGTTCATCAGGGATATTGG - Intronic
982810207 4:159816181-159816203 TTGATGTTCATCAAGAATATTGG - Intergenic
982815104 4:159874834-159874856 TTGATGTTCATCAGGGATATTGG + Intergenic
982836203 4:160122640-160122662 CCGATGTTCATCAGGGATATTGG + Intergenic
982838512 4:160153599-160153621 CTGATGTTCATCAGGGATATTGG + Intergenic
982875077 4:160638144-160638166 TTGATGTTCATCAGGAATATTGG + Intergenic
982990475 4:162267533-162267555 CTGATGCTCATAAAGAATATTGG + Intergenic
983051824 4:163057067-163057089 TTGATGTTCATCAGGGATATTGG + Intergenic
983173998 4:164566806-164566828 CTGATGTTCATCAGGGATATTGG - Intergenic
983179785 4:164634159-164634181 TTGATGTTCATCAGGGATATTGG - Intergenic
983298682 4:165898656-165898678 TTGATGTTCATCAGGGATATTGG + Intronic
983355251 4:166648667-166648689 CTGATTTTCATCAGGGATATTGG + Intergenic
983418618 4:167489583-167489605 TTGATGTTCATCAGGGATATTGG + Intergenic
983673530 4:170265708-170265730 TTGATGTTCATCAGGGATATTGG + Intergenic
983686210 4:170412042-170412064 TTGATGTTCATCAGGGATATTGG + Intergenic
983754117 4:171312584-171312606 TTGATGTTCATCAGGGATATTGG + Intergenic
983757294 4:171355748-171355770 TTGATGTTCATCAGGGATATTGG + Intergenic
983788386 4:171762638-171762660 TCGATGTTCATCAGGAATATTGG - Intergenic
983819979 4:172181182-172181204 TTGATGTTCATCAGGGATATTGG - Intronic
983828738 4:172298794-172298816 TCGATGTTCATGAGGGATATTGG + Intronic
984008721 4:174345034-174345056 TTGATGTTCATCAGGGATATTGG + Intergenic
984110129 4:175602447-175602469 TTGATGTTCATCAGGGATATTGG + Intergenic
984380646 4:178988189-178988211 TTGATGTTCATCAGGGATATTGG + Intergenic
984422891 4:179547672-179547694 TTGGTGTTCATCAGGAATATTGG - Intergenic
984427918 4:179611813-179611835 CTGATGTTCATCAGGGATATTGG - Intergenic
984433724 4:179682072-179682094 TCGATGTTCATCAGGAATATTGG + Intergenic
984446126 4:179837985-179838007 CTGTTGTAGATTAGGAATCTTGG + Intergenic
984457280 4:179986282-179986304 TTGATGTTCATCAGGGATATTGG + Intergenic
984494014 4:180472103-180472125 CTGATGTTCATCAGGGACATTGG - Intergenic
985204868 4:187524469-187524491 CTGATGTTCATCAGGGATATTGG - Intergenic
986140908 5:5028760-5028782 TTGATGTTCATCAGGTATATTGG - Intergenic
986513706 5:8538302-8538324 TTTATGTTCTTGAGGAATATTGG - Intergenic
986654187 5:9994422-9994444 TTGATGTTCATCAGGGATATTGG - Intergenic
986665070 5:10095019-10095041 TTGATGTTCATCAGGGATATTGG - Intergenic
986838492 5:11669191-11669213 GTGATGTTCATCAGGGATATTGG + Intronic
986956161 5:13152596-13152618 TTGATGTTCATCAGGGATATTGG + Intergenic
987128265 5:14835831-14835853 TTGATGTTCATCAGGGATATTGG - Intronic
987479323 5:18433034-18433056 TTGATGTTCATCAGGGATATTGG - Intergenic
987584231 5:19833946-19833968 TTGATGTTCATCAGGGATATCGG + Intronic
987635123 5:20529453-20529475 TTGATGTTCATCAGGGATATTGG - Intronic
987649808 5:20726153-20726175 TTGATGTTCATCAGGGATATTGG - Intergenic
987834388 5:23142866-23142888 TTGATGTTCATCAGGGATATTGG + Intergenic
987915141 5:24203117-24203139 TTGTTGTTCATCAAGTATATTGG - Intergenic
987997860 5:25309210-25309232 CTGATGTTCATCAAGGATATTGG + Intergenic
988076307 5:26360119-26360141 TTGATGTTCATTAGGAATATTGG + Intergenic
988131432 5:27111737-27111759 TTGATGTTCATCAGGGATATTGG - Intronic
988332384 5:29858746-29858768 TTGATGTTCATCAGGGATATTGG - Intergenic
988618563 5:32798797-32798819 CTGATGTTCATCAGGGATATTGG - Intergenic
988627668 5:32895301-32895323 TTGATGTTCATCAGGGATATTGG + Intergenic
988630268 5:32922470-32922492 TTGATGTTCATCAGGGATATTGG - Intergenic
988687941 5:33543575-33543597 CTGATGTTCATCATGGATATTGG - Intronic
988719546 5:33862757-33862779 TTGATGTTCATCAGGGATATTGG - Intronic
988745750 5:34135344-34135366 TTGATGTTCATCAGGGATATTGG + Intergenic
988770800 5:34431181-34431203 ATGATGTTCATCAGGGATATTGG + Intergenic
989064447 5:37445474-37445496 TTGATGTTCATTAGGGATATTGG + Intronic
989072518 5:37526197-37526219 TTGATGTTCATCAGGGATATTGG - Intronic
989349599 5:40471164-40471186 TTGATGTTCATCAGGGATATTGG + Intergenic
989402712 5:41025750-41025772 TTGATGTTCATCAGGGATATTGG - Intronic
989627194 5:43441290-43441312 TTGATGTTCATCAGGGATATTGG + Intergenic
989674387 5:43956584-43956606 TTGATGTTCATCAGGGATATTGG - Intergenic
989674904 5:43962373-43962395 TTGATGTTCATCAGGGATATTGG + Intergenic
989676371 5:43978279-43978301 CTGATGTTCATCAGGGATATTGG + Intergenic
989681879 5:44039480-44039502 TCGATGTTCATCAGGAATATTGG + Intergenic
989991966 5:50776314-50776336 ATCTGGTTCATCAGGAATATTGG + Intronic
990004178 5:50925480-50925502 ATGATGTTTATCAGGAATATTGG - Intergenic
990016362 5:51067070-51067092 TTGATGTTCATCAGGGATATTGG - Intergenic
990231711 5:53719683-53719705 TTGATGTTCATCAGGGATATTGG - Intergenic
990273203 5:54168036-54168058 CTGCTTTTGATAAGGAATATAGG - Intronic
990317621 5:54598446-54598468 TTGATGTTCATCAGGGATATTGG - Intergenic
990541625 5:56778737-56778759 TTGTTGTTCATCAGGGATATTGG + Intergenic
990860055 5:60316914-60316936 TTGATGTTCATTAGGGATATTGG + Intronic
990929098 5:61067012-61067034 CTAATGTTCATGAGGACTGTTGG + Intronic
991053275 5:62295315-62295337 GTGATGTTCATCAGGGATATTGG - Intergenic
991071127 5:62481691-62481713 TTGATGTTCATCAGGGATATTGG + Intronic
991076393 5:62544167-62544189 TTGATGTTCATCAGGGATATTGG - Intronic
991162826 5:63525156-63525178 TTGATGTTCATCAGGGATATTGG - Intergenic
991199336 5:63973242-63973264 TTGATGTTCATAAGGGATATTGG - Intergenic
991323778 5:65406574-65406596 TTGATGTTCATCAGGGATATTGG + Intronic
991334549 5:65532465-65532487 TCTGTGTTCATGAGGAATATTGG - Intronic
991527058 5:67571362-67571384 TTGGTGTTCATCAGGGATATTGG + Intergenic
991576175 5:68105944-68105966 TTGATGTTCATCAGGGATATTGG - Intergenic
992029240 5:72704675-72704697 CTATATTTCATGAAGAATATTGG + Intergenic
992054894 5:72979036-72979058 CTGATGTTCATCAGAGATATTGG + Intronic
992078222 5:73210775-73210797 TCGATGTTCATGAGGGATATTGG - Intergenic
992183173 5:74218157-74218179 TTGATGTTCATCAGGGATATTGG - Intergenic
992277444 5:75134732-75134754 TTGGTGTTCATCAGGGATATTGG - Intronic
992316631 5:75562937-75562959 TTGATGTTCATCAGGGATATTGG + Intronic
992572065 5:78068820-78068842 TTGATGTTCATCAGGGATATTGG - Intronic
992811524 5:80393553-80393575 GTGATGTTCATCAGGGATATTGG + Intergenic
992854177 5:80843331-80843353 TTGATGTTCATCAGGGATATTGG + Intronic
993020087 5:82581642-82581664 GCGATGTTCATCAGGAATATTGG + Intergenic
993053054 5:82947724-82947746 TTGATGTTCATCAGGGATATTGG - Intergenic
993220668 5:85092737-85092759 TTGATGTTCATCAGGGATATTGG - Intergenic
993244606 5:85435157-85435179 TTGATGTTCATCAGGGATATTGG - Intergenic
993266306 5:85730942-85730964 TTGATGTTCATCAGGGATATTGG + Intergenic
993270796 5:85793317-85793339 TTGATGTTCATCAGGGATATTGG + Intergenic
993403027 5:87476265-87476287 TTGGTGTTCATCAGGGATATTGG - Intergenic
993437977 5:87921410-87921432 TTGATGTTCATCAGGGATATTGG + Intergenic
993615298 5:90103854-90103876 CTGATGTTCATCAAAAATATTGG + Intergenic
993742580 5:91559087-91559109 TTGATGTTCATCAGGGATATTGG - Intergenic
993757312 5:91747641-91747663 TTGATGTTCATCAGGGATATTGG + Intergenic
993837355 5:92831904-92831926 TTGATGTTCATCAGGGATATTGG + Intergenic
993888610 5:93445764-93445786 TTGATGTTCATCAGGGATATTGG - Intergenic
993892095 5:93486811-93486833 TTGATGTTCATCAGGGATATTGG - Intergenic
993984990 5:94586756-94586778 TTGATGTTCATCAGGGATATTGG - Intronic
994142517 5:96357757-96357779 TTGATGTTCATCAGGGATATTGG + Intergenic
994222626 5:97213703-97213725 TTGATGTTCATCAGGGATATTGG + Intergenic
994229064 5:97292344-97292366 TTTGTGTTCATTAGGAATATTGG + Intergenic
994344856 5:98672335-98672357 TTGATGTTCATCAGGGATATTGG - Intergenic
994437729 5:99760327-99760349 TTGATGTTCATCAGGTATATTGG + Intergenic
994499539 5:100557363-100557385 TTGATGTTCATCAGGGATATTGG + Intronic
994507473 5:100660447-100660469 TTGATGTTCATCAGGGATATTGG + Intergenic
994586220 5:101712676-101712698 TTGATGTTCATCAGGGATATTGG + Intergenic
994611280 5:102044182-102044204 CTGATGTTCATCAGGGATAATGG - Intergenic
994721184 5:103382272-103382294 TTGATGTTCATCAGGGATATTGG + Intergenic
994990966 5:106996708-106996730 TTGATGTTCATCAGGGATATTGG + Intergenic
995197538 5:109389079-109389101 CCTATGTTCATGAGAAATATTGG + Intronic
995204249 5:109460951-109460973 TCGATGTTCATCAGGAATATTGG - Intergenic
995340576 5:111054529-111054551 TTGATGTTCATCAGGGATATTGG + Intergenic
995341623 5:111067238-111067260 AGGTTGTTCAAGAAGAATATAGG - Intergenic
995578709 5:113571405-113571427 CTGATATTCATCAGGGATATTGG + Intronic
995690054 5:114815594-114815616 TTGATGTTCATCAGGAATATTGG + Intergenic
996036586 5:118765136-118765158 TTGATGTTCATCAGGGATATTGG - Intergenic
996054966 5:118972688-118972710 TTGATGTTCATCAGGGATATTGG - Intronic
996055376 5:118976901-118976923 TTGATGTTCATCAGGGATATTGG - Intronic
996271134 5:121605865-121605887 TTGATGTTCATCAGGGATATTGG - Intergenic
996275711 5:121663623-121663645 CTGATGTTCATTAGAGATATTGG - Intergenic
996296254 5:121920904-121920926 TTGTTATTCATTAGGGATATTGG + Intergenic
996399901 5:123050528-123050550 TCTCTGTTCATGAGGAATATTGG + Intergenic
996494949 5:124144233-124144255 CTCTTATTCATGAGGGATATTGG - Intergenic
996676025 5:126175560-126175582 TTGATGTTCATCAGGGATATTGG - Intergenic
996782321 5:127200851-127200873 TTGATGTTCATCAGGGATATTGG - Intergenic
996854611 5:127991202-127991224 TTGATGTTCATCAGGGATATTGG + Intergenic
996902418 5:128557633-128557655 TTGATGTTCATCAAGAATATTGG - Intronic
996943166 5:129034712-129034734 TTGATGTTCATCAGGGATATTGG + Intergenic
996960016 5:129235968-129235990 TTGATGTTCATCAGGGATATTGG + Intergenic
996986377 5:129570652-129570674 TTTATGTTCATGAGAAATATTGG - Intronic
996989742 5:129614249-129614271 CTGATGTTCATCAGGGATATTGG - Intronic
997106917 5:131031143-131031165 TTGATGTTCATCAGGGATATTGG + Intergenic
997138066 5:131347713-131347735 TTGATGTTCATCAGGGATATTGG - Intronic
997578314 5:135000347-135000369 TTGATGTTCATCAGGGATATTGG + Intronic
997790332 5:136753757-136753779 TTGATGTTCATCAGGGATATTGG + Intergenic
997808515 5:136943856-136943878 TTGATGTTCATCAGGGATATTGG + Intergenic
997876286 5:137550645-137550667 TTGATGTTCATCAGGGATATTGG - Intronic
998242052 5:140455428-140455450 TTGATGTTCATCAGGGATATTGG - Intronic
998704668 5:144744932-144744954 TTGTTGTTCATGAGAGATATTGG + Intergenic
998755300 5:145371538-145371560 CCAATGTTCATCAGGAATATTGG + Intergenic
998768546 5:145515704-145515726 TTGATGTTCATCAGGTATATTGG - Intronic
998806990 5:145927656-145927678 TTGATGTTCATCAGGGATATTGG + Intergenic
999391191 5:151192717-151192739 TCTATGTTCATGAGGAATATTGG - Intronic
999570641 5:152916103-152916125 TTGATGTTCATCAGGGATATTGG + Intergenic
999677607 5:154020860-154020882 TTGATGTTCATCAGGGATATTGG - Intronic
999703296 5:154248238-154248260 TTGATGTTCATCAGGGATATTGG + Intronic
999816613 5:155183457-155183479 CTGTTATTCATAAGGACTATTGG + Intergenic
999820669 5:155224843-155224865 TTGATGTTCATCAGGGATATCGG - Intergenic
1000061695 5:157663166-157663188 TTGATGTTCATCAGGGATATTGG - Intronic
1000144555 5:158441222-158441244 TTGATGTTCATCAGGGATATTGG + Intergenic
1000214617 5:159143239-159143261 TTGATGTTCATCAGGGATATTGG - Intergenic
1000420994 5:161037615-161037637 TTGATGTTCATCAGGGATATTGG - Intergenic
1000548400 5:162629431-162629453 CTGAGGTTCATCAGGGATATTGG - Intergenic
1000582445 5:163050554-163050576 TTGATGTTCATCAGGGATATTGG - Intergenic
1000653845 5:163852077-163852099 TTGATGTTCATCAGGGATATTGG + Intergenic
1000660867 5:163936554-163936576 TGGATGTTCATCAGGAATATTGG - Intergenic
1000720222 5:164696642-164696664 CTGATGTTCATTAGGTATATTGG - Intergenic
1000737662 5:164925741-164925763 CTGATGTTCATCAGGGATATTGG + Intergenic
1000738105 5:164930877-164930899 TTGATGTTCATCAGGGATATTGG + Intergenic
1000830885 5:166099830-166099852 TTGATGTTCATCAGGGATATTGG + Intergenic
1000834703 5:166139736-166139758 CCTATGTTCATCAGGAATATTGG - Intergenic
1001189633 5:169616883-169616905 TCTTTGTTCATGAGAAATATTGG - Intergenic
1001212500 5:169823334-169823356 TTGATGTTCATCAGGGATATTGG - Intronic
1001820624 5:174707391-174707413 TTGTTGGTAATGAGGAATGTTGG + Intergenic
1002406309 5:179035660-179035682 CTCTTGTTCATAGGTAATATTGG - Intergenic
1002677515 5:180930029-180930051 TTGATGTTTATCAGGAATATTGG - Intronic
1002850165 6:987472-987494 CTGATGTTCATCAGGGATATTGG + Intergenic
1002967537 6:1981737-1981759 CTGATGTTCATCAAGGATATTGG - Intronic
1003165551 6:3674638-3674660 TTGATGTTCATGACGGATATTGG + Intergenic
1003327398 6:5102709-5102731 GTGTTGTTCATGAGGCATTCTGG - Intronic
1003388193 6:5688628-5688650 TTGATGTTCATGAGGGATATTGG + Intronic
1003416546 6:5914282-5914304 TTGGTGTTCATTAGGGATATGGG + Intergenic
1003647822 6:7929398-7929420 TTGATGTTCATCAGGGATATTGG - Intronic
1005152040 6:22762738-22762760 CTGATGTTCATCAGGGATATTGG + Intergenic
1005182528 6:23122384-23122406 TTGATGTTCATCAGGGATATTGG + Intergenic
1005543910 6:26843579-26843601 CTGATGTTCATCAGGGATATTGG + Intergenic
1005558471 6:27012128-27012150 TTGATGTTCATCAGGGATATTGG - Intergenic
1005801760 6:29432424-29432446 CTGTTGGTAATGGGGAATTTAGG - Intronic
1005924790 6:30433988-30434010 TTGATGTTCATCAGGGATATTGG - Intergenic
1005936321 6:30524534-30524556 TTGATGTTCATCAGGGATATTGG - Intergenic
1006197994 6:32259522-32259544 TTGATGTTCATCAGGGATATTGG + Intergenic
1006237564 6:32648345-32648367 TTGATGTTCATCAGGCATATTGG - Intergenic
1006990586 6:38211774-38211796 CTGATGTTGAACAGGAATATGGG + Intronic
1007347612 6:41244623-41244645 TTGATGTTCATCAGGGATATTGG - Intergenic
1007858487 6:44882599-44882621 TTGATGTTCATCAGGGATATTGG - Intronic
1007871183 6:45040700-45040722 CTGTTATTCAACAGGATTATTGG - Intronic
1007988057 6:46227214-46227236 TTGATGTTCATCAGGGATATTGG + Intronic
1008038046 6:46767056-46767078 CCTGTGTTCATGAGAAATATTGG - Intergenic
1008088886 6:47273228-47273250 TTGATGTTCATCAGGGATATTGG - Intronic
1008116680 6:47558749-47558771 TTGATGTTCATCAGGGATATTGG + Intronic
1008155837 6:48013000-48013022 TTGATGTTCATCAGGGATATTGG + Intronic
1008207709 6:48683681-48683703 TTGATGTTCATCAGGGATATTGG - Intergenic
1008339507 6:50347428-50347450 TTGATGTTCATCAGGTATATTGG - Intergenic
1008467903 6:51851324-51851346 TTGATGTTCATCAGGGATATTGG + Intronic
1008734909 6:54531177-54531199 TTGATGTTCATCAGGGATATTGG - Intergenic
1008780064 6:55092739-55092761 TTGATGTTCATCAGGGATATTGG - Intergenic
1009014690 6:57885248-57885270 TTGATGTTCATCAGGGATATTGG + Intergenic
1009166434 6:60347171-60347193 TTGATGTTCATCAGGGATATGGG + Intergenic
1009241126 6:61187169-61187191 CCGATGTTCATCAGGGATATTGG - Intergenic
1009282933 6:61774855-61774877 TTGATGTTCATCAGGGATATTGG - Intronic
1009410378 6:63359260-63359282 CCGATGTTCATCAGGAATATTGG + Intergenic
1009411053 6:63365651-63365673 TTGATGTTCATCAGGAATATTGG - Intergenic
1009453938 6:63832780-63832802 TTGATGTTCACCAGGAATATTGG - Intronic
1009510463 6:64545084-64545106 TTGATGTTCATCAGGGATATTGG - Intronic
1009512643 6:64571995-64572017 TTGATGTTCATCAGGGATATTGG - Intronic
1009521416 6:64687254-64687276 ATCATGTTCATGAGAAATATTGG - Intronic
1009624358 6:66119949-66119971 ATTTTGCTCATGAGAAATATTGG - Intergenic
1009668276 6:66710822-66710844 TTGATGTTCATCAGGGATATTGG + Intergenic
1009794727 6:68452679-68452701 TTGGTGTTCATCAGGGATATTGG + Intergenic
1009916412 6:70002292-70002314 TTGATGTTCATCAGGGATATTGG + Intronic
1010312226 6:74400873-74400895 TTGATGTTCATCAGGGATATTGG - Intergenic
1010412154 6:75572929-75572951 TTGATGTTCATCAGGGATATTGG - Intergenic
1010482888 6:76375938-76375960 CTGATGTTCATCAGGGATACTGG + Intergenic
1010594931 6:77751830-77751852 TTGATGTTCATCAGGGATATTGG - Intronic
1010747564 6:79581353-79581375 TTGATGTTCATCAGGGATATTGG - Intergenic
1010822346 6:80430292-80430314 TTGATGTTCATTAGGGATATTGG + Intergenic
1010888107 6:81269275-81269297 TTGATGTTCATGAGGGATATTGG - Intergenic
1010930722 6:81799675-81799697 CTGTTGATCATGAGATATAATGG - Intergenic
1010945982 6:81973772-81973794 CCGATGTTCATCAGGGATATTGG - Intergenic
1011199519 6:84819998-84820020 TTGATGTTCATCAGGGATATTGG + Intergenic
1011214548 6:84991342-84991364 TTGATGTTCATTAGGGATATTGG - Intergenic
1011308447 6:85955330-85955352 TTGATGTTCATGAGGGATATTGG + Intergenic
1011407947 6:87035619-87035641 TTGATGTTCATCAGCAATATTGG + Intergenic
1011432700 6:87304739-87304761 TTGATGTTCATCAGGGATATTGG - Intronic
1011932466 6:92731342-92731364 TTGATGTTCATCAGGTATATTGG + Intergenic
1012013845 6:93829594-93829616 CTGATGTTCATCAAGGATATTGG + Intergenic
1012082728 6:94781864-94781886 CTGATGTTCATCAGGGATATTGG + Intergenic
1012148855 6:95720297-95720319 TAGATGTTCATGAGGGATATTGG - Intergenic
1012190435 6:96273108-96273130 TTGATGTTCATCAGGGATATTGG + Intergenic
1012220344 6:96641357-96641379 CCGATGTTCATCAGGGATATTGG - Intergenic
1012330816 6:97984067-97984089 CTGTATTTCATGAGGGATGTTGG - Intergenic
1012674607 6:102099814-102099836 TTGATGTTCATCAGCAATATTGG + Intergenic
1012766258 6:103370301-103370323 CTGATGTTCATCAGGGATATTGG - Intergenic
1012783418 6:103591806-103591828 CTGATGTTCATCAGGGATATTGG + Intergenic
1012785505 6:103620161-103620183 CTGATGTTCATCAGGAGTATTGG - Intergenic
1013025380 6:106266565-106266587 TTGATGTTCATCAGGGATATTGG - Intronic
1013267719 6:108516215-108516237 TTGATGTTCATCAGGGATATTGG - Intronic
1013382771 6:109593578-109593600 TTGATGTTCATCAGGGATATTGG - Intronic
1013390649 6:109682962-109682984 TTGATGTTCATCAGGGATATTGG - Intronic
1013461897 6:110382500-110382522 TTGATGTTCATCAGGGATATTGG - Intergenic
1013495781 6:110696062-110696084 TTTGTGTTCATCAGGAATATTGG - Intronic
1013675054 6:112449802-112449824 CTGTTGTTAATGAAGAAATTTGG - Intergenic
1013682944 6:112545073-112545095 TTGATGTTCATCAGGCATATTGG - Intergenic
1013683635 6:112553253-112553275 TTGATGTTCATCAGGGATATTGG - Intergenic
1013905756 6:115216893-115216915 TTTGTGTTCATGAGGGATATTGG - Intergenic
1014243976 6:119047944-119047966 CTGGTGTTCATCAAGGATATTGG - Intronic
1014332453 6:120086677-120086699 TTGATGTTCATCAGGGATATTGG - Intergenic
1014352844 6:120365452-120365474 CTGATGTTCATCAGGGATATTGG - Intergenic
1014422683 6:121264629-121264651 CTGATGTTCATTAGGGATATTGG - Intronic
1014423262 6:121270825-121270847 TCGATGTTCATCAGGAATATTGG - Intronic
1014431123 6:121371961-121371983 TTGATGTTCATCAGGGATATTGG - Intergenic
1014666156 6:124240459-124240481 CTGATGATCATCAGGGATATTGG - Intronic
1014765347 6:125399798-125399820 TTGATGTTCATCAGGGATATTGG - Intergenic
1014892871 6:126863953-126863975 ATGATATTCATGAGGATTATTGG + Intergenic
1014902619 6:126986184-126986206 TTGATGTTCATCAGGGATATTGG - Intergenic
1014968762 6:127789589-127789611 TTGATGTTCATCAGGAATATTGG - Intronic
1015133356 6:129839142-129839164 TTGATGTTCATCAGAAATATTGG - Intronic
1015136671 6:129879958-129879980 TTGATGTTCATCAGGGATATTGG + Intergenic
1015358527 6:132308584-132308606 TCGATGTTCATAAGGAATATTGG - Intronic
1015432863 6:133151496-133151518 TTGATGTTCATCAGGGATATTGG + Intergenic
1015501112 6:133934399-133934421 TCGATGTTCATCAGGAATATTGG - Intergenic
1015587710 6:134792912-134792934 TTGATGTTCATCAGGGATATTGG - Intergenic
1015623041 6:135152779-135152801 TTGATGTTCATCAGGGATATTGG + Intergenic
1015637556 6:135292956-135292978 ATTTTGTTCATGAGAAATATGGG - Intronic
1015659789 6:135562674-135562696 TTGATGTTCATCAGGGATATTGG + Intergenic
1015711113 6:136141393-136141415 TTGATGTTCATCAGGAATATTGG + Intronic
1015779411 6:136848777-136848799 TTGATGTTCATCAGGGATATTGG + Intronic
1015882922 6:137887794-137887816 TTGTTGTTCATCAGGGATATTGG + Intergenic
1016059326 6:139612767-139612789 TTTTTATTCATGAGGGATATTGG + Intergenic
1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG + Intergenic
1016242208 6:141943848-141943870 TTGATGTTCATCAGGGATATTGG - Intergenic
1016412561 6:143798813-143798835 CTGATGTTCATCGGGGATATTGG + Intronic
1016418036 6:143853878-143853900 TTGATGTTCATCAGGGATATTGG + Intronic
1016483148 6:144504685-144504707 TTGATGTTCATCAGGGATATTGG + Intronic
1016542384 6:145180046-145180068 TTGGTGTTCATCAGGGATATTGG - Intergenic
1016640067 6:146338145-146338167 CTGTTGGAGATTAGGAATATAGG - Intronic
1016790043 6:148058958-148058980 TTGATGTTCATCAGGGATATTGG + Intergenic
1016797028 6:148129297-148129319 CTGTTATTCCAGAGGAAAATAGG + Intergenic
1016875518 6:148860923-148860945 TTGATGTTCATCAGGGATATTGG + Intronic
1016996814 6:149966665-149966687 CTTTAGGTCATTAGGAATATAGG - Intronic
1017310352 6:152968771-152968793 TTGATGTTCATCAGGGATATTGG + Intergenic
1018075722 6:160211146-160211168 TTGATGTTCATCAGGGATATTGG + Intronic
1019113187 6:169734713-169734735 TTGATGTTCATCAGGGATATTGG + Intergenic
1019182257 6:170196737-170196759 CCTGTGTTCATGAGGGATATTGG - Intergenic
1019972943 7:4556895-4556917 TCGATGTTCATCAGGAATATTGG + Intergenic
1020366893 7:7390419-7390441 TTGATGTTCATCAGGAATATTGG + Intronic
1020443416 7:8243130-8243152 CTGATGTTTATCAGGGATATAGG - Intronic
1020487322 7:8735564-8735586 TTGATGTTCATCAGGGATATTGG + Intronic
1020547002 7:9544718-9544740 CCTATGTTCATCAGGAATATTGG - Intergenic
1020574122 7:9903773-9903795 TTGATGTTCATCAGGGATATTGG - Intergenic
1020681408 7:11241711-11241733 TTGTTTTTCATGAAGAATATCGG - Intergenic
1020690604 7:11350136-11350158 TTGATGTTCATCAGGGATATTGG + Intergenic
1020716384 7:11678912-11678934 CTGATGTTCATTAGGGATATTGG - Intronic
1020773819 7:12428767-12428789 TTGATGTTCATCAGGGATATTGG + Intergenic
1020780588 7:12512614-12512636 CCTCTGTTCATCAGGAATATTGG + Intergenic
1020810312 7:12843249-12843271 TTGATGTTCATCAGGGATATTGG - Intergenic
1020860526 7:13487151-13487173 TTGATGTTCATCAAGAATATTGG - Intergenic
1020980774 7:15065509-15065531 TTGATGTTCATCAGGGATATTGG - Intergenic
1021099575 7:16572367-16572389 CTGATGTTCGTCAGGGATATTGG - Intronic
1021282370 7:18736661-18736683 TTGATGTTCATCAGGGATATTGG + Intronic
1021286279 7:18784883-18784905 CTGTTGTTCATGAGAATGTTGGG - Intronic
1021306312 7:19036660-19036682 TTGATGTTCATCAGGGATATTGG + Intronic
1021464329 7:20924780-20924802 TTGATGTTCATCAGGGATATTGG + Intergenic
1021642557 7:22753784-22753806 TTGATGTTCATCAGGGATATTGG + Intergenic
1021733709 7:23622008-23622030 TTGTTGTTCATCAGGGATATTGG + Intronic
1021797849 7:24275403-24275425 TTGATGTTCATCAGGGATATTGG + Intergenic
1021870228 7:24998681-24998703 TTGATGTTCATCAGGGATATTGG + Intergenic
1022453911 7:30541184-30541206 CTGATGTTCATCAGGGATGTTGG - Intronic
1022602800 7:31777626-31777648 CTGTTGTTTAAGATGAAAATGGG - Intronic
1022634994 7:32123426-32123448 TTGATGTTCATCAGGGATATTGG - Intronic
1022848126 7:34231969-34231991 TTGATGTTCATCAGGGATATTGG + Intergenic
1022885236 7:34636586-34636608 TTGATGTTCATCAGGGATATTGG - Intergenic
1023464318 7:40437025-40437047 TTTTTCTTCCTGAGGAATATAGG - Intronic
1024276885 7:47684744-47684766 CTGTTGGGCAGGAGCAATATGGG - Intergenic
1024679685 7:51672550-51672572 TTGATGTTCATCAGGGATATTGG - Intergenic
1024692371 7:51817173-51817195 TTGATGTTCATCAGGGATATTGG - Intergenic
1024950115 7:54852107-54852129 CTGGTGTTCATCAGGGATAGTGG + Intergenic
1025017845 7:55454513-55454535 TTGATGTTCATCAGGGATATTGG - Intronic
1025714807 7:63945304-63945326 TTGATGTTCATCAGGGATATTGG - Intergenic
1026485160 7:70811865-70811887 TTGATGTTCATCAGGGATATTGG + Intergenic
1027330423 7:77086937-77086959 TCGATGTTCATCAGGAATATTGG + Intergenic
1027449985 7:78320336-78320358 GTGATGTTCATCAGGGATATTGG - Intronic
1027575917 7:79930869-79930891 CTGATGTTCATCAAGGATATTGG + Intergenic
1027792613 7:82652546-82652568 TTGATGTTCATCAGGGATATTGG - Intergenic
1027885562 7:83900272-83900294 TTGATTTTCATCAGGAATATTGG - Intergenic
1027987233 7:85308770-85308792 CTTTTGTGCATGTGGAATAGAGG - Intergenic
1028049216 7:86161091-86161113 TTGATGTTCATCAGGGATATTGG - Intergenic
1028140118 7:87264067-87264089 TTGATGTTCATCAGGCATATTGG - Intergenic
1028316446 7:89408346-89408368 TTGATGTTCATCAGGGATATTGG + Intergenic
1028332329 7:89610198-89610220 TTGATGTTCATCAGGGATATTGG + Intergenic
1028337093 7:89671374-89671396 CTGATGTTCATCAGGGATATTGG + Intergenic
1028431584 7:90753209-90753231 TTTTTGTTCATCAGGCATATTGG - Intronic
1028436495 7:90810184-90810206 TCGATGTTCATGAGGGATATTGG - Intronic
1028442858 7:90883652-90883674 CTGACGTTCATCAGGGATATTGG - Intronic
1028499213 7:91499557-91499579 TTGATGTTCATCAGGAATATTGG + Intergenic
1028734479 7:94191770-94191792 CTGATGTTCATCAGGGATATTGG - Intergenic
1028801056 7:94966742-94966764 TTGATGTTCTTCAGGAATATTGG + Intronic
1028816188 7:95147923-95147945 TTGATGTTCATCAGGGATATTGG + Intronic
1028992108 7:97060203-97060225 TTGATGTTCATTAGGGATATTGG - Intergenic
1029017944 7:97333766-97333788 TTGATGTTCATCAGGGATATTGG - Intergenic
1029785338 7:102784397-102784419 TCGATGTTCATCAGGAATATTGG - Intronic
1029810392 7:103041536-103041558 TTGATGTTCATCAGGGATATTGG - Intronic
1029850759 7:103459180-103459202 TTGATGTTCATCAGGGATATTGG + Intergenic
1029888418 7:103899506-103899528 TTGATGTTCATCAGGGATATTGG - Intronic
1029919418 7:104246838-104246860 TTGATGTTCATCAGGAATATTGG + Intergenic
1029951352 7:104589539-104589561 TTGATGTTCATCAGGGATATTGG + Intronic
1030166097 7:106556892-106556914 TTGATGTTCATCAGGGATATTGG + Intergenic
1030258280 7:107535870-107535892 TTGATGTTCATCAGGGATATTGG - Intronic
1030408550 7:109145371-109145393 CTTTTGTTTATGAGAAATACTGG - Intergenic
1030501693 7:110367439-110367461 TTGATGTTCATTAGGAATATTGG + Intergenic
1030508853 7:110457860-110457882 CTGGTGTTCATCAGGGATAGTGG - Intergenic
1030534382 7:110747462-110747484 TCGATGTTCATCAGGAATATTGG - Intronic
1030697564 7:112602864-112602886 TTGATGTTCATCAGAAATATTGG + Intergenic
1030774457 7:113516109-113516131 TTGATGTTCATCAGGGATATTGG + Intergenic
1030781120 7:113601363-113601385 TTGATGTTCATCAGGGATATTGG - Intergenic
1030882214 7:114894419-114894441 TTGATGTTCATCAGGGATATTGG + Intergenic
1030958993 7:115891045-115891067 TTGATGTTCATCAGGGATATTGG - Intergenic
1031366310 7:120904416-120904438 TCGATGTTCATGAGGGATATTGG - Intergenic
1031433964 7:121709887-121709909 TTGATGTTCATCAGGGATATTGG + Intergenic
1031699364 7:124904230-124904252 CTGATGTTCATCAGGGATATTGG - Intronic
1031864937 7:127028260-127028282 TTGATGTTCATCAGGGATATTGG + Intronic
1031900126 7:127399671-127399693 CTGTTGATAGTGTGGAATATTGG - Intronic
1032372697 7:131374584-131374606 TTGTTTTTCACAAGGAATATGGG - Intronic
1032777161 7:135125608-135125630 TTGATGTTCATCAGGAATATTGG - Intronic
1033112259 7:138590637-138590659 TTGATGTTCATTAGGGATATTGG - Intergenic
1033513984 7:142087953-142087975 CTGGTGATCACCAGGAATATTGG + Intronic
1033612677 7:142980671-142980693 TTGATGTTCATCAAGAATATTGG + Intergenic
1033787599 7:144752555-144752577 CTGATGTTCATCAGGAATACTGG + Intronic
1033827991 7:145215578-145215600 TTGATGTTCATCAGGGATATTGG + Intergenic
1033967711 7:146997496-146997518 CCTATGTTCATCAGGAATATTGG + Intronic
1034142085 7:148829653-148829675 CTTTTGTTTATGAAGCATATAGG - Intronic
1034208591 7:149341828-149341850 TTGATGTTCATCAGGGATATTGG + Intergenic
1034216519 7:149411260-149411282 TTGATGTTCATCAAGAATATTGG + Intergenic
1034321853 7:150192152-150192174 TGTTTGTTCATGAGGGATATTGG + Intergenic
1034370453 7:150591157-150591179 TTGATGTTCATCAGGGATATTGG + Intergenic
1034375225 7:150637084-150637106 ATGATGTTCATCAGGGATATTGG + Intergenic
1034639063 7:152587862-152587884 TCTATGTTCATGAGGAATATTGG + Intergenic
1034714760 7:153231430-153231452 TTGATGTTCATCAGGGATATTGG + Intergenic
1034770892 7:153775111-153775133 TGTTTGTTCATGAGGGATATTGG - Intergenic
1035237841 7:157510631-157510653 TTGATGTTCATCAGGGATATTGG - Intergenic
1035488040 7:159244777-159244799 CCTATGTTCATGAGGGATATTGG - Intergenic
1035881928 8:3252489-3252511 TTGATGTTCATCAGGGATATTGG + Intronic
1036052741 8:5218074-5218096 TTTTTGTGAATGAGGAATATGGG - Intergenic
1036558351 8:9880309-9880331 CTGATGTTCATCAGGGATATTGG - Intergenic
1037087365 8:14869152-14869174 TTGATGTTCATCAGGGATATTGG - Intronic
1037285073 8:17290605-17290627 TTGATGTTCATCAGGGATATTGG + Intronic
1038074035 8:24049672-24049694 CTGTCATTCATCAGGGATATTGG - Intergenic
1038281392 8:26168475-26168497 CTTTTGTAGATGAGGAAAATAGG - Intergenic
1038363437 8:26906606-26906628 TTTTTGTTCATCAGGGATATTGG + Intergenic
1038707952 8:29913077-29913099 TTGATGTTCATCAGGGATATTGG - Intergenic
1038872440 8:31509853-31509875 CCGATGTTCATCAGGGATATTGG - Intergenic
1039146019 8:34448163-34448185 TTGATGTTCATCAGGGATATTGG + Intergenic
1039170713 8:34741751-34741773 TTGATGTTCATGAGGGATATTGG - Intergenic
1039302751 8:36227408-36227430 TTGATGTTCATCAGGGATATTGG - Intergenic
1039632458 8:39127096-39127118 CTGATTTTCATCAGGGATATTGG + Intronic
1039639304 8:39202054-39202076 TTGATGTTCATCAGGGATATTGG + Intronic
1039685585 8:39798466-39798488 TTGATGTTCATCAGGGATATTGG + Intronic
1039686778 8:39811491-39811513 TTGATGTTCCTCAGGAATATTGG - Intronic
1039849791 8:41354370-41354392 TTGATGTTCATCAGGGATATTGG + Intergenic
1040091693 8:43405096-43405118 TTGATGTTCATCAAGAATATTGG + Intergenic
1040355288 8:46611579-46611601 TTGATGTTCATCAGGGATATTGG - Intergenic
1040441934 8:47452426-47452448 TTGATGTTCATCAGGGATATTGG - Intronic
1040736086 8:50510342-50510364 TCGATGTTCATGAGGGATATTGG + Intronic
1040753232 8:50737623-50737645 CTGATATTCATCAGAAATATTGG - Intronic
1040783994 8:51143852-51143874 TTGATGTTCATCAGGACTATTGG + Intergenic
1040968473 8:53108907-53108929 TTGATGTTTATCAGGAATATTGG + Intergenic
1040993038 8:53372700-53372722 CTGATGTTCATCAGGGATATTGG - Intergenic
1041051154 8:53935812-53935834 TTGATGTTCATCAGGGATATTGG - Intronic
1041120704 8:54583427-54583449 TTGATGTTCATCAGGAATATTGG + Intergenic
1041128334 8:54668052-54668074 TTGATGTTCATCAGGGATATTGG - Intergenic
1041275039 8:56148572-56148594 TTGATGTTCATCAGGGATATTGG + Intergenic
1041322852 8:56632813-56632835 GTGATGTTCATCAGGAATATTGG + Intergenic
1041424703 8:57707086-57707108 TTGATGTTCATCAGGGATATTGG - Intergenic
1041518448 8:58728361-58728383 TTGATGTTCATCAGGGATATTGG - Intergenic
1041583617 8:59491561-59491583 CTGATATTCATCAGGGATATTGG + Intergenic
1042479152 8:69283893-69283915 TTGATGTTCATCAGGGATATTGG - Intergenic
1042536548 8:69864536-69864558 TTGATGTTCATCAGGGATATTGG - Intergenic
1042597208 8:70462640-70462662 TTGATGTTCATCAGGGATATTGG + Intergenic
1042638279 8:70903066-70903088 TTGATGTTCATTAGGGATATTGG + Intergenic
1042853187 8:73237279-73237301 TTGATGTTCATCAGGGATATTGG + Intergenic
1042931618 8:74019634-74019656 TCGATGTTCATTAGGAATATTGG - Intronic
1043071104 8:75636863-75636885 TGGTTGTTCATCAGGGATATTGG + Intergenic
1043129094 8:76438847-76438869 CTGATGTTCATCAGGGATATTGG + Intergenic
1043165541 8:76898508-76898530 TTGATGTTCATCAGGGATATTGG + Intergenic
1043496131 8:80802403-80802425 TTGATGTTCATCAAGAATATTGG - Intronic
1043498256 8:80826638-80826660 TTGATGTTCATCAGGGATATTGG - Intronic
1043532751 8:81168887-81168909 TTGATGTTCATGAGGGATATTGG - Intergenic
1043554380 8:81413876-81413898 CTGATGTTCATCAAGGATATTGG - Intergenic
1043592836 8:81849742-81849764 TTGATGTTCATCAGGGATATTGG - Intergenic
1043593488 8:81856995-81857017 ATGTTTTTCATGTGAAATATGGG + Intergenic
1043604812 8:81987507-81987529 CTGATGTTCATCAGGGATATTGG + Intergenic
1043828651 8:84961250-84961272 TTGATGTTCATCAGGGATATTGG - Intergenic
1043845168 8:85154989-85155011 TTGATGTTCATCAGGGATATTGG - Intergenic
1044033691 8:87270650-87270672 TTAATGTTCATCAGGAATATTGG + Intronic
1044048117 8:87463513-87463535 CTGATGTTCATCAGGAATATTGG + Intronic
1044168930 8:89024722-89024744 TTGATGTTCATCAGGTATATGGG + Intergenic
1044196033 8:89377617-89377639 TTGATGTTCATCAGGGATATTGG - Intergenic
1044200396 8:89428390-89428412 CTGATGTTCATCAGGGATATTGG - Intergenic
1044235116 8:89821787-89821809 TTGATGTTCATCAGGGATATTGG + Intergenic
1044377791 8:91496780-91496802 CTGGTGTTCATCAGGGATGTTGG + Intergenic
1044484167 8:92730651-92730673 CTGTTGTTCATGAGACAAACAGG + Intergenic
1044546898 8:93470034-93470056 TTGATGTTCATCAGGGATATTGG - Intergenic
1044548593 8:93486939-93486961 TTGATGTTCATCAGGGATATTGG - Intergenic
1044784441 8:95779727-95779749 TTCTAGTTCATAAGGAATATGGG + Intergenic
1044812128 8:96074116-96074138 TTGATGTTCATTAGGGATATTGG - Intergenic
1044879574 8:96709809-96709831 TTAATGTTCATCAGGAATATTGG + Intronic
1045070829 8:98502831-98502853 TTGATGTTCATAAGGAATATTGG + Intronic
1045086241 8:98689442-98689464 CTTATGTTCATTAGGGATATTGG - Intronic
1045095604 8:98794727-98794749 CTTATGTTCATCAGGGATATTGG - Intronic
1045103919 8:98872270-98872292 TTGATGTTCATCAGGGATATTGG + Intronic
1045151450 8:99412986-99413008 TTGATGTTCATCAGGGATATTGG + Intronic
1045157225 8:99490328-99490350 TTGATGTTCATCAGGGATATTGG + Intronic
1045587148 8:103551163-103551185 TCGATGTTCATGAGGGATATTGG - Intronic
1045618422 8:103945502-103945524 TGTATGTTCATGAGGAATATTGG - Intronic
1045619268 8:103955314-103955336 TTGATGTTCATCAGGGATATTGG - Intronic
1045784032 8:105900743-105900765 TTGATGTTCATCAGGCATATTGG - Intergenic
1045794513 8:106027009-106027031 CTGATGTTCATCAGGGATATTGG - Intergenic
1045945653 8:107792737-107792759 TTGGTGTTCATCAGGGATATTGG - Intergenic
1045973729 8:108107862-108107884 TTGGTGTTCATCAGGGATATTGG - Intergenic
1045978660 8:108158449-108158471 TTGATGTTCATCAGGGATATTGG + Intergenic
1046047622 8:108983041-108983063 TTGATGTTCACCAGGAATATTGG + Intergenic
1046114918 8:109773358-109773380 TTGATGTTCATCAGGGATATTGG + Intergenic
1046192819 8:110821105-110821127 TCGATGTTCATCAGGAATATTGG - Intergenic
1046218578 8:111182112-111182134 TTGATGTTCATCAGGGATATTGG + Intergenic
1046338574 8:112823061-112823083 TTGATGTTCATCAGGGATATTGG + Intronic
1046608245 8:116394451-116394473 CTGATGTTCATCAGGGATATTGG - Intergenic
1046610120 8:116414024-116414046 TTGATGTTCATCAGGAATATTGG - Intergenic
1046840912 8:118856050-118856072 TTGATGTTCATCAGGGATATTGG - Intergenic
1046887195 8:119380371-119380393 TTGATGTTCATCAGGGATATTGG - Intergenic
1047699913 8:127438609-127438631 TCTATGTTCATGAGGAATATTGG - Intergenic
1048040703 8:130725331-130725353 ATGATGTTCATCAGGGATATTGG + Intergenic
1048098549 8:131321505-131321527 TTGATGTTCATCAGGGATATTGG + Intergenic
1048137145 8:131757529-131757551 CTGATGTTCATCATGAATAAAGG + Intergenic
1048180358 8:132188936-132188958 ATGTTGTTCATGAGGCCTAGGGG - Intronic
1048227185 8:132599488-132599510 CCGATGTTCATCAGGGATATTGG - Intronic
1048424440 8:134309938-134309960 TTGATGTTCATCAGGGATATTGG + Intergenic
1048463949 8:134647093-134647115 TTTTTGTTTATCAGGAATATTGG - Intronic
1048587358 8:135787261-135787283 TTGATGTTCATCAGGGATATTGG + Intergenic
1048606905 8:135978414-135978436 TTTATGTTCATCAGGAATATTGG + Intergenic
1048690982 8:136963088-136963110 TTGATGTTCATCAGGGATATTGG + Intergenic
1048713780 8:137244078-137244100 TTGATGTTCATCAGGGATATTGG - Intergenic
1048796712 8:138157010-138157032 TTGATGTTTATCAGGAATATTGG - Intronic
1049074725 8:140385881-140385903 TTGATGTTCATCAGGGATATTGG - Intronic
1049453240 8:142674009-142674031 CCGTTATTCATTAGGAAGATGGG - Intronic
1049453257 8:142674138-142674160 CCGTTATTCATTAGGAAGATGGG - Intronic
1049453266 8:142674202-142674224 CCGTTATTCATTAGGAAGATGGG - Intronic
1049453275 8:142674266-142674288 CCGTTATTCATTAGGAAGATGGG - Intronic
1049453292 8:142674396-142674418 CCGTTATTCATTAGGAAGATGGG - Intronic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1050198109 9:3109964-3109986 TTGATGTTCATCAGGGATATTGG - Intergenic
1050300142 9:4250046-4250068 TTGATGTTCATCAGGGATATTGG + Intronic
1050390881 9:5143117-5143139 CTGATGTTCATCAAGGATATAGG + Intronic
1050404822 9:5296736-5296758 TTGATGTTCATTAGGGATATTGG - Intergenic
1050477942 9:6060078-6060100 TTGATGTTCATCAGGGATATTGG + Intergenic
1050509576 9:6379984-6380006 TTGATGTTCATCAGGGATATTGG - Intergenic
1050603831 9:7280112-7280134 TTGATGTTCATCAGGGATATTGG + Intergenic
1050632638 9:7576846-7576868 CTGATGTTCATCAGGGATATTGG + Intergenic
1050956475 9:11667688-11667710 TTGATGTTCATCAGGGATATTGG + Intergenic
1050960269 9:11721103-11721125 TTGATGTTCATCAGGGATATTGG + Intergenic
1050982650 9:12039552-12039574 TTGATGTTCATCAGTAATATTGG - Intergenic
1051115913 9:13694238-13694260 CTGATGTTCATGAATGATATTGG + Intergenic
1051236840 9:15009641-15009663 ATGTTCTTCATAAGGAACATTGG + Intergenic
1051296069 9:15597572-15597594 TTGATGTTCATCAGGGATATTGG + Intronic
1051354268 9:16227016-16227038 CCGATGTTCATCAGGGATATTGG - Intronic
1051447059 9:17151587-17151609 TTGATGTTCATCAGGGATATTGG + Intronic
1051695470 9:19763739-19763761 TTGATGTTCATCAGGGATATTGG + Intronic
1051843552 9:21426038-21426060 TTGATGTTCATCAGGGATATTGG + Intronic
1051918249 9:22232999-22233021 CTAATGTTCATCAGGGATATTGG - Intergenic
1051940985 9:22505304-22505326 CTGATGTTCATCAGGGATACTGG + Intergenic
1051946465 9:22575168-22575190 CTGATGTTCATCAGGGTTATTGG - Intergenic
1052098386 9:24412154-24412176 TTGATGTTCATCAGGGATATTGG - Intergenic
1052232284 9:26167960-26167982 CCTATGTTCATGAGGGATATTGG + Intergenic
1052241723 9:26281120-26281142 TTGATGTTCATCAGGGATATTGG - Intergenic
1052329736 9:27255189-27255211 TTGATGTTCATCAGGGATATTGG - Intergenic
1052579659 9:30339098-30339120 TTGATGTTCATCAGGGATATTGG + Intergenic
1052627919 9:31001392-31001414 TTGATGTTCATCAGGGATATTGG + Intergenic
1053041342 9:34875800-34875822 CTGGTGCTCATGAGGCATGTGGG + Intergenic
1053491777 9:38512175-38512197 CTCTTGTTCTTGAAGAATATTGG - Intergenic
1053704356 9:40735017-40735039 TTGATGTTCATCAGGGATATTGG + Intergenic
1053847433 9:42253891-42253913 ATGATGTTCATCAGGGATATTGG - Intergenic
1054414440 9:64858627-64858649 TTGATGTTCATCAGGGATATTGG + Intergenic
1054880836 9:70142952-70142974 ATGTTGTTTAGGAGGAATAAAGG + Intronic
1054890313 9:70244009-70244031 TTGATGTTCATCAGGGATATTGG - Intergenic
1054942404 9:70757551-70757573 CTGATGTTCATCAGGGATATTGG - Intronic
1055014334 9:71599540-71599562 TTGATGTTCATCAGGTATATTGG - Intergenic
1055125361 9:72713201-72713223 TTGATGTTCATCAGGGATATTGG + Intronic
1055239617 9:74167661-74167683 TTGATGTTCATCAGGGATATTGG - Intergenic
1055244455 9:74222856-74222878 TTGATGTTCATCAGGGATATTGG - Intergenic
1055361982 9:75501385-75501407 CTATTGTTGATGGGGAATTTAGG + Intergenic
1055390612 9:75818177-75818199 TCGATGTTCATCAGGAATATTGG + Intergenic
1055616508 9:78078659-78078681 TTGATGTTCATCAGGGATATTGG - Intergenic
1055895169 9:81166146-81166168 TTGATGTTCATCAAGAATATTGG - Intergenic
1056978409 9:91283026-91283048 CCGATGTTCATCAGGGATATTGG - Intronic
1056996798 9:91469958-91469980 TTGATGTTCATCAGGGATATTGG + Intergenic
1057017996 9:91670969-91670991 TTGATGTTCATCAGGGATATTGG + Intronic
1057672074 9:97101377-97101399 CTCTTGTTCTTGAAGAATATTGG - Intergenic
1057697659 9:97337590-97337612 TTGATGTTCATCAGGGATATTGG + Intronic
1057712129 9:97455388-97455410 TTGATGTTCATCAGGGATATTGG - Intronic
1058034228 9:100233797-100233819 TTGATGTTCATCAGGGATATTGG + Intronic
1058090368 9:100799244-100799266 TTGATGTTCATCAGGGATATTGG - Intergenic
1058101562 9:100923043-100923065 TTGATGTTCATGAAGGATATTGG - Intergenic
1058122457 9:101154137-101154159 TTGATGTTCATCAGGGATATTGG + Intronic
1058202692 9:102063970-102063992 TTGATGTTCATCAGGGATATTGG + Intergenic
1058229518 9:102408567-102408589 GGGTTGTTCATCAGGGATATGGG + Intergenic
1058266329 9:102903447-102903469 TTGATGTTCATCAGGGATATTGG - Intergenic
1058353477 9:104054957-104054979 TTGATGTTCATCAGGGATATTGG - Intergenic
1058479173 9:105373274-105373296 CTTTTGGTCCTGAGGAATTTGGG - Intronic
1058586959 9:106518625-106518647 TCTTTATTCATGAGGAATATTGG - Intergenic
1058595270 9:106608676-106608698 CTGATGTTCATCAGGGTTATTGG - Intergenic
1058819578 9:108717167-108717189 TTGATGTTCATCAGGGATATTGG - Intergenic
1059124941 9:111675439-111675461 ATGTTGAACATGGGGAATATGGG - Intergenic
1059594323 9:115701089-115701111 CTTGTGTTCATGAAGAATGTTGG - Intergenic
1059954932 9:119505887-119505909 CTGATGTTCATCAGGGATATTGG - Intronic
1060112275 9:120914710-120914732 CTGAAGTTCATGGGGAATCTTGG + Intronic
1203517858 Un_GL000213v1:20017-20039 CTGATGTTCATCAGGGATATTGG + Intergenic
1203532440 Un_GL000213v1:159077-159099 CTGATGTTCATCAGGGATATTGG + Intergenic
1203713504 Un_KI270742v1:120635-120657 TTGATGTTCATCAGGGATATTGG + Intergenic
1185766488 X:2729841-2729863 CTTTTGTTCTTGAAGAATCTAGG - Intronic
1186084907 X:5976966-5976988 CTCATGAGCATGAGGAATATTGG + Intronic
1186237241 X:7526837-7526859 TTGATGTTCATCAGGGATATTGG - Intergenic
1186665646 X:11714185-11714207 CTGTTGTTCAGGAGGAGAGTTGG + Intergenic
1186678228 X:11843227-11843249 TCTATGTTCATGAGGAATATTGG + Intergenic
1186755303 X:12664630-12664652 TTGATGTTCATCAGGGATATTGG + Intronic
1186765288 X:12764274-12764296 TTGATGTTCATCAGGGATATTGG - Intergenic
1186772920 X:12835457-12835479 TTGATGTTCATCAGGGATATTGG + Intergenic
1186774507 X:12851217-12851239 TTGATGTTCATCAGGGATATTGG + Intergenic
1186919661 X:14264149-14264171 TTGATGTTCATCAGGGATATTGG + Intergenic
1186964100 X:14769086-14769108 CTGATGTTCATCAAGGATATTGG + Intergenic
1187596138 X:20774878-20774900 TTGATGTTCATCAGGGATATTGG - Intergenic
1187635266 X:21221044-21221066 CTGATGTTCATCAGGGATATTGG + Intergenic
1187729896 X:22241991-22242013 TTGATGTTCATCAGGGATATTGG - Intronic
1188119192 X:26283727-26283749 CTGATGTTCATCAGGGATATTGG + Intergenic
1188560887 X:31467592-31467614 TTGATGTTCATCAGGGATATTGG + Intronic
1188703155 X:33290971-33290993 TTGATGTTCATCAGGGATATTGG - Intronic
1188711513 X:33406271-33406293 TTGATGTTCATCAGGGATATTGG - Intergenic
1188772347 X:34167993-34168015 TCGATGTTCATCAGGAATATTGG - Intergenic
1189209597 X:39273531-39273553 TTGATGTTCATCAGGGATATTGG + Intergenic
1189291997 X:39893294-39893316 GGTTTGGTCATGAGGAATATTGG - Intergenic
1189575317 X:42345383-42345405 CCTATGTTCATGAGGGATATTGG + Intergenic
1189934605 X:46054463-46054485 TTGATGTTCATCAGGGATATTGG + Intergenic
1190363255 X:49668471-49668493 CATTTGTTCATCAGGATTATTGG + Intergenic
1190467261 X:50737892-50737914 TTGATGTTCATCAGGGATATTGG - Intronic
1190476717 X:50835450-50835472 CTGTTGTTCTTAAAGAATCTGGG + Intergenic
1190965444 X:55295994-55296016 TTGATGTTCATCAGGGATATTGG + Intergenic
1190965802 X:55300078-55300100 TTGATGTTCATCAGGGATATTGG + Intergenic
1190994060 X:55587324-55587346 CCCTTGTTCATCAGGGATATTGG - Intergenic
1191003979 X:55690598-55690620 CTGATGTTCATCAAGGATATTGG - Intergenic
1191097137 X:56685433-56685455 TTGATGTTCATCAGGGATATTGG + Intergenic
1191156281 X:57277139-57277161 ATGATGTTCATCAGGAATATTGG - Intergenic
1191160531 X:57325266-57325288 TTGATGTTCATCAGGGATATTGG + Intronic
1191186393 X:57617442-57617464 CTGATGTTCATCAGGGATATTGG - Intergenic
1191710231 X:64142211-64142233 TTGATGTTCATCAGGAATATTGG - Intergenic
1191738533 X:64412941-64412963 CTGATGTTCATCAGGGATATTGG + Intergenic
1191771264 X:64761428-64761450 CTGATGTTCTTCAGGGATATTGG + Intergenic
1191794334 X:65004295-65004317 TTGATGTTCATCAGGGATATTGG - Intronic
1191796012 X:65022239-65022261 TTGATGTTCATCAGGGATATTGG - Intronic
1191804003 X:65114184-65114206 ATTTTGTTCATGAGGGATATTGG + Intergenic
1191893139 X:65965231-65965253 TTGATGTTCATCAGGGATATTGG - Intergenic
1191907060 X:66104729-66104751 TTGATGTTCATCAGGGATATTGG + Intergenic
1191908653 X:66123641-66123663 TTGATGTTCATCAGGGATATTGG + Intergenic
1191928392 X:66341083-66341105 TCGATGTTCATCAGGAATATTGG + Intergenic
1191962826 X:66722307-66722329 TTGATGTTCATCAGGGATATTGG - Intergenic
1192000670 X:67147460-67147482 TTGATGTTCATCAGGGATATTGG + Intergenic
1192018877 X:67362714-67362736 TCAATGTTCATGAGGAATATTGG - Intergenic
1192020913 X:67389924-67389946 CTGATGTTCATCAGGGATTTTGG - Intergenic
1192031341 X:67516051-67516073 TGGATGTTCATGAGGAATACCGG - Intergenic
1192042733 X:67640247-67640269 CTGATGTTCATCAGGGTTATTGG + Intronic
1192063889 X:67860841-67860863 TTGATGTTCATCAGGAATATTGG + Intergenic
1192073417 X:67964839-67964861 CTGATATTCATCAGGGATATTGG - Intergenic
1192097529 X:68228475-68228497 TTGATGTTCATCAGGGATATTGG - Intronic
1192228758 X:69248767-69248789 CTGATGTTCATCAGGGATATTGG - Intergenic
1192346602 X:70314029-70314051 GTGTGGCTAATGAGGAATATAGG + Intronic
1192389706 X:70713218-70713240 TCGATGTTCATCAGGAATATTGG + Intronic
1192404106 X:70866609-70866631 TTGATGTTCATCAGGGATATTGG - Intronic
1192525542 X:71840352-71840374 TTGATGTTCATCAGGGATATTGG + Intergenic
1192613240 X:72589141-72589163 TTGATGTTCATCAGGGATATTGG - Intronic
1192628236 X:72752576-72752598 CAGATGTTCATCAGGGATATTGG + Intergenic
1192653472 X:72968232-72968254 CAGATGTTCATCAGGGATATTGG - Intergenic
1192675210 X:73188554-73188576 TTGATGTTCATCAGGGATATTGG - Intergenic
1192685637 X:73302058-73302080 TTGATGTTCATCAGGGATATTGG + Intergenic
1192701444 X:73478736-73478758 TTGGTGTTCATCAGGAATATTGG + Intergenic
1192714210 X:73622123-73622145 TTGATGTTCATCAGGGATATTGG + Intronic
1192716766 X:73650902-73650924 TTGATGTTCATCAGGAATATCGG - Intronic
1192755494 X:74043009-74043031 TTGATGTTCATCAGGGATATTGG + Intergenic
1192758862 X:74074420-74074442 TTGCTGTTCATCAGGGATATTGG + Intergenic
1192825303 X:74689761-74689783 TTGATGTTCATCAAGAATATTGG + Intergenic
1192841683 X:74863825-74863847 TTGCTGTTCATGAGAGATATTGG - Intronic
1192934560 X:75845853-75845875 TTGATGTTCATCAGGGATATTGG - Intergenic
1192966193 X:76179717-76179739 TTGATGTTCTTCAGGAATATTGG + Intergenic
1192982535 X:76361475-76361497 CTGATGTTCATCAGGGATATTGG + Intergenic
1192995698 X:76510601-76510623 TTTATGTTCATCAGGAATATTGG - Intergenic
1193010848 X:76673341-76673363 TCGTTGTTCATCAGGAATATTGG - Intergenic
1193035021 X:76940213-76940235 TTGATGTTCATCAGGGATATTGG - Intergenic
1193036178 X:76953870-76953892 TTGATGTTCATCAGGTATATTGG - Intergenic
1193059313 X:77188165-77188187 TTGATGTTCATCTGGAATATTGG - Intergenic
1193065910 X:77259810-77259832 TTGATGTTCATCAGGGATATTGG - Intergenic
1193067064 X:77271679-77271701 TTGATGTTCATCAGGGATATTGG - Intergenic
1193079685 X:77393907-77393929 TTGATGTTCATCAGGGATATTGG - Intergenic
1193089027 X:77474329-77474351 TTGATGTTCATCAGGGATATTGG - Intergenic
1193174013 X:78370758-78370780 TTGATGTTCATCAGGGATATTGG + Intergenic
1193189460 X:78552363-78552385 TTGATGTTCATCAGGGATATTGG - Intergenic
1193233341 X:79075278-79075300 TTGATGTTCTTGAGGGATATTGG - Intergenic
1193267198 X:79485791-79485813 TTGATGTTCATCAGGGATATTGG - Intergenic
1193351163 X:80466276-80466298 CTGATGTTCATCAGGGATATTGG - Intergenic
1193363034 X:80598419-80598441 CCGATGTTCATCAGGGATATTGG + Intergenic
1193400587 X:81037268-81037290 TTGATGTTCATCAGGAATATTGG - Intergenic
1193479081 X:82004657-82004679 TCGATGTTCATCAGGAATATTGG + Intergenic
1193516696 X:82474516-82474538 TTGATGTTCATCAGGGATATTGG + Intergenic
1193547889 X:82852063-82852085 TTGATGTTCATCAGGGATATTGG + Intergenic
1193594619 X:83431294-83431316 TTGATGTTCATCAGGGATATTGG + Intergenic
1193641291 X:84012561-84012583 TTGATGTTCATCAGGGATATTGG - Intergenic
1193704606 X:84805892-84805914 ATGATGTTTATCAGGAATATTGG - Intergenic
1193727844 X:85063792-85063814 TCGATGTTCATCAGGAATATTGG + Intronic
1193729003 X:85079517-85079539 TCGATGTTCATCAGGAATATTGG + Intronic
1193771845 X:85597144-85597166 CTTATGTTCATCAGGGATATTGG - Intergenic
1193784455 X:85742607-85742629 TCGTTGTTCATGAGGGATATTGG - Intergenic
1193822530 X:86183602-86183624 TTGGTGTTCATCAGGGATATTGG + Intronic
1193830271 X:86281214-86281236 CTGATGTTCATCAGGGATATTGG - Intronic
1193991963 X:88319305-88319327 TCGATGTTCATCAGGAATATTGG + Intergenic
1194040480 X:88936131-88936153 TTGATGTTCATCAGGAATATTGG + Intergenic
1194098928 X:89677838-89677860 TTGATGTTCATCAGGGATATTGG - Intergenic
1194103359 X:89735319-89735341 ATCATGTTCATCAGGAATATTGG + Intergenic
1194170255 X:90572180-90572202 TTGATGTTCATCAGGGATATTGG - Intergenic
1194208177 X:91036561-91036583 TTGATGTTCATCAGGGATATTGG + Intergenic
1194259494 X:91676277-91676299 TTGATGTTCATCAGGGATATTGG + Intergenic
1194358236 X:92915670-92915692 TTGATGTTCATTAGGGATATTGG - Intergenic
1194420253 X:93664172-93664194 TTGGTGTTCATCAGGGATATTGG - Intergenic
1194514030 X:94827724-94827746 TTGATGTTCATCAGGGATATTGG - Intergenic
1194576001 X:95615357-95615379 TCGATGTTCATCAGGAATATTGG + Intergenic
1194625117 X:96218236-96218258 TTGATGTTCATCAGGGATATTGG - Intergenic
1194708485 X:97203886-97203908 TTGATGTTCATTAGGGATATTGG - Intronic
1194772186 X:97919250-97919272 TTGATGTTCATCAGGGATATTGG - Intergenic
1194782797 X:98045778-98045800 TTGATGTTCATCAGGGATATTGG + Intergenic
1194801132 X:98274571-98274593 CTAATGTTCATCAGGGATATTGG - Intergenic
1194905337 X:99568957-99568979 TTGATGTTCATCAGGGATATTGG + Intergenic
1194911161 X:99646337-99646359 TTGATGTTCATCAGGGATATTGG + Intergenic
1195144966 X:102004130-102004152 ATGTTGTTCATCAAGAATATTGG - Intergenic
1195213864 X:102677170-102677192 TTGATGTTCATAAGGGATATTGG + Intergenic
1195368079 X:104146021-104146043 TTGATGTTCATCAGGGATATTGG - Intronic
1195579882 X:106489556-106489578 CTGATGTTCATCAGGGATATTGG + Intergenic
1195586910 X:106575569-106575591 TTGATGTTCATCAGGGATATTGG + Intergenic
1195733372 X:107988505-107988527 TTGATGTTCATCAGGGATATTGG + Intergenic
1195832542 X:109075216-109075238 TCGTTGTTCATCAGGGATATTGG + Intergenic
1195933261 X:110100952-110100974 CTGTTGTTCATGAGGAATATTGG + Intronic
1196013170 X:110909888-110909910 TTGATGTTCATCAGGGATATGGG - Intergenic
1196040663 X:111199854-111199876 CTGTTGATCATGAGGAGGAAAGG + Intronic
1196094857 X:111788127-111788149 TTGATGTTCATCAGGGATATTGG - Intronic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1196167157 X:112548231-112548253 TTGATGTTCATGAGGGATATTGG + Intergenic
1196203869 X:112916809-112916831 TTGATGTTCATCAGGAATATTGG + Intergenic
1196252911 X:113482959-113482981 TTGATGTTCATCAGGGATATTGG - Intergenic
1196284133 X:113860182-113860204 CTGATGTTCATCAAGGATATTGG + Intergenic
1196314471 X:114206656-114206678 ACTTTGTACATGAGGAATATTGG - Intergenic
1196474441 X:116066323-116066345 TTGATGTTCATCAGGGATATTGG + Intergenic
1196516144 X:116614503-116614525 TTGATGTTCATCAGGGATATTGG - Intergenic
1196561567 X:117155396-117155418 TTGATGTTCATCAGAAATATTGG - Intergenic
1196585467 X:117422535-117422557 TTGATGTTCATCAGGGATATTGG + Intergenic
1196966350 X:121060001-121060023 TTTGTGTTCATGAGGGATATTGG + Intergenic
1197061982 X:122192047-122192069 CTGATGTTCATCAGGGATATTGG + Intergenic
1197239357 X:124106830-124106852 TTGATGTTCATCAGGGATATGGG + Intronic
1197357062 X:125448161-125448183 TTGATGTTCATCAGGGATATCGG - Intergenic
1197413526 X:126147363-126147385 TTGATGTTCATCAGGGATATTGG + Intergenic
1197478315 X:126950438-126950460 TTGATGTTCATCAGGGATATTGG - Intergenic
1197516263 X:127433678-127433700 TTAATGTTCATCAGGAATATTGG + Intergenic
1197625204 X:128794290-128794312 TTGATGTTCATCAGGGATATTGG - Intergenic
1197684262 X:129422048-129422070 CTGATGTTCATCAGGGATATTGG + Intergenic
1197906606 X:131431970-131431992 TTGATGTTCATCAGGGATATTGG - Intergenic
1198477143 X:137006210-137006232 TCGATGTTCATCAGGAATATTGG - Intergenic
1198489633 X:137126124-137126146 TTGATGTTCATCAGGGATATTGG - Intergenic
1198556206 X:137796012-137796034 TTGATGTTCATCAGGGATATTGG - Intergenic
1198621583 X:138517807-138517829 TTGATGTTCATCAGGGATATTGG - Intergenic
1198689338 X:139263234-139263256 TTGATGTTCATCAGGGATATTGG - Intergenic
1198713130 X:139527250-139527272 TTGATGTTCATCAGGGATATTGG - Intergenic
1198785990 X:140288662-140288684 TTGATGTTCATCAGGGATATTGG + Intergenic
1198796352 X:140400248-140400270 TTGATGTTCATCAGGGATATTGG - Intergenic
1198955200 X:142121566-142121588 TTGATGTTCATCAGGGATATTGG + Intergenic
1199244520 X:145587465-145587487 TTTATGTTCATCAGGAATATTGG - Intergenic
1199292676 X:146122582-146122604 TTGATGTTCATCAGGGATATTGG - Intergenic
1199384093 X:147204001-147204023 TTGATGTTCATCAGGGATATTGG - Intergenic
1199477204 X:148258951-148258973 TTGATGTTCATCAGGGATATTGG + Intergenic
1199589042 X:149448896-149448918 GTGATGTTCATCAAGAATATTGG + Intergenic
1199662740 X:150068536-150068558 TTGATGTTCATTAGGGATATTGG + Intergenic
1199787965 X:151122347-151122369 TTGATGTTCATAAGGAATATTGG - Intergenic
1199789913 X:151143318-151143340 TTGATGTTCATCAGGGATATTGG + Intergenic
1199801562 X:151256428-151256450 TTGATGTTCATCAGGGATATTGG - Intergenic
1199820927 X:151445030-151445052 TTTTTGTTTATGAGGGATATTGG + Intergenic
1199825989 X:151499966-151499988 TTTATGTTCATGAGGAATACTGG - Intergenic
1199901916 X:152182989-152183011 ATTTTGTTCATCAGGGATATTGG + Intronic
1200451948 Y:3339217-3339239 TTGATGTTCATCAGGGATATTGG - Intergenic
1200516502 Y:4149946-4149968 TTGATGTTCATCAGGGATATTGG - Intergenic
1200578194 Y:4915470-4915492 TTGATGTTCATCAGGGATATTGG + Intergenic
1200666412 Y:6031327-6031349 TTGATGTTCATTAGGGATATTGG - Intergenic
1200842148 Y:7793365-7793387 CTAATTTTCATAAGGAATATAGG - Intergenic
1200955912 Y:8945471-8945493 TTGATGTTCATCAGGGATATTGG + Intergenic
1201419174 Y:13779279-13779301 CTGATGTTCATCAGGGATATTGG + Intergenic
1201421950 Y:13809147-13809169 TTGATGTTCATCAGGGATATTGG + Intergenic
1201493022 Y:14563468-14563490 TTGATGTTCATCAGGGATATTGG + Intronic
1201529229 Y:14973595-14973617 TTGATGTTCATCAGGGATATTGG + Intergenic
1201537360 Y:15065522-15065544 CTGATGTTCATCAGGGATATTGG + Intergenic
1201626519 Y:16020858-16020880 TTGATGTTCATCAGGGATATTGG + Intergenic
1201670264 Y:16512329-16512351 TTGATGTTCATCAGGGATATTGG + Intergenic
1201705484 Y:16932060-16932082 TTGATGTTCATCAGGGATATTGG - Intergenic
1201923320 Y:19258115-19258137 TTGATGTTCATCAGGGATATTGG - Intergenic
1201939022 Y:19438726-19438748 TTGATGTTCATCAGGGATATTGG - Intergenic
1201960018 Y:19669777-19669799 CTAATGTTCATCAGGGATATTGG - Intergenic
1202091988 Y:21200941-21200963 ATGATGTTCATCAGGGATATTGG + Intergenic
1202094781 Y:21237946-21237968 TTGGTGTTCATCAGGTATATTGG + Intergenic
1202256234 Y:22923485-22923507 TTGATGTTCATCAGGGATATTGG - Intergenic
1202409225 Y:24557238-24557260 TTGATGTTCATCAGGGATATTGG - Intergenic
1202461557 Y:25112840-25112862 TTGATGTTCATCAGGGATATTGG + Intergenic