ID: 1195934469

View in Genome Browser
Species Human (GRCh38)
Location X:110111758-110111780
Sequence TTGTAGAAGCATGAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195934467_1195934469 25 Left 1195934467 X:110111710-110111732 CCTTCTTCTTGCAAAGCCATTGA 0: 1
1: 0
2: 2
3: 19
4: 191
Right 1195934469 X:110111758-110111780 TTGTAGAAGCATGAGAATGAAGG 0: 1
1: 0
2: 4
3: 19
4: 229
1195934468_1195934469 9 Left 1195934468 X:110111726-110111748 CCATTGAACATAAACAGAAATTT 0: 1
1: 0
2: 1
3: 56
4: 680
Right 1195934469 X:110111758-110111780 TTGTAGAAGCATGAGAATGAAGG 0: 1
1: 0
2: 4
3: 19
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195934469 Original CRISPR TTGTAGAAGCATGAGAATGA AGG Intronic
900307260 1:2016922-2016944 TTGCAGAAACCTGTGAATGATGG + Intergenic
900873146 1:5319940-5319962 TTGTAGCAGCATGAAAAGCATGG - Intergenic
906948818 1:50317965-50317987 TTCTAGAAGCAAGTGAGTGAGGG - Intergenic
907472209 1:54681153-54681175 TTGTGTGAGCCTGAGAATGAGGG + Intronic
908125359 1:61024962-61024984 TCATAGAAGCAGAAGAATGATGG + Intronic
908153030 1:61324171-61324193 CTTTAGAAGGATGAGAATGTAGG + Intronic
910762972 1:90753282-90753304 TTTTAGAAGCAGGAGATTGGTGG - Intergenic
912122272 1:106486297-106486319 TTGTATAAGCATGACAAAGTAGG - Intergenic
912139883 1:106711226-106711248 TGGTAGAAGAATGATAATTAAGG + Intergenic
912498622 1:110107257-110107279 TGGGAGAAGCAGGAGCATGAAGG - Intergenic
915107397 1:153542999-153543021 TTGCAGCAGCATGAGAATATAGG - Intergenic
916350200 1:163840751-163840773 TTTTAGAAGCATGATCATTAGGG - Intergenic
916979107 1:170114098-170114120 CTATAAAAGCATGAGAATCATGG - Intergenic
921020008 1:211226669-211226691 ATCTAGTAGAATGAGAATGAGGG + Intergenic
921538452 1:216382380-216382402 TTGTAGCAACATAAGAAAGATGG + Intronic
921592135 1:217016517-217016539 TAGTAGAAGTTGGAGAATGAAGG - Intronic
924764839 1:247022713-247022735 TTTTAGGAGCATGAGAACTATGG + Intergenic
1063793078 10:9477827-9477849 CTCTAGAAGCTTGAGAATCAAGG - Intergenic
1064507790 10:16052060-16052082 TTGTAAATTCATGAGAATTAAGG - Intergenic
1064601091 10:16993848-16993870 TTGTATGATCATGAGAAAGAGGG + Intronic
1065415013 10:25474846-25474868 TTGTGGAAGACTAAGAATGAGGG + Intronic
1065484438 10:26223463-26223485 TTCTAGCAGCATGAGTATAAAGG + Intronic
1065757459 10:28946088-28946110 GTGTAGAAGCATTTTAATGATGG + Intergenic
1066262186 10:33739637-33739659 TAGTAGAGGCATGGGAATGTGGG + Intergenic
1067052326 10:43029040-43029062 TTGCAGGAGCATGGGTATGAAGG + Intergenic
1067724663 10:48761017-48761039 AGGTAGAAGAATGAGAATGGAGG + Intronic
1069098234 10:64286572-64286594 TTGATGAAGCAGGAGAAAGAGGG - Intergenic
1069210262 10:65749175-65749197 TTGTAGAAGCCAGAGAAAGATGG + Intergenic
1071368336 10:84924303-84924325 TTGTGGAATCATAAGAATGATGG + Intergenic
1071848364 10:89542875-89542897 GTTGAGAAGCATGATAATGAAGG - Intronic
1072820886 10:98556315-98556337 TTGCAGAAGTATGTGAATGGGGG - Intronic
1073599080 10:104829378-104829400 ATCTGGAAGCATGAGAAGGAAGG + Intronic
1073732042 10:106300513-106300535 TTGCAAAGGAATGAGAATGATGG - Intergenic
1073965191 10:108980738-108980760 TTGTAAAAAAATGATAATGAAGG + Intergenic
1074820949 10:117177978-117178000 AAGTGGAAGCAAGAGAATGACGG + Intergenic
1075601376 10:123771987-123772009 TCATAGCAGCATGAGAATGAAGG + Intronic
1075968430 10:126632615-126632637 TTGTAGAAGCATGGCAATAGGGG + Intronic
1081285751 11:41267968-41267990 CTGAAGTAGCATTAGAATGATGG - Intronic
1082839691 11:57678898-57678920 TAGTACAAACATGAGAATGAAGG - Intronic
1085637621 11:78170567-78170589 TGGCAAAAGCATGAGAAAGACGG - Intergenic
1086089389 11:82990328-82990350 TGGTAGAAACATTTGAATGATGG + Intronic
1090132543 11:124159792-124159814 TTGTAGATGCATAAAAATGAGGG - Intergenic
1090445590 11:126762072-126762094 ATGTTGAGGCATGAGAATCACGG + Intronic
1090938277 11:131364773-131364795 TTGTAGATTCATTAAAATGAAGG - Intergenic
1091541880 12:1469682-1469704 GTGAAGAAGGGTGAGAATGAGGG - Intronic
1092445131 12:8548561-8548583 ATGTAGAAGGATGACAAAGATGG - Intergenic
1095550885 12:43438256-43438278 TTTCAGAAACAGGAGAATGAAGG - Intronic
1096851675 12:54442898-54442920 CCGGAGAAGCAAGAGAATGAAGG + Intergenic
1101321925 12:103680193-103680215 TTGGAGAAGGATGGTAATGATGG + Intronic
1102614541 12:114141979-114142001 TCCAAGAAGCATGAGAATGAAGG - Intergenic
1105646398 13:22322537-22322559 TTGTTGAAGTCTGAAAATGAAGG - Intergenic
1106054580 13:26226510-26226532 TGGTAAAAGCATGATAATCAGGG - Intergenic
1106907946 13:34428643-34428665 TTGTAGAATCATCAAAATGGGGG + Intergenic
1107985581 13:45773378-45773400 ATGTAGAAACATGAGATTCATGG - Intergenic
1108499455 13:51056297-51056319 TTGCAGATGCCTGAGAAAGAGGG - Intergenic
1109853080 13:68092734-68092756 TTGTGGCAGCAGAAGAATGAAGG + Intergenic
1110544007 13:76736551-76736573 TTGCCCAAGCCTGAGAATGAGGG - Intergenic
1112616716 13:101014152-101014174 TTGTAAATGCTTGGGAATGATGG - Intergenic
1113303701 13:109052620-109052642 ATGTATAACCATCAGAATGAAGG + Intronic
1113781768 13:112981284-112981306 TTGTGGGAGCAGGAGAATGCAGG + Intronic
1114637600 14:24196669-24196691 TTGTAGAAGCAGGTAAATTAAGG - Intronic
1114787927 14:25622349-25622371 TTGTGGAAGCCAGAGAGTGATGG - Intergenic
1115922412 14:38390817-38390839 TCATAGAAACATAAGAATGAAGG + Intergenic
1117129242 14:52668032-52668054 TTCTAGAAGCAGTACAATGACGG + Intronic
1117224697 14:53643421-53643443 ATGAAAAAGCATGAAAATGAAGG - Intergenic
1117408823 14:55431117-55431139 TTGTAACAGCAAGAGTATGAGGG - Intronic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1118789596 14:69077831-69077853 TTGTAGGAACATGAGAAAAAAGG + Intronic
1119562965 14:75605603-75605625 TTGTAGAAGCGTGAGACAGGAGG + Intronic
1120634371 14:86932919-86932941 TAGTAGAATCATTAGAAGGAAGG + Intergenic
1121841695 14:97139718-97139740 TAGTAGTGGCATGAGAATCAGGG + Intergenic
1122071282 14:99207186-99207208 TAATAGAAGCATTAAAATGATGG - Intronic
1124207761 15:27737344-27737366 TAGTACAATCTTGAGAATGAAGG + Intergenic
1125068838 15:35527215-35527237 TTCTGGAAGCTAGAGAATGAAGG + Intronic
1126463703 15:48940621-48940643 TAGTAGCAGCATCAGTATGATGG + Intronic
1128118111 15:65125158-65125180 TTACACAAGCATGAAAATGAAGG - Intronic
1130920035 15:88336058-88336080 ATGTGGACGCATGAGGATGAGGG + Intergenic
1132057821 15:98665474-98665496 TTGAAGAAGGAAGAGACTGAAGG - Intronic
1132418151 15:101639422-101639444 TTGAAAAAGCCTGAAAATGAAGG - Intronic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1139046326 16:63064338-63064360 TTGCAGCAGCCTAAGAATGAAGG - Intergenic
1140995929 16:80259545-80259567 GTGTAGAAGCAAGAGAATAGGGG + Intergenic
1143325323 17:6094761-6094783 TGGCAGAAGCAAGAGAAGGAAGG + Intronic
1143641065 17:8197827-8197849 TTGAACCAGCATGAGAGTGATGG + Intergenic
1144035587 17:11362473-11362495 TGGTAGAAGCATCAGAAAGCAGG - Intronic
1144461259 17:15460355-15460377 TTGTAGAATAAAGAGAACGAAGG - Intronic
1146298607 17:31671104-31671126 TTGTAGCAGAAAGAGAATGATGG - Intergenic
1146736046 17:35240225-35240247 CTCTAGAAGCTTGAGAATGTGGG + Intergenic
1147005550 17:37400551-37400573 TTGTAGAAGTAGCAGAATGGTGG - Intronic
1149434884 17:56625142-56625164 TTCCATAAGCCTGAGAATGAGGG - Intergenic
1151005067 17:70425955-70425977 TTGTAAAAGCATGTTAATGTTGG + Intergenic
1154479917 18:14810340-14810362 ATTTAGAAGCATAAGAATTAGGG + Intronic
1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG + Intergenic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1166914253 19:46183895-46183917 TTAGAGAAGCATGGGAGTGATGG - Intergenic
929904336 2:46033059-46033081 ATGTAGAAGCATGAGTTGGATGG + Intronic
930215608 2:48693278-48693300 TTTCAGAACCATGAGAATGAAGG - Intronic
930307926 2:49699853-49699875 TTGGAGAAGCCTAAGAAGGATGG - Intergenic
930308620 2:49709221-49709243 ATTTAGCAGCATGAAAATGATGG - Intergenic
930414946 2:51079026-51079048 TTGAAGAATCAAGGGAATGAAGG + Intergenic
930564016 2:52996869-52996891 TAGTAGAAGGAAGAGAAGGAAGG + Intergenic
933140833 2:78791780-78791802 TTTTAGATTCATGAGAAAGATGG - Intergenic
933597990 2:84301957-84301979 ATGCTGGAGCATGAGAATGAAGG - Intergenic
935654741 2:105412488-105412510 TTGTAGAAGGATGAGATTCAGGG + Intronic
937099132 2:119255114-119255136 TTCTAGAAGCTTGAGAATGGTGG - Intronic
937670552 2:124533267-124533289 TTGCAGAAACCTGAGAGTGAGGG + Intronic
938035210 2:128029012-128029034 CTTTAGAAGTTTGAGAATGAAGG - Intergenic
938639916 2:133267078-133267100 TTGGAGAAGCTGGAGAGTGAGGG + Intronic
938673500 2:133607000-133607022 CTGTGGGAGCTTGAGAATGAAGG + Intergenic
939839287 2:147167963-147167985 TTGAAGAATCAAGAGAATAAGGG - Intergenic
940456090 2:153902596-153902618 TTGTAGAGGGATAAGAATGAAGG + Intronic
942362134 2:175183329-175183351 TTATAGAAAGAGGAGAATGAAGG + Exonic
944339628 2:198580812-198580834 TGGAAGAGGCATGAGAATAAAGG + Intergenic
947281455 2:228460286-228460308 TTGCTGAAGCATGAGCATGTAGG - Intergenic
948334594 2:237197570-237197592 ATGTAGATTCATGAGCATGAGGG + Intergenic
1169347261 20:4838658-4838680 TTTTAGAAGCTTCAGAGTGATGG + Intergenic
1169621609 20:7513310-7513332 TTGTAGAAGAATGATAGTGTTGG + Intergenic
1169935564 20:10879847-10879869 ATTTAGAATCATGAGAAGGAAGG - Intergenic
1173010440 20:39176918-39176940 TTGCACAAGCCTGAGAGTGAAGG - Intergenic
1174561576 20:51434272-51434294 TTCTAGAAGCATTATACTGAGGG - Intronic
1174969769 20:55261832-55261854 TTGCAGCAGCATGGGAAAGAAGG + Intergenic
1175336965 20:58202901-58202923 TTGTGGATGGATGACAATGATGG + Intergenic
1176800622 21:13425964-13425986 ATTTAGAAGCATAAGAATTAGGG - Intergenic
1177592509 21:23189208-23189230 TTGGAGATGGAGGAGAATGATGG + Intergenic
1180324387 22:11355928-11355950 TTGGAGAACCACGAGAAAGAAGG + Intergenic
1182918105 22:34054081-34054103 TTGTGAGAGAATGAGAATGAGGG - Intergenic
1183609279 22:38887030-38887052 TATTAGAAGACTGAGAATGACGG + Intergenic
1184221689 22:43104826-43104848 TTGCAGAGGCAAGAGACTGAAGG - Intergenic
1184325962 22:43785452-43785474 TTTTAGATGGATGAAAATGAAGG + Intronic
950087553 3:10271064-10271086 TTGTTGAAGCCTGACAATAAGGG + Intronic
951866868 3:27318213-27318235 TTGTAGGAGGATGAGAAAAAAGG + Intronic
952109219 3:30103606-30103628 TTGTTGAAGGATGAAGATGAAGG + Intergenic
953060179 3:39421349-39421371 TTGTAGATTCATGAGAATTTCGG - Intergenic
953408986 3:42678300-42678322 TTGTTGAAGCATTATTATGATGG + Intergenic
953801196 3:46023954-46023976 TTGTAGAAACGTCAGAATTACGG + Intronic
955145510 3:56314407-56314429 TAGTAGGAGCTTGAAAATGATGG - Intronic
956283640 3:67585616-67585638 TGGGAGAAGCATCAGCATGATGG - Intronic
957274435 3:78072938-78072960 ATGTAGATGAATCAGAATGATGG - Intergenic
958061689 3:88491587-88491609 TTGTAGAGACAGGAGAAAGAAGG - Intergenic
959139877 3:102472867-102472889 TATTAGCAGCATGAGAATGGAGG - Intronic
962300005 3:134231512-134231534 TTTTAGAAGCCTGAGAAAGTTGG - Intronic
962419590 3:135216254-135216276 ATGTAGCAGCATCAGAATGAGGG - Intronic
963865897 3:150361044-150361066 TTCTAGGAGCATGAGAGAGATGG + Intergenic
963989512 3:151637008-151637030 TTGCTGAAACTTGAGAATGATGG + Intergenic
966238307 3:177727253-177727275 TTGTAGCAGTCTGAGAAAGAGGG - Intergenic
966542591 3:181108366-181108388 GTGTGCAAGTATGAGAATGAAGG - Intergenic
967254775 3:187578769-187578791 TTGAAGAAGCGAGAGAATAAAGG - Intergenic
969070445 4:4533883-4533905 TTGTAGAAGCATGATTCTCAGGG - Intronic
969200965 4:5605620-5605642 ATGTTGAAGCAAGAGAAAGAAGG + Intronic
972172675 4:36365886-36365908 TGGCAGAAGCATTAGACTGATGG + Intergenic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973906344 4:55535691-55535713 CTGTGGAAGCATGGGAAAGAAGG + Intronic
974970989 4:68826769-68826791 TTGTAGAAACAGGAGACAGAGGG - Intronic
976325735 4:83769711-83769733 TTATAGCAGAATGAGAATGAGGG - Intergenic
977781086 4:100981594-100981616 TTGTGGAAGTGTGAGAATGGAGG - Intergenic
978168244 4:105634691-105634713 TTGTAATAGAAAGAGAATGAAGG + Intronic
978203061 4:106045727-106045749 ATCTAGAAGGAAGAGAATGAGGG - Exonic
979438847 4:120727106-120727128 TTGTAGAGGCAACAGAGTGAAGG - Intronic
981375296 4:144008247-144008269 ATGTAGCAGAAAGAGAATGAGGG + Intronic
981385916 4:144130446-144130468 ATGTAGCAGAAAGAGAATGAGGG + Intronic
982893751 4:160890200-160890222 ATGCAGAAGCAAGAGAAAGAAGG + Intergenic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
984252075 4:177347259-177347281 TTGTTGAAGGAAGAGAAAGAAGG + Intronic
984671884 4:182499047-182499069 TGGTAGAAGCCTGAAAATAAAGG + Intronic
986345216 5:6828483-6828505 CTGTAGAATGATGAGAATGTAGG + Intergenic
987068931 5:14317650-14317672 GTGAAGAATGATGAGAATGATGG - Intronic
987548492 5:19346073-19346095 TTCTAGAAGCATGAAAATTCAGG - Intergenic
987601118 5:20072092-20072114 TTGTTGAGGCAAAAGAATGATGG - Intronic
987606986 5:20149106-20149128 TAGTTGAAGCAAGAGAATGGAGG - Intronic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987713335 5:21533072-21533094 TTTTAGAAGAAGTAGAATGAGGG - Intergenic
990372300 5:55132530-55132552 TTTTTGAAGCAGGAGAAAGAAGG - Intronic
991026816 5:62038426-62038448 TTATCCAAGCATTAGAATGAAGG - Intergenic
991051457 5:62277060-62277082 TTGAAAAAGCATACGAATGAAGG - Intergenic
993632048 5:90298323-90298345 TTATAGAAGTGGGAGAATGATGG - Intergenic
994697136 5:103086450-103086472 GTGAAGAAGCAAGATAATGAGGG - Exonic
994791147 5:104227250-104227272 TTATAGCAGCATGAGCATGAGGG + Intergenic
995070001 5:107909483-107909505 TTGAACAACAATGAGAATGATGG + Intronic
995077176 5:107999606-107999628 ATTTAGAAATATGAGAATGAAGG - Intronic
995939013 5:117555478-117555500 TTCTGGAAACATGAGAATGAAGG - Intergenic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
996550643 5:124726441-124726463 TTGTGAAAGAATGAGAATTAAGG - Intronic
996861839 5:128076032-128076054 TTTTAAAAACATGAGTATGAAGG - Intergenic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998514202 5:142737898-142737920 TTGTAGAATCATGAGCAAGGTGG + Intergenic
998775570 5:145597181-145597203 TTGTAGAAGCCTTATAATTAAGG - Intronic
1004869895 6:19894289-19894311 TTGTAGACACATCAGAAGGAAGG + Intergenic
1005783960 6:29222972-29222994 GTGTAGAAGAAGGAGAATGAAGG - Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006770816 6:36551114-36551136 TTGCAGAACCCTGAGAGTGAAGG + Intergenic
1009317871 6:62245071-62245093 TTCTAGTCGCATGAGAATGTTGG - Intronic
1011988340 6:93479274-93479296 TTGTTGAACCGTGAAAATGAAGG + Intergenic
1014810174 6:125876513-125876535 TTGGAGGAGCATGTGAATAAAGG - Intronic
1014883686 6:126753607-126753629 TAGTAGAAGCTTTAGAAAGATGG + Intergenic
1014976924 6:127898688-127898710 TTGTAAAAACATGTGAATGCAGG - Intronic
1015360796 6:132336816-132336838 TGGTAGACGCATGAGAATTCGGG - Intronic
1015403050 6:132808597-132808619 TTAGAGAATCATTAGAATGAAGG - Intergenic
1015714522 6:136178656-136178678 TTGTAGAATCATGAGATTGGCGG - Intronic
1015966758 6:138702002-138702024 TTCTAGAAGCTTGACCATGAAGG - Intergenic
1016518046 6:144918675-144918697 TTGTAGAATTATGATAATAATGG + Intergenic
1017611048 6:156186548-156186570 TTGTGGAAACAGTAGAATGAAGG + Intergenic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1021035711 7:15795664-15795686 TTCTAAAAGCATGGGAATGTGGG - Intergenic
1021819631 7:24483678-24483700 TTCTAGAAGCATGAGATGGGAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023793340 7:43771013-43771035 TTTGGGAAACATGAGAATGATGG + Intronic
1024271434 7:47645225-47645247 TGGTAGATGCATGGGAATGGGGG - Intergenic
1024960259 7:54967321-54967343 TTATAGAAGAATGAGCATAAAGG - Intergenic
1028630764 7:92931480-92931502 CTGTAGAAGCAGCAGAATGGTGG + Intergenic
1028843317 7:95452145-95452167 TTGGAGCAGAATGGGAATGAGGG - Intergenic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1031770603 7:125836697-125836719 TTATCAAAGCATGATAATGAAGG - Intergenic
1032444229 7:131967699-131967721 TTGTAGAAATTTGAGAAAGAAGG - Intergenic
1033262276 7:139854106-139854128 TTGTACAACCCTGAGAGTGAGGG - Intronic
1035976850 8:4322601-4322623 TTGTAGAAGCAGAAAAATGCTGG + Intronic
1037005115 8:13768476-13768498 TGAAATAAGCATGAGAATGAAGG + Intergenic
1037025329 8:14028541-14028563 GTGCAGAAGCAAGAGACTGAAGG - Intergenic
1041988350 8:63954307-63954329 TTGTGGAAGCGGGAGCATGAAGG + Intergenic
1043661977 8:82755094-82755116 ATGTAGGAGCATGTGAAGGAAGG + Intergenic
1045962454 8:107983776-107983798 TTGTAGAAACATCAGAGTTATGG + Intronic
1046435643 8:114184601-114184623 TTGGAGGAGTATGAGACTGAGGG + Intergenic
1049266615 8:141671080-141671102 TTGTACAAGCAAGAAAATGGAGG - Intergenic
1050339366 9:4620371-4620393 TTTGAGAAGCAAGGGAATGATGG - Intronic
1051208141 9:14711910-14711932 TTATAGAAGCAGTAGAATGGTGG + Intergenic
1052082248 9:24221466-24221488 ATATAGAAGCATGAGAATGAGGG - Intergenic
1052498948 9:29263849-29263871 TTGCAGAACCTTGAGAATAAAGG + Intergenic
1052629980 9:31025349-31025371 TTGAAGAAGAATGAGGTTGAGGG + Intergenic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1055851528 9:80636579-80636601 TTGGAATAGCATGAGAATGAGGG - Intergenic
1057297449 9:93857622-93857644 TTGTGGAAGCCTGAGAAGGCAGG - Intergenic
1058120487 9:101133368-101133390 TTGTAGTAACATGAGAACGCAGG + Intronic
1058776126 9:108285721-108285743 TTGTACCACCCTGAGAATGAGGG + Intergenic
1058805900 9:108591542-108591564 TTGTAGAAACCTCAAAATGAAGG + Intergenic
1059950322 9:119455450-119455472 TTGTAGGAGCCTGAGAATCCTGG - Intergenic
1059970248 9:119659939-119659961 TTGAAGAATGATGAGAATGTTGG + Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1188274463 X:28182684-28182706 TTGTAGAATAATGGTAATGATGG + Intergenic
1188353224 X:29157996-29158018 TAGTAGAAGGAAGAGAATAAAGG + Intronic
1191079788 X:56497319-56497341 TTGTAGAAGAATCATAATGCAGG - Intergenic
1191651906 X:63548320-63548342 TTGTAGAATGAAAAGAATGATGG - Intergenic
1191923036 X:66278086-66278108 TTGGAGAGGCCTGAGAATCATGG + Intergenic
1191969580 X:66798638-66798660 ATGAAGAAAAATGAGAATGAAGG - Intergenic
1195934469 X:110111758-110111780 TTGTAGAAGCATGAGAATGAAGG + Intronic
1196987902 X:121294985-121295007 GTGTAGAAGCATGAGAATTAAGG + Intergenic
1197496695 X:127192568-127192590 AGGTAGAAGTATGGGAATGAAGG + Intergenic
1197756887 X:130001904-130001926 TTGTAGAATCAAGAAATTGAAGG + Intronic
1197936051 X:131741392-131741414 GTGTAGAACCAGGAGAGTGAGGG + Intergenic
1197975597 X:132162894-132162916 TTGTGGAAGCTTGAACATGAGGG + Intergenic
1198723670 X:139653219-139653241 TGGAAGAAGGGTGAGAATGAGGG + Intronic
1199891660 X:152089204-152089226 TTGTAGAAGAATTATAAGGAAGG - Intergenic
1200979052 Y:9244694-9244716 TTGTAGATTTATGGGAATGAGGG + Intergenic
1201352881 Y:13065466-13065488 TTCTAGTTCCATGAGAATGATGG - Intergenic