ID: 1195936066

View in Genome Browser
Species Human (GRCh38)
Location X:110126794-110126816
Sequence CACACAGGAGTGGCCCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 1, 2: 7, 3: 51, 4: 367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195936066_1195936069 26 Left 1195936066 X:110126794-110126816 CCTGGCTGGGCCACTCCTGTGTG 0: 1
1: 1
2: 7
3: 51
4: 367
Right 1195936069 X:110126843-110126865 TGTGTGTGTGTGTGTGTGTGTGG 0: 3779
1: 5173
2: 8013
3: 13571
4: 22268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195936066 Original CRISPR CACACAGGAGTGGCCCAGCC AGG (reversed) Intronic
900148966 1:1170005-1170027 CTCACAGGTGTGGCCCTGCCTGG - Intergenic
900185305 1:1330609-1330631 CACGCAGGAGTGGCCCAGACGGG + Intergenic
900203054 1:1419901-1419923 TACACCGGAGGGGCACAGCCGGG + Intronic
900266505 1:1759888-1759910 GACAAAGGAGTGGCTCTGCCAGG + Exonic
900347404 1:2216286-2216308 GACACTGGTGAGGCCCAGCCTGG - Intergenic
900354880 1:2256098-2256120 GACACAAGAGTGGCACAGACAGG - Intronic
900437236 1:2636832-2636854 CAGCCAGGTGTGGCCCAGGCAGG - Intronic
901226001 1:7613392-7613414 CACACAGGAGAGGCCCAGCCTGG + Intronic
901830858 1:11891589-11891611 CACACAGCAGTGGCAGAGCATGG + Intergenic
901948701 1:12724394-12724416 CAAACAGTAGTAGCCCAGGCTGG + Intronic
902222310 1:14974453-14974475 CACTCAGGAGTGGAGCAGCTGGG - Intronic
902388204 1:16088115-16088137 CTCCCAGGAGGTGCCCAGCCCGG - Intergenic
902752489 1:18526881-18526903 CAGAGATGAGTGTCCCAGCCAGG + Intergenic
903070833 1:20726326-20726348 CACAAATGAGTGGCAGAGCCAGG - Intronic
903969607 1:27110050-27110072 AACTCAGGAGTGGCAGAGCCAGG - Intronic
904586625 1:31584386-31584408 CACAGAGAAGTGGCCAGGCCAGG - Intronic
904673092 1:32180432-32180454 AGCCCAGGAGCGGCCCAGCCAGG + Exonic
905846840 1:41241423-41241445 CACACGTGAGTCGGCCAGCCGGG + Intronic
905931792 1:41793066-41793088 CACACAGGAGTGGCCTGTCATGG + Intronic
906140031 1:43528814-43528836 CTCACAGGAGCGGCCCAGACTGG + Intronic
906557373 1:46724481-46724503 CACACAGTAGGGGCTCACCCAGG - Intergenic
907100375 1:51828111-51828133 TACACCTGAGTGGCCCACCCAGG + Intronic
907786419 1:57617314-57617336 CACACTGCAGTGGCCCAGGTTGG + Intronic
908674668 1:66590465-66590487 TACAGAGATGTGGCCCAGCCTGG + Intronic
909486411 1:76179123-76179145 CAACTAGGAGTGTCCCAGCCTGG + Intronic
910057885 1:83053372-83053394 CACACAGCAGTGGTCCAGCCTGG + Intergenic
911090280 1:94012113-94012135 TGGACAGCAGTGGCCCAGCCAGG - Intronic
911109039 1:94163775-94163797 CACTCAGTAGTGGCGTAGCCAGG + Intronic
912882246 1:113427219-113427241 CACCCAGAGGTGGTCCAGCCTGG - Intronic
913007802 1:114651929-114651951 CACAGAGGGGTAGCCCAGCATGG + Intronic
919040955 1:192387783-192387805 CTCACAGCAGTGGCCCACTCAGG - Intergenic
920034073 1:203054403-203054425 CACACAGAAGTGACAGAGCCAGG + Intronic
920842025 1:209563122-209563144 CTCAAAGAAGTGCCCCAGCCAGG - Intergenic
921755543 1:218851863-218851885 CTCAGAGGAGGGGCCCAGCCAGG - Intergenic
922359937 1:224812043-224812065 CAGGCAGGAGAGGCCCAGGCTGG + Intergenic
922768876 1:228171304-228171326 CTCACAGGAGAGCCCCGGCCTGG - Intronic
924489261 1:244519452-244519474 CACACAGCAGTGGCCCCAACAGG - Intronic
924710132 1:246524525-246524547 CAGACATGAGTGGGGCAGCCAGG - Intergenic
1062789385 10:291957-291979 CCCGCAGGAGAGGGCCAGCCTGG - Intronic
1062823969 10:555516-555538 CTGACAGGACTGGCCCACCCTGG + Intronic
1062989757 10:1804442-1804464 GAAACAGAAGTGGCCCGGCCTGG - Intergenic
1063043436 10:2367972-2367994 CACAGAGGAGCAGCACAGCCAGG - Intergenic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1064330351 10:14388160-14388182 CACAGAGGAGTGGCCGACTCTGG + Intronic
1067762985 10:49063759-49063781 GACACAAAAGTGGCCCAGCAAGG - Intronic
1068711573 10:60140949-60140971 AACAAAGCAGTGGCCCAGGCGGG + Intronic
1069750365 10:70741451-70741473 CACACAGGTGTTGCCAAGGCCGG + Intronic
1070685214 10:78475559-78475581 CACAGTGCACTGGCCCAGCCTGG + Intergenic
1070951305 10:80433450-80433472 CCCAGGGGACTGGCCCAGCCAGG + Exonic
1071238535 10:83678012-83678034 CACACAGGACTTCCCCAGCAGGG - Intergenic
1071892346 10:90024303-90024325 CACTCCAGACTGGCCCAGCCTGG - Intergenic
1072443859 10:95480991-95481013 CACTCAGGAATGGCCCAGTAGGG + Intronic
1072614433 10:97040061-97040083 CCCACAGGAGTGCGCCTGCCTGG - Exonic
1072699990 10:97633554-97633576 CACTCCGCATTGGCCCAGCCCGG + Intronic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1075967833 10:126628146-126628168 AACACAGGAGTGACCCAGCCTGG - Intronic
1076126449 10:127977970-127977992 CACAGAGGCCTGGACCAGCCTGG - Intronic
1076783670 10:132738502-132738524 TCCACAGGACTGGCCCTGCCCGG - Intronic
1076794995 10:132794109-132794131 CACAGCGCCGTGGCCCAGCCTGG - Intergenic
1076813856 10:132904583-132904605 TACACAGCAGTGGCACGGCCAGG + Intronic
1076821938 10:132943679-132943701 CACCCAGGAGAGGCCCACCTGGG + Intergenic
1076840847 10:133044508-133044530 CACACAGGAGGGGCCCAGGAGGG + Intergenic
1076849968 10:133087946-133087968 CGCGCACGAGCGGCCCAGCCCGG - Exonic
1076857633 10:133124975-133124997 CACACAGGAGTGGTGCAGGACGG - Intronic
1076919620 10:133444888-133444910 CACAGAGGGGTGGTCCAGGCTGG + Intergenic
1076930943 10:133531428-133531450 GACAGAGGGGTGTCCCAGCCTGG - Intronic
1077021371 11:418598-418620 AGCACAGGAGAGGCCCAGCACGG + Intronic
1077104078 11:834426-834448 GAGAGAGGAGTGGCCAAGCCCGG - Intronic
1077179400 11:1205519-1205541 CACACAGGCGTGGCTCCCCCAGG + Intergenic
1077287555 11:1774398-1774420 GGCACAGGAGTGGCTTAGCCAGG + Intergenic
1077356888 11:2122822-2122844 CACACAGGTGCGGCCAGGCCAGG - Intergenic
1077438310 11:2555564-2555586 CACACAGGAGTGGCCCAAGCCGG - Intronic
1078068370 11:8092750-8092772 CACACACGCGTGGCCTACCCAGG + Intronic
1078509255 11:11973509-11973531 CAAACAGGAGTGGCCAGGACTGG - Intronic
1078782143 11:14449343-14449365 CACACAGGACTTCACCAGCCAGG - Intronic
1079403127 11:20122397-20122419 CATACAACAGTGGCCCAACCAGG + Intergenic
1079915479 11:26364415-26364437 AACACAAGAGTGGCCTAACCCGG - Intronic
1081626950 11:44661675-44661697 CAGACAGGCAGGGCCCAGCCGGG + Intergenic
1081651254 11:44825576-44825598 CACACAGGAGGGGTCCCGCTGGG - Intronic
1081906836 11:46675577-46675599 CACTCAGCAGAGGCCCTGCCAGG + Intergenic
1082293612 11:50412204-50412226 CAGACAGGACTGGACAAGCCTGG - Intergenic
1083410455 11:62488948-62488970 GACACAGGAGCGGCCCAGCGCGG + Intronic
1083709706 11:64540609-64540631 AACACAGGCCTGGCCCTGCCTGG + Intergenic
1083859400 11:65411899-65411921 CTCAGAGTGGTGGCCCAGCCTGG - Exonic
1083862259 11:65427608-65427630 CACACAGCAGTGCCCCATCTTGG - Intergenic
1083946438 11:65925687-65925709 AACCCAGGAGTGGACCTGCCAGG - Intergenic
1084150874 11:67287390-67287412 GACTCATGAGTGGCCCAGGCTGG + Intergenic
1084264790 11:67999339-67999361 CACACAGGAGTGGCACAGGTCGG - Intronic
1084955256 11:72687857-72687879 CTCACAAGAGTGGCACATCCTGG + Intronic
1085024285 11:73227737-73227759 CACAGAGGGGTGGCCCTGCCTGG - Intronic
1085263989 11:75225541-75225563 CACAGAGGCGTGTCCCTGCCTGG + Intergenic
1085345412 11:75765372-75765394 CACACAGGAAGGGCCCAAGCTGG + Intronic
1087855954 11:103091999-103092021 CGCACCGGCGCGGCCCAGCCCGG + Exonic
1088841844 11:113634069-113634091 CACACAGCAGTGGTGAAGCCTGG + Intergenic
1088974371 11:114802499-114802521 CACAGTTGATTGGCCCAGCCTGG + Intergenic
1089632427 11:119792038-119792060 CAAACAGCAGTGGCTCAGCAGGG + Intergenic
1090398132 11:126432517-126432539 CACACAGGAGCTGCCCAGCCAGG + Intronic
1091805892 12:3355511-3355533 CACACAGCAGCAGCCCAGCAAGG + Intergenic
1092230439 12:6772946-6772968 CCCACAGGAGGGGACCAGCAGGG + Intronic
1093182525 12:15983314-15983336 GACACAGCAGAGGCACAGCCAGG - Intronic
1095431184 12:42136801-42136823 CACACACAAGTCGCCCAGGCTGG + Intronic
1096667438 12:53175348-53175370 CACACAGGAGGAGGCCTGCCTGG + Intronic
1097696453 12:62779674-62779696 CACACAATAGTGGCAGAGCCAGG + Intronic
1098141173 12:67451532-67451554 CTCAGAGGTGTGACCCAGCCAGG + Intergenic
1100543225 12:95577604-95577626 CACTCTGGAGTTGCCCAGGCTGG - Intergenic
1101442416 12:104713643-104713665 AACAGAAGAGTGGCCCAGCACGG - Intronic
1102229151 12:111250352-111250374 CACACACGAGGGGCCAAGGCAGG - Intronic
1102586026 12:113923642-113923664 CACACTGCAGTGGCCAAGCCTGG - Intronic
1103054139 12:117805316-117805338 CACACAGGTGTGGCCTTCCCTGG + Intronic
1103619860 12:122180641-122180663 TACACAGAAGAGGCCCAGCCAGG - Intronic
1103763959 12:123269144-123269166 CAGCCAGGAGTGGCACAGCTGGG - Intronic
1103947968 12:124537620-124537642 CACACTGGAGTGGCACACACTGG - Intronic
1103947970 12:124537635-124537657 CACACTGGAGTGGCACACACTGG - Intronic
1104189062 12:126460224-126460246 CACACAGGCCTGGCCCATCATGG + Intergenic
1104950926 12:132439567-132439589 CACACACGTGTGGCCTCGCCGGG + Intergenic
1104955908 12:132465736-132465758 CCCAGAGGAGAGGCCCTGCCAGG + Intergenic
1105852632 13:24349400-24349422 CAGTCAGCAGTGGCCGAGCCAGG + Intergenic
1107092410 13:36496047-36496069 GACAAAGCAGTGGCCAAGCCGGG + Intergenic
1112649957 13:101385200-101385222 CACAAAGGAGTGGAACAGCAAGG - Intronic
1117617510 14:57548662-57548684 GACACAGGAGTGGCAGAACCTGG + Intergenic
1120102466 14:80461145-80461167 GGCACAGAAGTGGCCGAGCCAGG + Intergenic
1122318275 14:100838234-100838256 CACACAGGAGAGGCCCAGATAGG + Intergenic
1122427382 14:101619884-101619906 CACACAGGACAGGCTCAGCCAGG + Intergenic
1122548543 14:102538171-102538193 CACAGGGAAGGGGCCCAGCCGGG + Intergenic
1122672292 14:103382108-103382130 CACACCACAGTGCCCCAGCCTGG + Intergenic
1122771345 14:104099301-104099323 CACAGAGGTGTGGCAGAGCCAGG - Intronic
1124248982 15:28095249-28095271 AGGGCAGGAGTGGCCCAGCCAGG + Intronic
1126181333 15:45787949-45787971 CAAACTGGACTGGCCTAGCCTGG + Intergenic
1127523671 15:59770876-59770898 CACACATGGGTGGCCCACCTTGG - Intergenic
1127975717 15:63995806-63995828 CTCACAGCTGTGGCCCACCCTGG - Intronic
1128142836 15:65314434-65314456 CCCACTGGAGTTGCCCAGGCTGG + Intergenic
1128570798 15:68731454-68731476 GAGATAGGAGTGGCCCAGCCTGG + Intergenic
1129518604 15:76171776-76171798 CAGACAAGAGTGGCCCAGTGGGG - Intronic
1130159925 15:81388466-81388488 CACACAGCAGTGGCTTAGCTCGG + Intergenic
1130714362 15:86316901-86316923 CTCACAGGACTGCCTCAGCCTGG - Intronic
1131187264 15:90285540-90285562 GCGACAGGATTGGCCCAGCCGGG + Intronic
1132545261 16:530091-530113 CACACAGCTGAGGCACAGCCTGG - Intronic
1133236610 16:4390195-4390217 GACCCAGGAGAGCCCCAGCCTGG + Intronic
1134129074 16:11636162-11636184 CACACCTGATTGCCCCAGCCCGG - Intronic
1134134943 16:11671783-11671805 CAGACAGGTGGGGTCCAGCCAGG + Intronic
1134518915 16:14908989-14909011 CAGGCAGAAGTGGTCCAGCCTGG - Intronic
1134555012 16:15157235-15157257 CAGGCAGAAGTGGTCCAGCCTGG + Intergenic
1134706586 16:16307644-16307666 CAGGCAGAAGTGGTCCAGCCTGG - Intergenic
1134804084 16:17109995-17110017 CACATAGGAGGGGCCCAGCAAGG - Intronic
1134960954 16:18404480-18404502 CAGGCAGAAGTGGTCCAGCCTGG + Intergenic
1134965256 16:18487083-18487105 CAGGCAGAAGTGGTCCAGCCTGG + Intronic
1135786011 16:25349880-25349902 CAAACTGAAGTGGCCCAGCGTGG - Intergenic
1136617039 16:31404549-31404571 CACACGGGAGTGTCCCATTCTGG + Intronic
1137480845 16:48850629-48850651 CACGCAGCCCTGGCCCAGCCCGG + Intergenic
1137721784 16:50631802-50631824 CACACTGGTGAGGCCCATCCTGG + Intronic
1138340317 16:56284938-56284960 CCCACAGCGGTGGCTCAGCCTGG + Intronic
1138360759 16:56425460-56425482 CAGCCAGGAGCGGCCCGGCCCGG - Exonic
1139825035 16:69750280-69750302 CACACAGGAGCCACCGAGCCTGG + Intronic
1140209699 16:72960373-72960395 CACACAGGGGTGGCATGGCCGGG + Intronic
1140501948 16:75440682-75440704 CACAAAGGACTGGACCAGCCTGG - Intronic
1141691617 16:85599991-85600013 CACACAGGAGGGACCTTGCCAGG - Intergenic
1142712749 17:1732340-1732362 CACACAGGATGGTCCGAGCCTGG - Exonic
1143203597 17:5128568-5128590 CACACATGAGTGGGGCAGCCGGG + Intronic
1143205914 17:5139179-5139201 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1143633773 17:8152877-8152899 AACCCAGGAGAGGCCCAGGCAGG - Intronic
1143712553 17:8744490-8744512 CACAGAGGGGTGGGCAAGCCAGG + Intronic
1144493241 17:15732043-15732065 CACATATGAGTGGGGCAGCCGGG + Intergenic
1145013758 17:19384054-19384076 CACACTAGGGTGGCCCAGACAGG + Exonic
1145030466 17:19501245-19501267 CCCACAGGAGTGGCCCTGGCCGG + Intronic
1145112814 17:20179204-20179226 TACACAGAATTGGCCCAGGCCGG + Intronic
1145799621 17:27674589-27674611 CACACATGAGTGGGGCAGCCAGG - Intergenic
1146842696 17:36166617-36166639 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146844986 17:36176812-36176834 CACACATGAGTGGGGCAGCCGGG - Intronic
1146855009 17:36254576-36254598 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146857293 17:36264747-36264769 CACACATGAGTGGGGCAGCCGGG - Intronic
1146863323 17:36323628-36323650 CACACATGAGTGGGGCAGCCGGG + Intronic
1146865611 17:36333800-36333822 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1146870909 17:36378468-36378490 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146873205 17:36388657-36388679 CACACATGAGTGGGGCAGCCGGG - Intronic
1146878267 17:36429550-36429572 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146880561 17:36439743-36439765 CACACATGAGTGGGGCAGCCGGG - Intergenic
1146882216 17:36450696-36450718 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1147066183 17:37924216-37924238 CACACATGAGTGGGGCAGCCGGG + Intergenic
1147068480 17:37934412-37934434 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1147073793 17:37979092-37979114 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1147076087 17:37989282-37989304 CACACATGAGTGGGGCAGCCGGG - Intronic
1147077716 17:38003777-38003799 CACACATGAGTGGGGCAGCCGGG + Intronic
1147080003 17:38013949-38013971 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1147085314 17:38058630-38058652 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1147087612 17:38068828-38068850 CACACATGAGTGGGGCAGCCGGG - Intergenic
1147093653 17:38127711-38127733 CACACATGAGTGGGGCAGCCGGG + Intergenic
1147095952 17:38137909-38137931 CAGGCAGGTGGGGCCCAGCCCGG + Intergenic
1147101261 17:38182596-38182618 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1147103554 17:38192777-38192799 CACACATGAGTGGGGCAGCCGGG - Intergenic
1148035105 17:44654542-44654564 AGCCCAGGAGTTGCCCAGCCAGG - Intergenic
1148693944 17:49548142-49548164 CACAGAGGGGTGACCCACCCCGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149413438 17:56432762-56432784 GACACAGGAGTGGCACAGTGAGG - Intronic
1149845858 17:60009102-60009124 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1149848128 17:60019274-60019296 CACACATGAGTGGGGCAGCCGGG - Intergenic
1150084209 17:62265682-62265704 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1150086485 17:62275877-62275899 CACACATGAGTGGGGCAGCCGGG - Intronic
1152146615 17:78572429-78572451 CACACATGTGTGACCCAGCGGGG + Intronic
1152378782 17:79931536-79931558 CACAGATGAGTGCCCCAACCCGG - Intergenic
1152378784 17:79931547-79931569 CACTCATCTGTGGCCCAGCCAGG + Intergenic
1152513262 17:80804680-80804702 CAGCTAGGAGTGGCCGAGCCTGG + Intronic
1152641182 17:81449912-81449934 CACCATGGAGTGCCCCAGCCTGG + Intronic
1152735442 17:81994837-81994859 CAGACTGGGGTGGCCCCGCCGGG - Exonic
1152742629 17:82025003-82025025 CACGCTGGAGTGGAACAGCCTGG + Exonic
1153726393 18:7960502-7960524 CACACACGTGTGGCCAAGGCAGG + Intronic
1154270347 18:12912644-12912666 CCCAGAGGAGCGCCCCAGCCGGG + Intronic
1155040149 18:22058335-22058357 CAAACAGGAGTGCTGCAGCCCGG - Intergenic
1156377992 18:36531857-36531879 CGCACAGGAATAGCCCAGGCAGG - Intronic
1156563404 18:38155963-38155985 CACACAGGCTTGGCACTGCCTGG - Intergenic
1157503958 18:48212910-48212932 CACATAGTAGTGGTCCAGGCTGG - Intronic
1158453438 18:57586679-57586701 CGCCCAGCAGTGGCCGAGCCGGG + Intronic
1160092572 18:75840916-75840938 CACTCAGCAGTGGCACAGCCAGG - Intergenic
1160386821 18:78501950-78501972 CCCAGAGGAGATGCCCAGCCAGG - Intergenic
1160865741 19:1255212-1255234 CACACACGCCTGGCCCTGCCCGG + Intronic
1161074982 19:2281136-2281158 CACACAGCAGGGGCCCAGAGAGG - Intronic
1161074993 19:2281179-2281201 CACACAGCAGGGGCCCAGAGAGG - Intronic
1161257233 19:3316146-3316168 GACACAGCAGTGACCCAGACAGG + Intergenic
1161369453 19:3902407-3902429 GACAGTGGAGTGGCCCAGACAGG - Intronic
1161853292 19:6750105-6750127 CACCCAGCAGTGACTCAGCCAGG - Intronic
1162181400 19:8871506-8871528 CAGAGAGTAGGGGCCCAGCCGGG + Exonic
1162629700 19:11917433-11917455 TACCTAGGAGTGGGCCAGCCTGG + Intergenic
1162694258 19:12460109-12460131 CACACAGGAGTGTCTCAGTTTGG + Intronic
1163233093 19:16016824-16016846 CACACCTGAGTGGAGCAGCCAGG + Intergenic
1163556617 19:17997044-17997066 CACCCAGGACTGTCCCTGCCTGG + Intronic
1163586049 19:18164213-18164235 CTCACAGGAGTGGCTGAGCCAGG + Intronic
1164941397 19:32254263-32254285 CAGACAGATGGGGCCCAGCCAGG - Intergenic
1165936446 19:39391758-39391780 AACACAGGCGTGCACCAGCCAGG - Intronic
1166777072 19:45319520-45319542 CAGACAGGAGTGGACAACCCAGG - Exonic
1167278660 19:48553792-48553814 CACGCAGAACTGGGCCAGCCTGG - Intronic
1167523826 19:49971916-49971938 CACACAGCAGCCCCCCAGCCAGG + Intergenic
1167650639 19:50726754-50726776 CACCCAGGAGTCCGCCAGCCGGG + Intergenic
1167756237 19:51415344-51415366 CACACAGCAGCCCCCCAGCCAGG - Exonic
924987646 2:287041-287063 CACACAGTCGGGGCTCAGCCAGG - Intronic
925031332 2:652118-652140 CGCCCAGGTGTGGCCCAGCTGGG - Intergenic
925106584 2:1297472-1297494 AACACAGGGGCTGCCCAGCCCGG + Intronic
925747006 2:7051846-7051868 CAGACCGGAGTGGAGCAGCCAGG - Intronic
926215148 2:10901754-10901776 CAGACAGGAGTAGACCAGCTGGG + Intergenic
926251918 2:11159615-11159637 CACACAGGAGGGGCCCCCCAGGG - Intronic
926459336 2:13109654-13109676 AACACAGGACAGGCCCAGGCTGG + Intergenic
926636322 2:15183656-15183678 CACACAGATGTGGCCCATTCTGG + Intronic
926745469 2:16153374-16153396 CACACAGAAGTGGCCCAGGTAGG - Intergenic
927218789 2:20687304-20687326 CACACAAGAGTCTCCCAGCATGG - Intronic
928096695 2:28409277-28409299 CCATCAGGAGTGGCCCAGCCTGG + Intronic
928117819 2:28560143-28560165 TACCAAGGAGTGGCCCACCCTGG - Intronic
931114762 2:59152648-59152670 CACACTGAAGTGGCCTGGCCAGG + Intergenic
932319725 2:70812800-70812822 CTCCCAGGAGTGCCCAAGCCAGG - Intronic
932321241 2:70823441-70823463 TACACAGGAAGGGCCCAGGCTGG + Intergenic
933813461 2:86047861-86047883 AACACAGGAGAGGCAGAGCCTGG + Intronic
935071189 2:99695271-99695293 TACGAAGGACTGGCCCAGCCAGG - Intronic
935170609 2:100608739-100608761 CACCCACAGGTGGCCCAGCCAGG + Intergenic
935271396 2:101437225-101437247 AGCCCAGGAGTTGCCCAGCCTGG + Intronic
935807850 2:106766684-106766706 CAGAGAGGAGTGGGGCAGCCTGG + Intergenic
936514887 2:113175138-113175160 CAGGGAGGAGAGGCCCAGCCTGG + Intronic
937418546 2:121736811-121736833 GCGACAGGATTGGCCCAGCCGGG + Exonic
938173692 2:129104907-129104929 CACACAGGGGTGGGACAGCCAGG - Intergenic
939482204 2:142763003-142763025 CACAAAGGAGTTGCAAAGCCAGG - Intergenic
942414817 2:175747498-175747520 AACACAGGTGTGGAACAGCCTGG + Intergenic
946230218 2:218286678-218286700 CCCCCAGGAGAGCCCCAGCCGGG - Exonic
946299139 2:218811917-218811939 CACACAGGAGTTACCCACCTAGG + Intronic
947623193 2:231604081-231604103 CACCCAGGGGTGGCCTGGCCTGG + Intergenic
948490609 2:238310282-238310304 TAAAAAGGAGTGGCGCAGCCGGG - Intergenic
948563242 2:238867642-238867664 CACAGAGGGGTGGCCGAGGCTGG + Intronic
948709901 2:239819064-239819086 CACAGGGGAGGAGCCCAGCCGGG - Intergenic
948755149 2:240155164-240155186 TACACAGAATTGGCCCAGCTTGG - Intergenic
1170866831 20:20165130-20165152 CTCAGAGGAGTGCCCCATCCTGG + Intronic
1170889369 20:20365447-20365469 CAAGCAGGTGTAGCCCAGCCCGG - Intergenic
1172131581 20:32659603-32659625 CACCCATGAGGGGTCCAGCCAGG - Intergenic
1172572807 20:35983730-35983752 CACGCAGCAGTGACCCAGACTGG + Intronic
1172671317 20:36636060-36636082 GACACAGGAGTGGACAAGACTGG - Intronic
1173125398 20:40331841-40331863 CTCAAAGGTGGGGCCCAGCCTGG - Intergenic
1174363769 20:50044123-50044145 CTCTCAGCACTGGCCCAGCCTGG - Intergenic
1174452529 20:50628962-50628984 CACACAGGAGGGACCTGGCCTGG + Intronic
1175059749 20:56231131-56231153 CAGAGAGGAGTGGAACAGCCAGG + Intergenic
1175754024 20:61517956-61517978 CCCACACGAGAGGCCCATCCAGG - Intronic
1176177256 20:63734608-63734630 CAGAGGGCAGTGGCCCAGCCAGG - Intronic
1176383542 21:6125921-6125943 CACACAGGCATGGCCCAAGCAGG - Intergenic
1178630922 21:34260830-34260852 AGCACATGAGTGGCCCAGCATGG - Intergenic
1179094990 21:38305945-38305967 CACACAGGAGTGTCAAAGACTGG - Exonic
1179545705 21:42111211-42111233 CAGACAGGAGAGTACCAGCCAGG + Exonic
1179545746 21:42111346-42111368 CAGCCAGGAGAGCCCCAGCCAGG + Exonic
1179739928 21:43412317-43412339 CACACAGGCATGGCCCAAGCAGG + Intergenic
1180043919 21:45294112-45294134 CACATAGGGGAGGCACAGCCTGG + Intergenic
1180594865 22:16966526-16966548 CAGATAGAAGTGCCCCAGCCAGG + Intronic
1181000540 22:19986050-19986072 CACACAGCAGTGCACCTGCCAGG + Intronic
1181011011 22:20040665-20040687 CCTACAGGACTGGCCCATCCAGG + Intronic
1181041665 22:20195302-20195324 CCCACAAGGGTGTCCCAGCCAGG + Intergenic
1181165385 22:20980350-20980372 CCCACAGCACTGGCCCTGCCTGG - Intronic
1181418164 22:22775143-22775165 TACAGAGGAATAGCCCAGCCAGG - Intronic
1181434503 22:22902516-22902538 CACACAGCCCTGACCCAGCCTGG - Intergenic
1181438711 22:22924833-22924855 CCCCCAGGAGTGGCTCAGCCTGG - Intergenic
1181465420 22:23108127-23108149 CACACAGGTGGGGAGCAGCCAGG + Intronic
1181534671 22:23535155-23535177 CACACAGGAGGAGTCCAGGCGGG - Intergenic
1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG + Intergenic
1183240438 22:36653734-36653756 CACAGGGGACTGGCCCAGGCTGG - Intronic
1183494323 22:38133796-38133818 CTCAGAGGAGATGCCCAGCCAGG + Intronic
1183627900 22:39015831-39015853 CACACAGGAGAGCCCACGCCGGG - Intronic
1183725849 22:39589317-39589339 CACCCAGGAGTGGCCCCGCTGGG + Intronic
1184105835 22:42367134-42367156 AAAACAGGAGTGGCTCAGCAAGG - Intergenic
1184115546 22:42419767-42419789 CACCCAGGAGTGGCTCAGGGAGG - Intronic
1184223950 22:43118463-43118485 CACACAGCAGGGGCCGAGCAGGG + Intronic
1184321730 22:43747071-43747093 TACCCAGCATTGGCCCAGCCTGG - Intronic
1184645273 22:45891795-45891817 CACACAGGTGTGGCCGATCCCGG - Intergenic
1184656745 22:45945788-45945810 CACACAGCAGGGGCTCAGCAAGG - Intronic
1184927855 22:47656855-47656877 CACAAAGGAGTAACCGAGCCAGG + Intergenic
1185048116 22:48539233-48539255 AAGACAGGACTGGCCCAGCCAGG + Exonic
1185134708 22:49063072-49063094 CACACAGGAGAGGCCCTTCGGGG + Intergenic
1185312701 22:50165430-50165452 CACACTCCAGTGGCCCAGACTGG - Intergenic
950677088 3:14560863-14560885 CACACAGCAGGGGCGCAGCAAGG + Intergenic
951541822 3:23789207-23789229 CACACAGGAGTGGCAGGGCAGGG + Intergenic
953335771 3:42092610-42092632 CTAACAGGAGTAGCCCTGCCTGG + Intronic
953740012 3:45529801-45529823 CAAACTGGAGTAGCCCAACCTGG + Intronic
955754840 3:62216569-62216591 CAGAAGGGGGTGGCCCAGCCAGG - Intronic
961651890 3:128420980-128421002 CACAGAGGCCTTGCCCAGCCTGG + Intergenic
961669364 3:128517803-128517825 CACAGAAGCCTGGCCCAGCCTGG - Intergenic
961739068 3:129021091-129021113 GACACATGAGGGGCCCTGCCAGG + Intronic
961807732 3:129501322-129501344 CAGGTAGCAGTGGCCCAGCCAGG + Intronic
963039542 3:141058656-141058678 GACACAGCAGTGGCCAAGTCGGG - Intronic
965667459 3:171110602-171110624 CACACAGTGGTGGCCATGCCTGG + Intronic
967113843 3:186319007-186319029 CACAAAGGAGAGGCCTACCCTGG - Intronic
967930380 3:194686538-194686560 CACACAGAATTACCCCAGCCTGG - Exonic
968609054 4:1548927-1548949 CACGCAGGAGCGGCCGGGCCAGG - Intergenic
968904073 4:3443672-3443694 CACACAGGCGTGCCCCAGGCAGG + Intronic
969226337 4:5800852-5800874 CACACAGGTGTGGCGCGGCGCGG - Intronic
969486564 4:7475475-7475497 GCCACAGGAGTGTCCCAGCCTGG + Intronic
972345685 4:38190704-38190726 AACACAGGAGTTGCCCTGGCAGG + Intergenic
972750395 4:41982294-41982316 CACACAAGAGTTAACCAGCCTGG + Exonic
973639946 4:52892655-52892677 CACAGAGGAGTAGCTCAGTCAGG - Intronic
974870062 4:67631163-67631185 CTCACATATGTGGCCCAGCCTGG - Intronic
976146906 4:82051047-82051069 CTCACAGGAGAGGCACAGCCTGG + Intergenic
980830304 4:138123603-138123625 CACACAGGAGAGCACCAGCAGGG + Intergenic
985113729 4:186571494-186571516 CAGACAGCAGTGCCACAGCCTGG - Intergenic
985479875 5:102849-102871 CACACAGATGTCGCCCAGGCAGG - Intergenic
985554211 5:548302-548324 CACACTGGCGTGGCCTTGCCTGG - Intergenic
986283902 5:6346028-6346050 TACACAGGAGGGGATCAGCCAGG + Intergenic
987967318 5:24893371-24893393 CACAAAGGAGTGCCCCAGCTGGG + Intergenic
990003832 5:50922913-50922935 CACGCAGGAGCGGCCGGGCCAGG + Intergenic
992503299 5:77362751-77362773 CACAGAGGCATGGCCAAGCCTGG - Intronic
994904619 5:105822215-105822237 CCTGCAGGAGTTGCCCAGCCTGG - Intergenic
996980784 5:129491290-129491312 CACTCAGGAGTGGCCCGGCCTGG - Intronic
997689824 5:135820916-135820938 AAGTCAGGAGTGACCCAGCCGGG - Intergenic
997729942 5:136162298-136162320 CACACAGACGTGGCCCTGGCTGG + Intronic
999010538 5:148033906-148033928 CACACAGGACTGTCCCAGAAAGG - Intronic
999311782 5:150556086-150556108 CACAGATGAGTGGGCCAGCGAGG + Exonic
999429110 5:151510886-151510908 CACACCAGGGTGGGCCAGCCTGG + Intronic
1000614139 5:163409283-163409305 CAAACAGAAGTGGCCCTGCAAGG + Intergenic
1001413087 5:171524496-171524518 AGAACAGGAGAGGCCCAGCCTGG + Intergenic
1001783118 5:174387350-174387372 AGCACACAAGTGGCCCAGCCTGG + Intergenic
1001846146 5:174923107-174923129 GCAACAGGATTGGCCCAGCCGGG - Intergenic
1002955703 6:1861383-1861405 CACACTGGAGTGGCCCCTCCTGG - Intronic
1004004535 6:11626910-11626932 CACGCAGGAATGGGCCATCCAGG + Intergenic
1004045971 6:12023151-12023173 GACACAAGAGAAGCCCAGCCGGG + Intronic
1006389439 6:33749833-33749855 GAAACAAGAGTGGCCTAGCCTGG + Intergenic
1006422157 6:33941770-33941792 CTCACAGGATTGGGCCTGCCTGG + Intergenic
1006514150 6:34536725-34536747 GACACAGCAGGGGCCCAGCGAGG + Intergenic
1006669758 6:35722654-35722676 CACACAGGCGTGAAGCAGCCCGG - Intronic
1007214033 6:40222138-40222160 CACACCATTGTGGCCCAGCCTGG - Intergenic
1007240463 6:40421050-40421072 CACAGAGGAGTCGCCAACCCTGG - Intronic
1008798431 6:55336232-55336254 GACAAAGAAGTGGCCCGGCCCGG - Intronic
1011269115 6:85558494-85558516 CTCACAGCAGCTGCCCAGCCTGG + Intronic
1013174385 6:107664793-107664815 CACACAGTTGTGGCACAGCCTGG + Intergenic
1013667879 6:112366713-112366735 CATCCAGGAGCAGCCCAGCCAGG - Intergenic
1018057838 6:160067852-160067874 CACACAGCAGGGGCCATGCCCGG - Intronic
1019346276 7:532264-532286 GACACAGGAGTTCCCCCGCCTGG - Intergenic
1021934699 7:25618411-25618433 CACACAGAGGTGGCCTTGCCAGG - Intergenic
1023689665 7:42772887-42772909 CACAGGGGATTGTCCCAGCCAGG - Intergenic
1024029655 7:45448270-45448292 CAAACAGAAGTGGCCCTGCAAGG + Intergenic
1026133819 7:67642061-67642083 CACACAGGACTGCCCGAGGCTGG + Intergenic
1026207574 7:68271607-68271629 CATAAAGAAGTGGCCCAGGCTGG + Intergenic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1033504630 7:141987556-141987578 CACACAGAAGTGGACCATGCAGG + Intronic
1033629125 7:143139946-143139968 GGCACAGGAGTGGCAGAGCCAGG + Intergenic
1034445111 7:151110136-151110158 CTCAAAAGACTGGCCCAGCCAGG + Intronic
1035000646 7:155609950-155609972 CACACCCGTGTGGCCCACCCAGG + Intergenic
1035401226 7:158567250-158567272 CACACAGGTGTGTGCCAGGCAGG - Intronic
1036295053 8:7528694-7528716 TCCACATGAGAGGCCCAGCCAGG + Intergenic
1036327510 8:7792297-7792319 TCCACATGAGAGGCCCAGCCAGG - Intergenic
1039150780 8:34502849-34502871 CACACATCAGTGGCTAAGCCAGG + Intergenic
1039389925 8:37171391-37171413 AGCTCAGGAGTTGCCCAGCCTGG + Intergenic
1039404260 8:37299147-37299169 CACACAGGGGTACCCCACCCAGG + Intergenic
1039622447 8:39010805-39010827 GACACGGAAGTGGCCCAGCAGGG + Intronic
1040291681 8:46128738-46128760 CACCCAGGATTGTCCCAGGCGGG - Intergenic
1040738366 8:50539588-50539610 CTGACAGGTGTGGCCCAGCAAGG - Intronic
1040958657 8:53006874-53006896 CACACAGGAGTCCCACTGCCAGG - Intergenic
1041153959 8:54964441-54964463 CACACAGGAGGGAACCAACCTGG - Intergenic
1041320952 8:56611980-56612002 CAGACGGCAGTGGCCCAGCCTGG - Intergenic
1043428836 8:80174992-80175014 CACAAGGGAGTGGGCCAGCCTGG - Intronic
1047740175 8:127800375-127800397 CACACAGTAGTGGGGCAGGCTGG + Intergenic
1048277566 8:133078365-133078387 CTCACAACAGAGGCCCAGCCAGG + Intronic
1049045836 8:140150808-140150830 GACAGAGGGGTGGCCGAGCCTGG - Intronic
1049191055 8:141287853-141287875 CACACAGGAGGGCCCGGGCCAGG + Intronic
1049211572 8:141389021-141389043 CCTACAGGAGGGGCCCAGGCTGG - Intergenic
1049233016 8:141494007-141494029 CACACAGGCCTGTCCCAGGCGGG - Intergenic
1049260451 8:141636205-141636227 CATACACGAGTGCCCCTGCCTGG - Intergenic
1049280040 8:141739683-141739705 CAGTCAGGGCTGGCCCAGCCTGG - Intergenic
1049521301 8:143092768-143092790 CACACAGGGCAGGGCCAGCCGGG + Intergenic
1049773732 8:144395374-144395396 CACACACCAGTGGCCCGGCCAGG + Intronic
1056495238 9:87149142-87149164 CACACAGGACTACCCCAGTCAGG - Intronic
1057198855 9:93129893-93129915 CACACAGGAGGGTCCCAGGGAGG + Intronic
1057263893 9:93601588-93601610 CTCGCAGCAGTGGGCCAGCCTGG - Intronic
1057694029 9:97311002-97311024 AACACATGAGTGGCAGAGCCAGG + Intronic
1057911839 9:99025729-99025751 CAGTCAGCAGTGACCCAGCCTGG + Intronic
1059345597 9:113625790-113625812 CACAGGGCAGTGGCCCGGCCAGG - Intergenic
1060148554 9:121271829-121271851 GACACAGGACTTGCCCAGCAAGG + Intronic
1060237997 9:121879605-121879627 CACACAGGGGTGGCAAAGGCAGG + Intronic
1060372083 9:123083736-123083758 CACACAGCAGAGGCGGAGCCAGG - Intronic
1060552063 9:124490381-124490403 CAGACTGGAGTGGCCCAGGCAGG + Intronic
1060813322 9:126622309-126622331 CTCACAGCACTGGCCCGGCCAGG - Intronic
1061144153 9:128787398-128787420 TGGCCAGGAGTGGCCCAGCCGGG - Intronic
1061245752 9:129400684-129400706 CACACAGGAGGAGCCCAGATGGG + Intergenic
1061429981 9:130524660-130524682 GCCACACGAGAGGCCCAGCCAGG + Intergenic
1061521302 9:131119879-131119901 CGCAGAGGCGTGGCCCAGCCTGG + Intronic
1061904737 9:133690824-133690846 CACACAGGCCTAGGCCAGCCTGG + Intronic
1062119839 9:134828248-134828270 CACACAGGCTGGGCCCAGCAGGG - Intronic
1062123142 9:134844995-134845017 CCCTCAGGAGTGGCCAAGGCTGG + Intergenic
1062357961 9:136173929-136173951 CACACAGAAGGGGTCCAGGCAGG + Intergenic
1062437787 9:136554297-136554319 CCCACAGGCCTGGCCCAGGCTGG - Intergenic
1062467802 9:136688835-136688857 CAGACAGGAGTGCCGCTGCCGGG + Intergenic
1062495428 9:136829337-136829359 CACACGGGTGGGGCCCAGCCTGG + Intronic
1062569436 9:137178354-137178376 GACACAGGAGTGGCTCAGGGAGG - Intronic
1188124814 X:26354154-26354176 CACACAGGAGCCTGCCAGCCAGG - Intergenic
1188401574 X:29751886-29751908 CACACAGCTGTGCTCCAGCCTGG + Intronic
1190087730 X:47410314-47410336 CCGACAGGAGTGGCACAGACTGG + Exonic
1191846291 X:65550329-65550351 CTCAGAGTGGTGGCCCAGCCTGG + Intergenic
1192173277 X:68870156-68870178 CACACAGGAGTGGTCCAGGCAGG + Intergenic
1195936066 X:110126794-110126816 CACACAGGAGTGGCCCAGCCAGG - Intronic
1199975409 X:152892311-152892333 CAAAAAGGATTGGACCAGCCTGG - Intergenic
1201376803 Y:13331228-13331250 CACACAGGACTGATCCAGCTGGG + Intronic