ID: 1195938378

View in Genome Browser
Species Human (GRCh38)
Location X:110146329-110146351
Sequence TGGGTTAGACTGGTCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195938374_1195938378 -1 Left 1195938374 X:110146307-110146329 CCATAAAAATCTGTCAGGTAGCT 0: 1
1: 0
2: 3
3: 17
4: 167
Right 1195938378 X:110146329-110146351 TGGGTTAGACTGGTCTGACATGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195938378 Original CRISPR TGGGTTAGACTGGTCTGACA TGG Intronic
900486908 1:2927019-2927041 TGGGCTGGACTGGGCTGACCTGG + Intergenic
901350524 1:8591687-8591709 TGGCTTAGACAGGTTTGAAAAGG - Intronic
903358734 1:22763767-22763789 TGGGTTTCACTGGGCTGAAATGG + Intronic
904090522 1:27941817-27941839 TGGGTTGGGCTGAGCTGACAAGG + Intronic
907290655 1:53410382-53410404 TGGGTTAGAAAGGAGTGACACGG - Intergenic
908068360 1:60432415-60432437 TGGTTTAGACTGGTCAGTCTTGG - Intergenic
910073171 1:83243866-83243888 CAGGTTACACTGTTCTGACATGG - Intergenic
911125992 1:94341372-94341394 TAAGTTAGACTGGTCTGAATGGG + Intergenic
912584123 1:110746401-110746423 TGGTTTACACTGGCCTGACTAGG - Intergenic
915029700 1:152867621-152867643 TGGTCTAGGCTGGTATGACATGG + Intergenic
921971948 1:221159551-221159573 TGGGTTAAACAGATCAGACATGG + Intergenic
1071162095 10:82759138-82759160 TGGGTTAGTCTGGTGTTAAAAGG + Intronic
1072985196 10:100133364-100133386 TGGGCTAGATTGCTCTGAAAAGG - Intergenic
1083177137 11:60957473-60957495 TGGGTTAGTCTGTTCTTGCATGG + Intergenic
1083659607 11:64246053-64246075 TGGGTTAGACTGTGGTTACAAGG - Intronic
1084343914 11:68530185-68530207 TCTGTTAGACGGGTCTGACTTGG + Intronic
1089142896 11:116301682-116301704 TGGGATACACTGATCTAACATGG + Intergenic
1089366464 11:117923934-117923956 TGGCTTAAACTGGACTGAAACGG - Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1096265166 12:50116965-50116987 TGGTTTAGAGGGGTCAGACATGG - Intronic
1098382271 12:69881614-69881636 TGGGTGGGACTTGACTGACAGGG - Intronic
1099730026 12:86488995-86489017 TGGGTTAGAGTGGGCACACAGGG - Intronic
1100201798 12:92306654-92306676 TGGGTTAGAAATGTCTGCCATGG - Intergenic
1104663260 12:130627718-130627740 TGTGATAGACTGGGCTGAGAGGG - Intronic
1106943111 13:34798851-34798873 TGGGTTATAAAGGTCTGGCAAGG - Intergenic
1107777428 13:43861127-43861149 TGGCTTTAACTGGGCTGACAGGG + Intronic
1112346237 13:98592434-98592456 TGGTTTAGACAGGACAGACAGGG + Intergenic
1113327922 13:109300642-109300664 TTTGTTAGACTAGTCTGCCAGGG - Intergenic
1119434552 14:74589547-74589569 TGGGTTACAATTCTCTGACATGG - Intronic
1123059801 14:105589403-105589425 TGGGCTAGACTGGGCTGAGCTGG - Intergenic
1126932478 15:53670421-53670443 TGGGTTATGCTGAACTGACAGGG - Intronic
1133092500 16:3415163-3415185 TTGGTTAGGCTGGTCTCAAATGG + Intronic
1133126707 16:3652007-3652029 TGGAGGAGCCTGGTCTGACATGG - Intronic
1134213969 16:12301509-12301531 TGGATCAGACTGGACTGCCAGGG - Intronic
1134378115 16:13698324-13698346 TGTCTAAGACTGATCTGACAGGG - Intergenic
1143513473 17:7408088-7408110 TGGGTTAGACTGGACAGAGAAGG - Intronic
1147455372 17:40534684-40534706 CAGGTCAGAGTGGTCTGACAAGG + Intergenic
1151515164 17:74589171-74589193 TGTGTTATACTGGTCTGATGGGG + Intronic
1155650287 18:28132986-28133008 TGTGTGAGATTGGTTTGACATGG - Intronic
1156312320 18:35935944-35935966 TGGGCTAGACTGGTCAGGCCCGG - Intergenic
1156983982 18:43327098-43327120 TGGTTTAGTCTGGTCTGTTAAGG - Intergenic
1158086995 18:53662780-53662802 TGTGTTAGTCTGTTCTTACATGG - Intergenic
1161532176 19:4796567-4796589 GGGGTTTGACTGTTCTGATATGG - Exonic
1162494210 19:11014068-11014090 GGGGTTAGTCTGGTCTGATTGGG + Intronic
1164535609 19:29084647-29084669 TGGGTTAGAGAGGCCTGAAAGGG + Intergenic
1165531347 19:36404491-36404513 TGGTTTTGACTGGTCTCCCAAGG + Intronic
926931567 2:18046510-18046532 TGGGTTGGACTGGCATGCCATGG + Intronic
927642927 2:24856839-24856861 TGGGAGAGACTGGTCTCCCAGGG + Intronic
931630194 2:64291491-64291513 TGGCTTAGGCTGTTCTCACAGGG - Intergenic
931880699 2:66567485-66567507 TCGGTTGGACTGGTCTATCATGG - Exonic
1170339581 20:15308870-15308892 TGGGTCAGACTGGCTTGACTGGG + Intronic
1171122760 20:22580344-22580366 TGGGTTAGAAAGGTCTGCCATGG + Intergenic
1174048218 20:47748658-47748680 TGGGTTGGATTTGACTGACAAGG + Intronic
1175111418 20:56650852-56650874 TGGGCTGGGCTGGTCTGGCATGG + Intergenic
1175244442 20:57573163-57573185 TGGGCTAGACTGGTCTCCCAGGG - Intergenic
1175635867 20:60582577-60582599 GGGGATAGACTGGTCTGGCAAGG - Intergenic
1180900497 22:19368631-19368653 TGGTTCAGACTGATCTGAAAGGG + Intronic
1183099805 22:35576916-35576938 TGGGTCAGACTGGGTCGACATGG + Intergenic
1185122476 22:48980552-48980574 TGGGTTGGACTGGTGTGGGAAGG - Intergenic
1185306414 22:50119807-50119829 TGGGTGAGACTGCACTGAAATGG + Intronic
955821972 3:62906079-62906101 TGGGTTTGACTGGTCTAGGATGG - Intergenic
956454803 3:69409947-69409969 TGGTTTAAGCTGGTCTGAAATGG + Intronic
961906326 3:130266497-130266519 TGGGTTTGACAGTTCTGATATGG + Intergenic
962757068 3:138473119-138473141 TGAGTTATACTGGGATGACATGG + Intronic
964281245 3:155068506-155068528 TATTTTAGGCTGGTCTGACACGG + Intronic
969078424 4:4599190-4599212 TGGGTAAGACTGCATTGACACGG - Intergenic
969318320 4:6395390-6395412 TTGGTCAGACTGGTCTGGGAGGG - Intronic
971400845 4:26274011-26274033 TGGGAAAGACTTCTCTGACAAGG - Intronic
973850390 4:54956018-54956040 TACTTTACACTGGTCTGACATGG - Intergenic
975652968 4:76612997-76613019 TGGGATAGACTGATATTACATGG - Intronic
979169188 4:117578183-117578205 TGTGTTAGATGAGTCTGACAGGG + Intergenic
986267451 5:6202617-6202639 TGGGCCTGAATGGTCTGACATGG - Intergenic
986831244 5:11581164-11581186 TAGGTAAGTCTGGTTTGACAGGG - Intronic
992341132 5:75824380-75824402 TTGGTTAGGCTATTCTGACATGG + Intergenic
998524345 5:142828696-142828718 TGGGGTAGTCTGGTTTGGCAAGG + Intronic
998764866 5:145474882-145474904 TGGGGTACACTGGACTGAGATGG + Intronic
1008013622 6:46492757-46492779 TGGGTTAGAATTGTCTGAAAGGG + Intergenic
1018916612 6:168136172-168136194 TGGGAGAGACTGGTCTGTGAAGG - Intergenic
1019714128 7:2530555-2530577 TGGGCTAGACTGGGGGGACATGG - Intergenic
1021795617 7:24250938-24250960 GGGGTTAGACTTGCTTGACATGG + Intergenic
1023175757 7:37433885-37433907 TGGGTTAGCCTGGCCTGATGAGG - Intronic
1023263371 7:38380223-38380245 TGGGCTGGACTGGTTTTACAGGG + Intergenic
1023912914 7:44568098-44568120 TGGGTGAGTGTGGCCTGACAGGG - Exonic
1027290847 7:76708742-76708764 CAGGTTACACTGTTCTGACATGG - Intergenic
1030490047 7:110220869-110220891 TGTGTTAGTCAGGTTTGACATGG - Intergenic
1035552506 8:540081-540103 TGGTTTAGATGGGTCTGACATGG - Intronic
1037689042 8:21167497-21167519 TGGGTGAGACTGGGCAGCCACGG - Intergenic
1042064006 8:64853868-64853890 TCCGTTAGACTTGGCTGACATGG - Intergenic
1044804960 8:95996778-95996800 TGGGGTTGTCTGGTCTGAGATGG - Intergenic
1049383683 8:142330348-142330370 TGGGTTGGGCTGGTCTGGGATGG - Intronic
1049513580 8:143042247-143042269 GGGGTTAGACTGGTCTCCCCTGG - Intronic
1050328629 9:4522543-4522565 TGTATTAGCCTGTTCTGACAAGG + Intronic
1052487188 9:29117466-29117488 TGGTTTAGACTGATCCTACAAGG + Intergenic
1060730111 9:126031606-126031628 TGGGATAAACTGGACTGCCAAGG - Intergenic
1062255813 9:135620077-135620099 TGGGGGAGACTGGGCAGACAGGG - Intergenic
1062282093 9:135756720-135756742 TGGCTAAGACTGTCCTGACATGG + Intronic
1203727056 Un_GL000216v2:58465-58487 TGGATTAGAATGGAATGACATGG - Intergenic
1203727084 Un_GL000216v2:58690-58712 TGGATTAGAATGGAATGACATGG - Intergenic
1192980614 X:76335961-76335983 TGTGTTAGACTGTTCTCACATGG - Intergenic
1195938378 X:110146329-110146351 TGGGTTAGACTGGTCTGACATGG + Intronic
1196298627 X:114029154-114029176 TGGTTTGGTCTGGTCTGACTGGG + Intergenic
1201107055 Y:10771106-10771128 TGGTTTAGAATGGACTGGCATGG - Intergenic