ID: 1195940270

View in Genome Browser
Species Human (GRCh38)
Location X:110161941-110161963
Sequence TGAGAATTTTTATTAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 654}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195940270_1195940271 -7 Left 1195940270 X:110161941-110161963 CCTGTTATTAATAAAAATTCTCA 0: 1
1: 0
2: 4
3: 67
4: 654
Right 1195940271 X:110161957-110161979 ATTCTCAGATTCCAGATTCCAGG 0: 1
1: 0
2: 3
3: 27
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195940270 Original CRISPR TGAGAATTTTTATTAATAAC AGG (reversed) Intronic
900082419 1:868199-868221 TTAGTATTTGTATTAATATCAGG - Intergenic
900668897 1:3837077-3837099 TGAGCATGTTTATTAAAATCAGG - Intronic
905061346 1:35141925-35141947 TGAGAATTTTCACTAATCAGTGG + Intergenic
905288264 1:36901490-36901512 TGAGAGTTTTTATCATTAATGGG - Intronic
905577426 1:39056553-39056575 TGAGAGTTTTTATTATGAATGGG - Intergenic
906393815 1:45442955-45442977 TTAGTATTTTTAGTAATGACGGG + Intronic
906756712 1:48324643-48324665 TGAGAGTTTTTATTATGAAGGGG - Intronic
906836734 1:49091503-49091525 TTTGACTTTTTAATAATAACTGG - Intronic
908498086 1:64715112-64715134 TTAGTATTATTATTAATATCAGG - Intergenic
908631054 1:66107405-66107427 TGATAATTTTTAATAAATACAGG - Intronic
909143936 1:71904204-71904226 TGCGGATATTTAGTAATAACTGG + Intronic
909218953 1:72929652-72929674 CCAGATTTTTTTTTAATAACTGG - Intergenic
909219329 1:72935125-72935147 ACAGAATTTTTAATAAAAACTGG - Intergenic
909464893 1:75962197-75962219 TGACAATACTTATTAAAAACTGG - Intergenic
910127844 1:83863423-83863445 TGAGAACTTTGCATAATAACAGG - Intergenic
910326410 1:86013217-86013239 TGATAGCTTTTGTTAATAACTGG - Intronic
910372718 1:86534287-86534309 TGAGAATTTTTATCATGAATGGG + Intergenic
910724021 1:90319442-90319464 TGAGAGTTTTTATTATGAAAGGG + Intergenic
910775020 1:90866146-90866168 TGAAAATTTTTATTATTAATGGG - Intergenic
911286431 1:95999470-95999492 TGAGGATTTTTATCATGAACAGG - Intergenic
911650728 1:100385316-100385338 TGAGAATTTACATTTCTAACAGG - Intronic
911934782 1:103955693-103955715 TGAGAGTTTTTATTCATGAATGG + Intergenic
911946047 1:104110693-104110715 TGAGAGTTTTTATTAAGAATGGG + Intergenic
912479671 1:109972090-109972112 TGACAATTTTTTTTTATAAAAGG - Intergenic
912914646 1:113801703-113801725 TGAAAGTTTTTCTTAATCACAGG - Intronic
913395081 1:118360144-118360166 TGAGATTTTTTATTGAAATCAGG - Intergenic
913425491 1:118724385-118724407 TGAGAATTTTTATCATGAAATGG - Intergenic
914521540 1:148421354-148421376 TGAGATTTTCTATTTATCACTGG + Intergenic
914646954 1:149661836-149661858 TGAGATTTTCTATTTATCACTGG + Intergenic
915412828 1:155716230-155716252 AGTGAATTTTAAATAATAACAGG + Intronic
915857042 1:159399247-159399269 TGAGAGGTTTTATTAATACCAGG + Intergenic
916102476 1:161404671-161404693 TGAGAATTTTCACTAATTAGTGG + Intergenic
916636726 1:166678309-166678331 TGAGAATTTTTTTTTATAAAAGG + Intergenic
916775990 1:167965089-167965111 TTGTAATTTTTCTTAATAACTGG + Intronic
916899877 1:169209930-169209952 CAAGAAATTATATTAATAACAGG - Intronic
917218726 1:172704792-172704814 AGAGAATTTTTTTTGACAACTGG - Intergenic
917334131 1:173911073-173911095 TGATAATATTTATTAACTACAGG - Intronic
918136388 1:181677827-181677849 GGAGAAGTTTTAGGAATAACAGG + Intronic
918480834 1:184974840-184974862 TGAGATTTTGTATTTCTAACAGG - Intergenic
918598111 1:186317337-186317359 AGAGAAATTTTATTATTAAAAGG - Intronic
918635437 1:186768724-186768746 AGATAATTTTTTTTAATAACAGG + Intergenic
918795670 1:188892283-188892305 TGAGAGTTTTTATCATTAAAGGG - Intergenic
919181786 1:194094034-194094056 TAAGAGTATTTATTAATAAGTGG - Intergenic
919367382 1:196680247-196680269 TGAATATTTTTGTTAACAACAGG + Intronic
919562291 1:199136776-199136798 AGAGATTTTTTTTTAAAAACAGG - Intergenic
921028650 1:211316129-211316151 TGACAATTTTCATTAATTTCAGG + Intronic
921816478 1:219569586-219569608 TTAGAATTATTATTTCTAACTGG - Intergenic
922038112 1:221869748-221869770 TGAAGATCTTTAATAATAACTGG + Intergenic
922655740 1:227382135-227382157 TGAGAGTTTTTATCATGAACGGG - Intergenic
923090156 1:230734666-230734688 TGAAAAATTTAATTAATAGCTGG + Intergenic
923888518 1:238184856-238184878 TTATAATTTTTATTGAAAACTGG + Intergenic
924865987 1:247980956-247980978 TTAAAATTTTTATTGATCACAGG + Intronic
924939115 1:248799349-248799371 TGAGAATTTTTATCATAAATGGG + Intergenic
1062935854 10:1388182-1388204 TGAGAATTTTCATGAAGAATGGG - Intronic
1063202649 10:3799262-3799284 TGAGAGTTTTTATTATGAAGAGG + Intergenic
1064447194 10:15406277-15406299 TGAGATTTTATTTTAAAAACAGG - Intergenic
1064469376 10:15619944-15619966 TTAGACATTTTATAAATAACAGG + Intronic
1065128683 10:22598976-22598998 TCAGTATTTTTATTTAGAACAGG - Intronic
1066114316 10:32226183-32226205 TGAGAATTGTTACAAAGAACTGG - Intergenic
1068274846 10:54781057-54781079 TGATGATTTTTATTAAAAAGTGG - Intronic
1068444092 10:57097626-57097648 CTAGAATTTTTTTTAATAAAAGG + Intergenic
1068649254 10:59503225-59503247 TGTGAATTTTTAGTAGTGACAGG - Intergenic
1069030856 10:63594756-63594778 TGAGTATTTTTATTATTTCCAGG + Exonic
1070694967 10:78555810-78555832 TGAGAAGTTTTTTAAATAATAGG + Intergenic
1071013389 10:80965805-80965827 TTATAATTTTGATAAATAACTGG - Intergenic
1071219703 10:83451029-83451051 TGAGTATTTTTATCATAAACAGG - Intergenic
1071615126 10:87068187-87068209 GAAGAATTTTTCTTAAAAACTGG - Intronic
1071953020 10:90726807-90726829 TAGGAATTTTTTTTAATAATTGG - Intergenic
1072142552 10:92601958-92601980 TGAGCATTTTTATGACTAATGGG + Intronic
1072345789 10:94504226-94504248 TTGCAATTTTTATTGATAACTGG + Intronic
1072412971 10:95221870-95221892 TGAGAATTTTTATCATCAAAAGG - Intronic
1072448019 10:95516197-95516219 AGAGGATTTTTATTTCTAACAGG - Intronic
1072497374 10:95975192-95975214 TGAAAATTGTTATACATAACTGG + Intronic
1072554294 10:96502921-96502943 TGAGAATATTTATTGGTAATTGG + Intronic
1074227498 10:111500126-111500148 TAAGAATTTTTATTATAAATGGG - Intergenic
1076389552 10:130088509-130088531 TGAGAATTTTTATTGACTAATGG + Intergenic
1077938709 11:6817701-6817723 TGAGAATTTTTATTATGAAAGGG - Intergenic
1078173249 11:8946739-8946761 TGAGAATTTTTATCATGAATGGG + Intergenic
1079585226 11:22117841-22117863 TATGGATTTTTATTAATAAAAGG + Intergenic
1079660071 11:23026569-23026591 TGAGACTTTATTTTAATATCAGG - Intergenic
1079663116 11:23066946-23066968 TGAGAGTTTTTATTATGAATGGG + Intergenic
1079782326 11:24623180-24623202 TGGGACTTTTCATTAATAAAAGG - Intronic
1079944907 11:26730142-26730164 TGAGTATTTTTTTTAATATCAGG + Intergenic
1080085952 11:28282347-28282369 TGAGAATTTTTATTGTTACAAGG - Intronic
1080185866 11:29485162-29485184 TGAGAATTTTAATTACCATCAGG + Intergenic
1080342713 11:31285629-31285651 TAAGTTTTTTTATTAATAAATGG + Intronic
1080758913 11:35228859-35228881 TGAGAATTTGTATTTCTAACAGG + Intronic
1080910387 11:36591808-36591830 TGAGAATTTTCATGGAAAACTGG - Intronic
1081196820 11:40171516-40171538 TGAAAATTTTTACTAATATTGGG - Intronic
1081302673 11:41472033-41472055 TGCAAATTATTATTACTAACAGG + Intergenic
1081544054 11:44057265-44057287 TGAAAGTTTTAATTAATAGCTGG + Intronic
1083502312 11:63121303-63121325 TGAGAATTTTTTTTACTAATAGG - Intronic
1084920664 11:72466939-72466961 TTTGAATTTTTATTAGTGACAGG - Intergenic
1085166342 11:74403662-74403684 TTTGAATTTTCATTAATATCTGG + Intergenic
1085890836 11:80577042-80577064 TGAGAATTTTTATGATAAATCGG - Intergenic
1086464088 11:87036207-87036229 TGGGAAGTTTTTTTAAAAACAGG + Intergenic
1086667274 11:89498508-89498530 TGTGAATTTTTAATATAAACGGG - Intergenic
1086721768 11:90129451-90129473 AGAGAATTATTTTTATTAACTGG - Intergenic
1086815715 11:91367894-91367916 TGAGAATTTTAATTTCTAACAGG - Intergenic
1087479604 11:98681825-98681847 TGAGAATTATTACTAATTATTGG - Intergenic
1087565417 11:99850399-99850421 TGACACCTTTTATTAATATCTGG + Intronic
1087637912 11:100723947-100723969 TGAGAGTTTTTATTATGAATTGG + Intronic
1087673632 11:101133764-101133786 TGAGACTTTTTATTTGAAACTGG + Intergenic
1087933460 11:104004296-104004318 TGAAAATATTTATTAAAAACAGG + Intronic
1088172552 11:107015757-107015779 TGAAAATATTTATTTACAACAGG - Intronic
1088186350 11:107175995-107176017 TGATATTGTTTATTAGTAACTGG - Intergenic
1088671187 11:112142597-112142619 TGAGAATTTTTATTATGAATTGG + Intronic
1088998156 11:115021787-115021809 TGTGATTTTTTGTTGATAACTGG - Intergenic
1089449050 11:118578588-118578610 TGAGAAATATTATTAATAAATGG - Intronic
1089475943 11:118761909-118761931 AGAGAACATTTATTAATCACTGG - Intronic
1089989385 11:122844530-122844552 TCAGTATTTTTATTAACAACAGG + Intronic
1090515491 11:127422105-127422127 TGAGAAATTTTATCAACATCAGG - Intergenic
1092637275 12:10465755-10465777 TGAGAATTTTTAATATGAAGTGG + Intergenic
1093095578 12:14968137-14968159 TGAGAGTTTTTATCATTAATGGG + Intergenic
1093606316 12:21093775-21093797 TGAGAGTTTTTATTATGAAGAGG + Intronic
1093672847 12:21898755-21898777 TGAGTATTCTCATGAATAACAGG - Intronic
1093758078 12:22874963-22874985 TGAGAATTTTTTTTAAGAGTAGG - Intergenic
1093759132 12:22886744-22886766 TGAGAATTTTAATTATAAATGGG + Intergenic
1094055306 12:26263240-26263262 TGAGAGTTTTTAATCATAAATGG - Intronic
1094080249 12:26526899-26526921 TGATATTATTTATTAATAAGAGG + Intronic
1094314680 12:29126064-29126086 TGAGAATTTTTATCATAAATGGG + Intergenic
1095608602 12:44100764-44100786 TGAGTACTTTTATTAAGCACTGG - Intronic
1096563817 12:52458796-52458818 TGAGAATTTTTAATATGAAGCGG + Intergenic
1097374597 12:58826342-58826364 TGAGAGTTTTTATTATGAAGGGG - Intergenic
1097673708 12:62573043-62573065 TCAGAATTTAAAATAATAACAGG + Intronic
1097992667 12:65852564-65852586 TTAGAAGTTATATAAATAACAGG - Intronic
1098113638 12:67151334-67151356 GGAGAATTTCTTTAAATAACAGG - Intergenic
1098413792 12:70210158-70210180 TGAGAATTTTTAATCATGAAAGG + Intergenic
1099033057 12:77553129-77553151 TGAAAATTTTTACTGATTACTGG + Intergenic
1099351179 12:81570637-81570659 TGAAAATTTTTCTTAAAAAGGGG + Intronic
1099370067 12:81818012-81818034 TCAGAATGTTTATTAATAAAAGG + Intergenic
1099458244 12:82891246-82891268 TGAGATGTTTTATTAAAAATTGG + Intronic
1103249625 12:119488433-119488455 TGAGAATTTGTATATATAGCAGG - Intronic
1105479859 13:20764804-20764826 TGAGCACTTTTATTGATAGCAGG - Intronic
1105686654 13:22789885-22789907 TTTCAATTTTTATTCATAACAGG - Intergenic
1105942418 13:25160548-25160570 TAGGAATTTTAATTAAGAACTGG - Intergenic
1106939040 13:34755861-34755883 TAAGAATTTTTCTTTATTACAGG - Intergenic
1106948892 13:34860629-34860651 TGAATATTTTTATCAACAACCGG + Intergenic
1107647176 13:42506597-42506619 TGAGAATTTTTAGTATGAAGAGG + Intergenic
1107995426 13:45855058-45855080 TGAGAGTTTTTATTATGAATGGG + Intergenic
1108026924 13:46187781-46187803 TTAGAATTTTTTTTAATGCCAGG + Intronic
1108099661 13:46941191-46941213 TGAGAGTTTTTAATCATAAAGGG - Intergenic
1108371442 13:49773539-49773561 TTACAATTTTTTTTAATTACAGG - Intronic
1108819582 13:54331752-54331774 TGAGAATTCTCATTTATTACTGG + Intergenic
1108890065 13:55245646-55245668 TGTAAATTTTCATTAATATCAGG - Intergenic
1109592574 13:64505455-64505477 TGAGAATTTTTTTATATAAAGGG + Intergenic
1109751995 13:66706573-66706595 TGTAGATTTTTAATAATAACTGG - Intronic
1110010125 13:70322134-70322156 GGAGAATTCTTGTTAATAATTGG - Intergenic
1110607003 13:77444789-77444811 TTAGAATTTTTATTTAAAAAAGG + Intergenic
1110895413 13:80745164-80745186 TAACAATATTTATTAATGACTGG + Intergenic
1110946088 13:81419700-81419722 TGAGGATTTTTTATCATAACAGG + Intergenic
1110963097 13:81656177-81656199 TAAGAATTTTTATAATAAACTGG + Intergenic
1110987339 13:81986993-81987015 TGAGAATTTTTAGCAATAAATGG + Intergenic
1111244101 13:85512221-85512243 TGATAATCTATTTTAATAACTGG + Intergenic
1111465257 13:88600020-88600042 TGAGAATTTGTATTCATTGCTGG - Intergenic
1111580819 13:90220931-90220953 TGAGTATTTCTATTATGAACAGG - Intergenic
1111958045 13:94779707-94779729 TGAGAATTTGTTTTTCTAACAGG + Intergenic
1112049880 13:95634891-95634913 TTGGAATAATTATTAATAACTGG + Intronic
1112641999 13:101285861-101285883 AGAGGGTTTTTATTAATAACTGG - Intronic
1112654153 13:101431676-101431698 TGACAATTTTCATATATAACAGG - Intergenic
1112720653 13:102240855-102240877 TGATAATTTTTTTAAATAAGAGG - Intronic
1113106051 13:106772529-106772551 TGAGAAATTTTATCAGAAACCGG - Intergenic
1113500922 13:110773505-110773527 TAAAAATTTATTTTAATAACAGG - Intergenic
1113729706 13:112632260-112632282 TTTGAATTTTTATTAAAGACAGG - Intergenic
1114580594 14:23755966-23755988 TGAGACTATTCACTAATAACTGG - Intergenic
1115661263 14:35496615-35496637 TGAGAGATTTTATCAATACCAGG + Intergenic
1116089123 14:40281465-40281487 TGATAATTTTGATTAATTTCTGG - Intergenic
1116501519 14:45629299-45629321 TGAGAGTTTTTATTATGAATGGG - Intergenic
1116563421 14:46413589-46413611 TGAGAATTCTAGTAAATAACAGG - Intergenic
1117310887 14:54521674-54521696 TTTGTATTTTTATTAATGACAGG + Intronic
1117527719 14:56627269-56627291 TGAGAAATGTTTTTAAAAACTGG + Intronic
1117673747 14:58134654-58134676 TCAAAGTTTTTATTAATGACAGG + Intronic
1118491167 14:66262124-66262146 TGAGAGTTTTTATCAATAAAGGG + Intergenic
1118523821 14:66617702-66617724 TGAGAGTTTTTTTTCATAAATGG + Intronic
1118526962 14:66655791-66655813 TGAGAATTTTTATCATGAATTGG + Intronic
1118574356 14:67226660-67226682 TGAGCATTTTGTTTATTAACAGG + Intronic
1118857031 14:69631622-69631644 ACAGAATTATTATTATTAACTGG - Intronic
1119344966 14:73915726-73915748 TGAGAATTTTTATTATGAATGGG + Intronic
1119631840 14:76238874-76238896 TGAGAATTTGCATTTCTAACAGG + Intronic
1119632553 14:76246132-76246154 GGGGAATTTTTTTTAATCACAGG + Intronic
1119958588 14:78828350-78828372 TGAATATTTTCATTAAGAACTGG + Intronic
1120336147 14:83157991-83158013 TGAGAATTTTTATCATGAATAGG - Intergenic
1120407558 14:84107585-84107607 TGAATATTTCTATTAATAAATGG + Intergenic
1121398070 14:93645059-93645081 TGAGAGTTTTTATTAATACCAGG + Intronic
1121899350 14:97678673-97678695 TGAGAATTTTTATCATGAAGTGG - Intergenic
1122565406 14:102651233-102651255 TGAGTATTGCTATTAATAAAGGG + Intronic
1123163116 14:106299338-106299360 TGAGAGTTTTTAGTATTAAGGGG - Intergenic
1123714654 15:23018455-23018477 TGAGAATTTTTGTGAAAAATAGG - Intronic
1123953120 15:25304280-25304302 TGAGTATTTTTATTATAAAATGG + Intergenic
1124599594 15:31122131-31122153 TGAGAGTTTTTATTATATACAGG - Intronic
1125165252 15:36696589-36696611 TTAGAATTTTTTTTAAGAGCGGG + Intronic
1125432833 15:39613903-39613925 TGAGAATTTTTATCATGAAATGG - Intronic
1125964851 15:43865754-43865776 TAAGAATTTTCATTAATGATGGG + Intronic
1126160301 15:45606138-45606160 TGAGCATTTTTACTAATAGCTGG + Intronic
1126537855 15:49786318-49786340 TGAGAGTTTTTAATCATAAATGG + Intergenic
1126915294 15:53459613-53459635 TGAGAATCTTTATTTGTAAAAGG + Intergenic
1126989786 15:54361076-54361098 TAGGAATTTTTATTAATATTTGG + Intronic
1126996837 15:54453725-54453747 TGAGAATATCTATTTATAGCTGG - Intronic
1127402881 15:58608332-58608354 TGATAATCTGTATTACTAACTGG + Intronic
1127428582 15:58880460-58880482 TGAGAATTTGCATTTCTAACAGG - Intronic
1127512805 15:59658919-59658941 TGAGATTTTTTTTTAATTAATGG - Intergenic
1128695353 15:69757795-69757817 TTAGAATTTTTATTGATCCCAGG - Intergenic
1128872192 15:71168558-71168580 TTAGAGTTTCTATAAATAACAGG - Intronic
1129448371 15:75634701-75634723 TGAGAATTTGCATTTCTAACAGG - Intergenic
1129577589 15:76767355-76767377 TGTGAAATTATATAAATAACAGG + Intronic
1129605741 15:77024194-77024216 TGAGAATCTGTATTTCTAACAGG + Intronic
1131361373 15:91793683-91793705 TGGGAATTTTTATTAAGGAAAGG + Intergenic
1131722862 15:95189471-95189493 TGAGAATTTTTCATCATAAAGGG + Intergenic
1132000234 15:98171971-98171993 TTAGAATTTTTCTTTATCACTGG + Intergenic
1132325309 15:100963992-100964014 TAGGAATTTTTGTTAATAAGAGG - Intronic
1133618670 16:7504876-7504898 TGTTAGTTTGTATTAATAACAGG + Intronic
1133696630 16:8269720-8269742 TGAGAGTTTTTAATCATAAAAGG + Intergenic
1134470816 16:14524139-14524161 TGAGAATTTTAATACATCACAGG - Intronic
1134621951 16:15696211-15696233 TAAAAATTTTTTTTATTAACTGG + Intronic
1135543606 16:23351194-23351216 AGAGAATCTTTAATAATAATAGG + Intronic
1135633210 16:24052280-24052302 TGAGAATTTGAATTTCTAACAGG + Intronic
1137653758 16:50142461-50142483 TGACAATTATTAATAATACCAGG + Intergenic
1137703260 16:50513878-50513900 TGAGCATTTTTAATCATAAAAGG + Intergenic
1138835173 16:60425882-60425904 CGAAAATTTTAATTAAAAACAGG - Intergenic
1138870750 16:60880627-60880649 TGAGAAAATTTTATAATAACTGG - Intergenic
1140381266 16:74489970-74489992 TTAGCATTTTTATTAAAAACTGG - Intronic
1141328703 16:83087724-83087746 TGAGAACATTAATAAATAACAGG - Intronic
1141473251 16:84253727-84253749 TCAAAATCTATATTAATAACAGG + Intergenic
1141765473 16:86055865-86055887 TGAGAATTTTTATCATGAATTGG - Intergenic
1143442407 17:6985618-6985640 TTAGAATTTTAAATAAGAACAGG - Intronic
1143738882 17:8937431-8937453 TGAGAATTTTTATCATAAATGGG + Intronic
1143979879 17:10859643-10859665 TTAGTATTCTCATTAATAACAGG + Intergenic
1144175457 17:12700768-12700790 TGAGAATTCTTATTTATAATTGG + Intronic
1147354237 17:39880694-39880716 TGAGAATTTTTATCACAAATGGG + Intergenic
1149054745 17:52350200-52350222 TTTTAATTTTTATTAGTAACTGG + Intergenic
1149633322 17:58144152-58144174 TGTAAATTTTTGTTGATAACTGG - Intergenic
1149648633 17:58260578-58260600 TGAGAGTTTTTATCATGAACAGG + Intronic
1150923686 17:69510146-69510168 TGAGAACTTTTATTATGAATGGG + Intronic
1153363105 18:4221256-4221278 TGATAATGTTTAATTATAACAGG - Intronic
1153660770 18:7324162-7324184 TCAGAATTTTTCATAATAAAAGG - Intergenic
1153861877 18:9219511-9219533 TGACAATTTTTTTCAATAAAGGG + Intronic
1154505045 18:15029123-15029145 TGAGAATTTTTATTCTCAAGAGG - Intergenic
1154997054 18:21650279-21650301 TGAAAATTATTATTATTAGCTGG + Intergenic
1155829941 18:30501909-30501931 TGAGAATTTTTAATAACAATAGG + Intergenic
1156397411 18:36710891-36710913 TAAGAATTATTAATCATAACTGG + Intronic
1156864351 18:41872495-41872517 TGAGAATTTGCATTTCTAACAGG + Intergenic
1156966256 18:43097207-43097229 TGAGCATTTGTATTTCTAACAGG + Intronic
1157029978 18:43894153-43894175 TGAGGATATTTATTTATAAAAGG - Intergenic
1157033397 18:43941295-43941317 TGATAATTTTTATTAGTAAAGGG - Intergenic
1157692547 18:49695421-49695443 TGAGAATTTTTTTTAAGACAGGG + Intergenic
1158223447 18:55174431-55174453 TGAGCATTTTTATTATAAATGGG - Intergenic
1158269627 18:55698482-55698504 TGAAAATTTGTATTTTTAACAGG + Intergenic
1158999307 18:62956936-62956958 TGAGAATTTTTCCAAATAAAAGG + Intronic
1159046312 18:63371668-63371690 TGAGAATTTTAATTATGAATGGG - Intergenic
1159194248 18:65091126-65091148 AGACACTTTTTATTAATACCTGG - Intergenic
1159482287 18:69005065-69005087 TAAGAATTTATCTTAAAAACAGG + Intronic
1159500101 18:69257746-69257768 TGAGAATTTTAATTGGCAACAGG - Intergenic
1159812483 18:73032581-73032603 TGAGAATTTTTATCATGAATGGG - Intergenic
1159818448 18:73107994-73108016 TGAAAATTTTTATTAAAAATGGG + Intergenic
1162721982 19:12668078-12668100 TGAAAAACTTTATTAACAACAGG + Exonic
1164415995 19:28046903-28046925 TGAGAATGGCTATGAATAACTGG - Intergenic
1164665640 19:30032906-30032928 TGTGAGTTTTTATTATTAGCAGG + Intergenic
1165401643 19:35604578-35604600 TGACAATTTTTATTTCTCACAGG - Intergenic
1168568958 19:57448396-57448418 TTATAATTATTATTATTAACGGG - Intronic
925378552 2:3406864-3406886 TGTATATATTTATTAATAACAGG - Intronic
925555818 2:5130634-5130656 TGATAATTTTTATTAGTCAGTGG + Intergenic
925601749 2:5615464-5615486 TGAGTATATTTATAAATAACAGG - Intergenic
926398761 2:12473126-12473148 TGAGAATTTCTATCTATAAATGG + Intergenic
926409258 2:12585073-12585095 TGAGGATTTTGATGAATGACAGG + Intergenic
926849266 2:17177007-17177029 TCAGAATTTTTTTTAATCCCTGG - Intergenic
926927334 2:18000979-18001001 TGACATTTTTTATTCATGACAGG - Intronic
928066250 2:28167366-28167388 TCTAAATCTTTATTAATAACGGG + Intronic
928266836 2:29819117-29819139 TGAGATTCTTTATTTATAACAGG - Intronic
928639507 2:33283388-33283410 GGAGAATTTTCATTAACAATTGG - Intronic
928734579 2:34272355-34272377 TGAGAATTTTTTTTAAAAAAAGG - Intergenic
928761129 2:34584295-34584317 TGAGAGTTTTTATTACAAAGTGG + Intergenic
929154680 2:38778746-38778768 TGAGAATTTTTATCAGGAAAAGG - Intronic
929268676 2:39947858-39947880 TGAGAATGATTATTCATAAAGGG + Intergenic
929404192 2:41622674-41622696 TGAGAAATATTTTTAATAAAAGG + Intergenic
929734735 2:44535688-44535710 TGAGAGTTTTTATTATGAATGGG - Intronic
929842109 2:45477979-45478001 TGTGAATTTTTATTGATATTTGG - Intronic
929913127 2:46109891-46109913 TGAGAATTTTTATAATGAATGGG + Intronic
930322325 2:49871543-49871565 TAACAATTTTTATTCATAAAAGG + Intergenic
930412945 2:51049951-51049973 TGAGAATTTTTATTATGACAAGG + Intergenic
930458956 2:51644796-51644818 TGAGAGTTTTTATTATAAAGGGG + Intergenic
930955758 2:57200749-57200771 TGAGATTTTCTATTTCTAACAGG - Intergenic
931553592 2:63474480-63474502 TGAGTATTTTCATAAATCACTGG - Intronic
931676725 2:64704298-64704320 TTCAAATTTTTAGTAATAACTGG - Intronic
932062568 2:68522143-68522165 AGAGAATTTCTATTAAAATCAGG - Intronic
932700313 2:73986876-73986898 TGACAATTTGTATGAGTAACTGG + Intronic
932711201 2:74064790-74064812 TGAAAAAATTTATTAATAAATGG + Intronic
933119581 2:78520170-78520192 TGAGACTTTTTATGAATCAGTGG - Intergenic
933327507 2:80857178-80857200 TACTAATTTTTTTTAATAACTGG - Intergenic
933386289 2:81614554-81614576 TAAGATTTTATATTAAAAACAGG - Intergenic
933583399 2:84152569-84152591 TGAGATTTTCTGTTAATAAATGG + Intergenic
934478756 2:94615062-94615084 TGAGCATTTTCATTGAAAACAGG - Intergenic
934894826 2:98107036-98107058 TGAGAATTTTTATTATTAATGGG + Intronic
935158098 2:100501898-100501920 TTATAATTTTTATTGAAAACGGG - Intergenic
935472940 2:103481046-103481068 TGAGAGTTTTTATTAGAAATGGG - Intergenic
935758773 2:106299390-106299412 TGAGAAATTCTAGTAAAAACAGG + Intergenic
936262418 2:110973241-110973263 TGAGTATTTTTATTACTTTCTGG + Intronic
936732672 2:115403200-115403222 TGAGAATTTTTATAAGAAAAGGG - Intronic
936749277 2:115621645-115621667 ATAGAATTTTTTTTAATAACAGG - Intronic
937194906 2:120144942-120144964 TGAGAGTTTTTATCATGAACAGG - Intronic
937593439 2:123643641-123643663 TGAAAAATTTTATTTAGAACAGG + Intergenic
937726280 2:125170262-125170284 TCATAATTGTTATTAAAAACTGG + Intergenic
937858128 2:126687390-126687412 TGAGAATTTCTATTTCTAACAGG + Intronic
937893179 2:126956028-126956050 TGTGAGTTTTTATTAAATACTGG - Intergenic
938043404 2:128095314-128095336 TGAGTGTTTTTATTTATAAGTGG + Intronic
938126413 2:128676268-128676290 TGAGAGTTTTTATGATTAATGGG - Intergenic
938226790 2:129623677-129623699 TGACAAGTTTTATTAATCACAGG - Intergenic
938504243 2:131859389-131859411 TGAGAATTTTTATTCTCAAGAGG - Intergenic
939383338 2:141464738-141464760 TGTGACTTTTTATTAAGATCTGG + Intronic
939539981 2:143481965-143481987 TGAGAATTTTCAATAACAATAGG - Intronic
939641077 2:144640576-144640598 TGAGAATTTGTATTTGTAACAGG + Intergenic
939817068 2:146909455-146909477 AGAGAATTATTATTCATAATTGG + Intergenic
940365932 2:152848838-152848860 TGAGAGTTTTTAATCATAATGGG + Intergenic
940471063 2:154100895-154100917 TGAGAGTTTTTATTTATGAGAGG + Intronic
940603804 2:155894417-155894439 TGATAATTTTTATTGAGAAAGGG - Intergenic
940879071 2:158928104-158928126 TGAGAGTTTTTATTATAAATGGG + Intergenic
941232387 2:162926974-162926996 TGTGAATTTTTATTGTTTACTGG - Intergenic
941251297 2:163167449-163167471 AAAGAATTTTTATTATAAACGGG + Intergenic
941542566 2:166804847-166804869 TGAGAATCTTTCTAAACAACAGG - Intergenic
942032761 2:171979498-171979520 TGAGAATTTTTATAAATTACTGG - Intronic
942092400 2:172506538-172506560 TCAGAATTTTTTTTAATGCCAGG - Intergenic
942510562 2:176695129-176695151 TAAGAATTTTTTTTAATATTGGG - Intergenic
942880455 2:180854905-180854927 TTAGAATTTTTATCTATAGCTGG - Intergenic
942981605 2:182090466-182090488 TGATATTTTCTATTTATAACCGG + Intronic
942996120 2:182262682-182262704 TGAGAATTTTTACTAATAGCTGG - Intronic
943196519 2:184759188-184759210 TGAATATTTTTCTTAATAATTGG - Intronic
943838552 2:192548206-192548228 TGAGAATTTGTGTTAATAGATGG - Intergenic
943928250 2:193816696-193816718 TATGTATTTTTTTTAATAACAGG - Intergenic
944334462 2:198514091-198514113 TTAGAATTTTAATAAATAAGTGG - Intronic
944432878 2:199654330-199654352 TGAGAATTTTTATAATGAATGGG + Intergenic
944615341 2:201453164-201453186 TAAGAATTGTTAGTAATAAAAGG - Intronic
944785820 2:203069052-203069074 TCAGAATTTTTATTGAAAATAGG + Intronic
945514067 2:210740360-210740382 TGAGAGTTTTTATTATGAATAGG + Intergenic
945650369 2:212551142-212551164 ATAAAATTTTTATTATTAACAGG + Intergenic
946874840 2:224117897-224117919 TGAGAGTTTTTAATCATAAAGGG - Intergenic
1168850197 20:971292-971314 TGAGAATTTGTATTTCTAACAGG + Intronic
1168884671 20:1240204-1240226 TGAAGATTTATATTACTAACTGG - Intronic
1170980857 20:21211475-21211497 AGAGAGCCTTTATTAATAACAGG + Intronic
1173749586 20:45466938-45466960 TGAGAATTTGCATTTCTAACAGG - Intergenic
1173787213 20:45802833-45802855 TCAGAATTTTTTTTAAAAAGTGG - Intronic
1175351765 20:58326996-58327018 TGAGAGTTTTTATCAAGAATGGG + Intronic
1175696156 20:61104656-61104678 TAAGAATAATTATTAATAAATGG + Intergenic
1176523711 21:7848746-7848768 TATGAACTTTTGTTAATAACAGG + Intergenic
1176792807 21:13339957-13339979 TGAGAATTTTTATTCTCAAGAGG + Intergenic
1177072303 21:16525841-16525863 TGAGAATTTTTAGTCATGAATGG + Intergenic
1177228696 21:18290765-18290787 AGAGTATTTTTACTAAAAACAGG - Intronic
1177247979 21:18555016-18555038 TGAAACTTTTTAATAATAATGGG - Intergenic
1177270146 21:18837294-18837316 TGAGAGTTTTTATTATAAAGGGG + Intergenic
1177333327 21:19690274-19690296 TCAGAATTTTTTTTAAAATCAGG - Intergenic
1177670490 21:24218774-24218796 TAATAATTTCTATTTATAACTGG - Intergenic
1177992191 21:28050841-28050863 TGAGAATTTTTATTCTCAAGAGG + Intergenic
1178116476 21:29422771-29422793 TGAAAATGTTTTTTAATAGCTGG + Intronic
1178595326 21:33948142-33948164 GAAGAATGATTATTAATAACTGG + Intergenic
1178657731 21:34478758-34478780 TATGAACTTTTGTTAATAACAGG + Intergenic
1178881261 21:36452006-36452028 TTTGTATTTTTAGTAATAACGGG + Intergenic
1179021637 21:37646344-37646366 TGTGAAATTCTAGTAATAACAGG + Intronic
1179558559 21:42196482-42196504 TGAGATTTTTTTTTAAATACAGG - Intergenic
1180114661 21:45693084-45693106 TGAGAATTTTTATTATTAGTGGG - Intronic
1181295738 22:21837113-21837135 TGTTAAATTTTATTAAAAACAGG - Intronic
1182653937 22:31874513-31874535 TGAGGATTTTTTTTAATAAGTGG + Intronic
1185194998 22:49463629-49463651 TAAGAATTTTGAATAATAGCCGG - Intronic
949324899 3:2852753-2852775 TGTGAAGTATTATTTATAACCGG - Intronic
949349132 3:3106629-3106651 TGAGAATTTTAATGAATTAAGGG + Intronic
949915360 3:8958597-8958619 TCAGAATTTTTGTTTTTAACAGG - Intronic
950625335 3:14242507-14242529 AGTGAATTTTTATTAAAACCTGG + Intergenic
950888367 3:16380618-16380640 TGAGAATTTGCATTTCTAACAGG - Intronic
951141509 3:19167589-19167611 TAAGTATTTTCATTAATAAAAGG - Intronic
951380527 3:21978603-21978625 TGGAAATTTTTACTAATATCAGG - Intronic
951483768 3:23189579-23189601 TGAGAGTTTTTATTATGAATGGG - Intergenic
952156670 3:30650760-30650782 TGAGAATCTGCATTTATAACAGG - Intronic
952537731 3:34330760-34330782 TGAGAGTTTTTATTATGAAAGGG + Intergenic
952579692 3:34818404-34818426 TGAGAATTTTTATCATGAAAGGG - Intergenic
953308482 3:41853211-41853233 TGAGAATTTGCATTTCTAACAGG + Intronic
955283762 3:57619041-57619063 TGAGAGTTTTTATCAATAATGGG - Intergenic
955946137 3:64195607-64195629 TCAGAATTTTTATTAGTGAACGG + Intronic
956079401 3:65541720-65541742 TGAGAATTTTTAGTATGAAGGGG - Intronic
956214200 3:66831693-66831715 TCAGAATTTATATTTAGAACAGG + Intergenic
956325865 3:68052274-68052296 AGAGAATTTTTATTAAACAATGG + Intronic
957230914 3:77513156-77513178 TTAAAATTTTTATTACCAACTGG - Intronic
957236864 3:77604264-77604286 TGAGACTTATTATAAATAAATGG - Intronic
957303474 3:78424286-78424308 TCAGAATTTTTATTCACACCTGG - Intergenic
957656927 3:83092170-83092192 TGAGAATACTTTTTAATAGCAGG - Intergenic
958461594 3:94404859-94404881 TGAGAGTTTTTATTATGAAAGGG + Intergenic
958542660 3:95499350-95499372 TGAGAGTTTTTATTACCAATGGG - Intergenic
958663900 3:97108800-97108822 TGAAAATTCTCAATAATAACTGG - Intronic
958666883 3:97151918-97151940 TTAGCGTTTTTATTAATAAATGG + Intronic
958857789 3:99407698-99407720 TGTGAATTTTTATGATTAAGGGG + Intergenic
959203287 3:103275393-103275415 TGAGAATTTTTATTATAAATGGG + Intergenic
959364661 3:105442138-105442160 TGAGATTTTATATTATTAAGTGG + Intronic
960477736 3:118150175-118150197 TGGTAATTTTTGTTAAAAACTGG - Intergenic
960579648 3:119265599-119265621 TGAGAATTTTTATCAGAAAAAGG - Intergenic
960753771 3:120984855-120984877 TGAGAGTTTTTATTATAAAATGG + Intronic
960894463 3:122487905-122487927 AAAAAATTTTTATTAATAATTGG - Intronic
961113710 3:124309735-124309757 TGAGTATTTTTATTATGAATAGG - Intronic
962000735 3:131293278-131293300 TGAGAATTTTTATCATGAATGGG + Intronic
962441449 3:135422151-135422173 TGAGCTTTATTATTCATAACTGG + Intergenic
963395114 3:144722330-144722352 TGAGAATTTTTATCAGGCACAGG + Intergenic
963429130 3:145174615-145174637 TGAGGGATTTTATCAATAACTGG + Intergenic
963676004 3:148312552-148312574 TGTTACTCTTTATTAATAACTGG - Intergenic
964338469 3:155682950-155682972 TGTGAATGTTTATTCATCACTGG + Intronic
964482462 3:157155245-157155267 AGATAATTTTTATTAACAAATGG - Intronic
964640789 3:158908011-158908033 TGTGAATTTGTATTTATATCTGG - Intergenic
964665884 3:159171476-159171498 TGAGAATTTGTACTTCTAACAGG + Intronic
965061746 3:163792344-163792366 TGTGAATTTTTTTTAATAGAGGG + Intergenic
965277038 3:166697740-166697762 AGAGAATATTTATTAATACTTGG + Intergenic
965319256 3:167231585-167231607 TGAGAAATTTTACTAATGAGGGG + Intergenic
965346190 3:167553880-167553902 TGGGGATTTTTATCAATCACAGG - Intronic
965552039 3:169976576-169976598 TGAGAATTTTTATTACTTGCAGG + Intronic
965800382 3:172486661-172486683 TGAGTATTTTTATTATAAAAGGG + Intergenic
965945897 3:174241224-174241246 TTAAAATTCTTATTCATAACCGG + Intronic
966325671 3:178750981-178751003 TGAGAATGTTTTTTAATATCTGG - Intronic
967202989 3:187090638-187090660 TGAGAGTTTTTATTACAAAAGGG + Intergenic
967678291 3:192327453-192327475 TGAGAATTTTTTTTAACTAAAGG - Intronic
967848253 3:194061661-194061683 TGAGATTATTTATAAGTAACAGG - Intergenic
968322360 3:197780922-197780944 TGAGAATTTTTATCAAGAATGGG + Intronic
968331087 3:197870954-197870976 TGACAATATTTCTTTATAACAGG - Intronic
968353834 3:198084482-198084504 TGAGTATTTTTATCATAAACGGG - Intergenic
969088281 4:4672831-4672853 TGAGGATTTTTATAAATGAGAGG - Intergenic
969661352 4:8530993-8531015 TAAGAATTTTTATCAAGAATGGG + Intergenic
970339414 4:15089155-15089177 TGGGAGTTTTTATTATTAATGGG + Intergenic
970352915 4:15222832-15222854 TGAGAATTTTTATTTAACATTGG - Intergenic
970388311 4:15579389-15579411 TAAGAATTATTTTAAATAACTGG - Intronic
970716078 4:18924931-18924953 TGATAATTATTATTTATAGCTGG - Intergenic
971893216 4:32553754-32553776 TGAGAATTTTTAATTATAAATGG + Intergenic
971918645 4:32909168-32909190 TGAGATTTTTTTTTACTTACTGG - Intergenic
972035744 4:34517345-34517367 TGAGAATTTGCATTTATAAAAGG - Intergenic
972216367 4:36901198-36901220 GGTCAAATTTTATTAATAACTGG - Intergenic
972262295 4:37421483-37421505 GGAGAATTATTATTAATATAAGG + Intronic
972318869 4:37953910-37953932 TGATAATCTACATTAATAACGGG - Intronic
973043724 4:45508428-45508450 TGAGAATTTTTATTATGAAAAGG + Intergenic
974373009 4:61042099-61042121 TGAGAATTACTAGTAATAATAGG + Intergenic
974614357 4:64263134-64263156 TGTAAGTTTTTATTAATAATTGG - Intergenic
975164061 4:71157416-71157438 TGACAATTTTTATTCATATCAGG - Intergenic
975282295 4:72575160-72575182 TGAAAACTCTTATTAATAAGTGG - Intergenic
975429197 4:74268132-74268154 TGAGGATTTCTAGAAATAACAGG + Intronic
975958255 4:79868673-79868695 TCAGACTTTTTCTTAGTAACAGG - Intergenic
976020013 4:80611160-80611182 TGAGAACATTTATTACTGACAGG - Intronic
976691969 4:87877670-87877692 AGTGAATTTTTATTGAAAACTGG - Intergenic
976966478 4:91047935-91047957 TGTTAATTTTTATTAATAAATGG + Intronic
977025230 4:91810138-91810160 TGAGAAATTTTATTAGAAAATGG - Intergenic
977265220 4:94845766-94845788 TTAGAATTTCAATTAAAAACTGG - Intronic
977492655 4:97734197-97734219 TGAGAATTTTTAATTATAAAAGG + Intronic
978065183 4:104389858-104389880 TGGGAATTTTTTTTTATAAAAGG + Intergenic
978171389 4:105674942-105674964 TTATAATTTTTATAAATAATAGG - Intronic
978447166 4:108790603-108790625 TGAGTTTGTTTATTAATAACAGG - Intergenic
978475195 4:109120085-109120107 TGAGAGTTTTTATCATTAATGGG - Intronic
978673769 4:111284218-111284240 TGAAAAATTTTAATAATAATCGG + Intergenic
979062922 4:116088694-116088716 TCAGAAATTATATTAATAATAGG + Intergenic
979405153 4:120301014-120301036 TGAGAGTTTTTATTATGAAAGGG - Intergenic
979512587 4:121571253-121571275 TGAGAGTTTTTAGTAAGAAGGGG - Intergenic
980289063 4:130821841-130821863 TGAAAATTATGATTAATAAATGG - Intergenic
980562371 4:134494066-134494088 TGACAATTTTTATTATGAAGGGG - Intergenic
980570730 4:134616107-134616129 GTATATTTTTTATTAATAACAGG - Intergenic
981201839 4:141989209-141989231 TGAGAGTTTTTATTATGAAGTGG + Intergenic
981515399 4:145603298-145603320 AGAGAATTATTAATAAGAACTGG + Intergenic
982412711 4:155097216-155097238 TTAGAAATTTTATCAATAAGAGG + Intergenic
982811806 4:159835051-159835073 TCAGAATTTTTATTTAAAAGAGG + Intergenic
982874004 4:160622161-160622183 TGAGAGTTTTTATTATGAATAGG + Intergenic
982898605 4:160967836-160967858 TGAGAATTTTTATCATGAAAGGG + Intergenic
983459700 4:168013044-168013066 TGAAAATTTATATTATTAAATGG - Intergenic
983746911 4:171212465-171212487 TGAGAATTTTTATCATGAAAAGG + Intergenic
983985023 4:174049016-174049038 TGAGAGTTTTTATCATTAATAGG + Intergenic
984401068 4:179264851-179264873 TGAGCATTTTTATTGAGAAAGGG - Intergenic
984404946 4:179316510-179316532 TGAGAGTTTTTATCATTAAATGG + Intergenic
984988983 4:185359671-185359693 TGGGAATTTCTTTTAATTACAGG - Intronic
985059858 4:186066697-186066719 TAAGAATTGTTATTAGGAACGGG + Intergenic
985077661 4:186232860-186232882 TGTGAATATGTATTATTAACTGG + Intronic
985853462 5:2406205-2406227 TGAGAAATATTAATAAAAACAGG - Intergenic
986387857 5:7254114-7254136 TGAAAATTTTTATTTAAAATTGG + Intergenic
987183512 5:15390218-15390240 TTGGAAGTATTATTAATAACTGG + Intergenic
987208753 5:15656790-15656812 TGAGAATTTTAATTAGGAAATGG + Intronic
987515026 5:18894712-18894734 TGAAAATCTGTAATAATAACAGG + Intergenic
987736028 5:21844620-21844642 TGACAATTTTTATGAATCACTGG + Intronic
987902762 5:24034805-24034827 TCAGAATTTTAAATAAGAACTGG + Intronic
988081698 5:26423562-26423584 TCAGAATTTTATTTAATTACAGG - Intergenic
989327869 5:40221181-40221203 AGAGAATTATTATACATAACTGG + Intergenic
989986844 5:50710829-50710851 TGAAAATTTTTATATCTAACAGG + Intronic
990035645 5:51315501-51315523 TGAGAATTTTTAACCATAAATGG + Intergenic
990213431 5:53505302-53505324 TTAAAATTTTTATTAAGAGCAGG - Intergenic
990221486 5:53595354-53595376 TGACATGTGTTATTAATAACTGG - Intronic
990544696 5:56811421-56811443 TTAGAAGGTTTATTAATAAGAGG + Intergenic
990585802 5:57209681-57209703 TGAGTATTTTTATAATTAAAGGG + Intronic
991527037 5:67571122-67571144 TGAGAGTTTTTATTATAAAAGGG + Intergenic
993113522 5:83689423-83689445 TGAACATTTTCATTAATAAAAGG + Intronic
993232966 5:85262819-85262841 TGAAAATTATTATTAATGAGTGG - Intergenic
993329954 5:86587142-86587164 TGAAAATATTTATTACTATCTGG + Intergenic
993470174 5:88298106-88298128 AAAAAATTTTTTTTAATAACTGG + Intergenic
993538221 5:89114766-89114788 TGAGATTTTGACTTAATAACTGG + Intergenic
994043946 5:95286737-95286759 TGAGGCTATTTATTAATACCTGG - Intergenic
994099283 5:95876726-95876748 TGACAATTTATATTTCTAACAGG + Intergenic
994506492 5:100649123-100649145 TGAGAACTTTTTTTAATAAATGG - Intergenic
994987265 5:106952526-106952548 TGAGAAGAATTATTAATAATAGG + Intergenic
995169819 5:109094555-109094577 TGACAAATTTTTTTTATAACGGG + Intronic
995217284 5:109610445-109610467 TGAGAATTTTTTTAAAAATCAGG - Intergenic
995322608 5:110853839-110853861 TGATAATTGTTATTAATGTCAGG - Intergenic
995500262 5:112797003-112797025 TGAGGATTACTATTAATAAATGG - Intronic
995520917 5:113004265-113004287 TGCTAATTCTTATTATTAACTGG - Intronic
995654484 5:114409850-114409872 AGAGAATTTTTATTACCTACAGG - Intronic
995704696 5:114975396-114975418 TTAGAATTTTTATTTATAATAGG + Intergenic
995717916 5:115098454-115098476 TGAGAGTTTTCAAAAATAACTGG - Intergenic
995780855 5:115773948-115773970 AAAGAATTTTTTTTAATTACTGG - Intergenic
996030257 5:118696880-118696902 TGATAATAGTTAATAATAACAGG + Intergenic
996133021 5:119805023-119805045 TGAGAGTTTTTATTATGAAGGGG + Intergenic
996151392 5:120040161-120040183 TGAGAATTGTTTTTAATGCCTGG + Intergenic
996327137 5:122287384-122287406 TGAGATTTTTCATTAAAAAAAGG - Intergenic
996737128 5:126768307-126768329 TGAGAATTTATATTGGTAACTGG - Intergenic
996853292 5:127976881-127976903 TGAAAACTTTTCTTAAAAACTGG - Intergenic
996853427 5:127978095-127978117 TCAGAATTTTTATTAAGAGAAGG - Intergenic
998475786 5:142420385-142420407 ACTGAATTTTTTTTAATAACTGG + Intergenic
998721477 5:144956069-144956091 TGAGAATTTTTATCATGAAAAGG + Intergenic
998723477 5:144980754-144980776 TGAGAATTTTTATCATAAAAGGG - Intergenic
999928113 5:156401753-156401775 TGAAAATTTTTTTTAAAAAGAGG - Intronic
999984633 5:156991590-156991612 TGATAATGTATATTAATAAGTGG + Intergenic
1000681239 5:164187627-164187649 TGAGAATTTGCATTTCTAACAGG - Intergenic
1001326286 5:170728107-170728129 TGAAAATTATTATGAATAAATGG - Intronic
1001716579 5:173821275-173821297 TGAGAATTTGCATTTCTAACAGG + Intergenic
1001793181 5:174478672-174478694 TGAGAGTTTTAAATAATAAATGG - Intergenic
1001968984 5:175938592-175938614 TGAGATTTTTTATTTAAAATTGG - Intronic
1002248459 5:177905153-177905175 TGAGATTTTTTATTTAAAATTGG + Intergenic
1003733886 6:8855849-8855871 TAAGAACTTTTCTTAAGAACTGG - Intergenic
1003746907 6:9012357-9012379 TTTTAATTTTTATTAATAAAAGG + Intergenic
1004047043 6:12036437-12036459 TGAGAATTTTAAGTAATTTCAGG + Intronic
1004373029 6:15068730-15068752 TAGGAAATTTTATTAATAAAAGG + Intergenic
1004697806 6:18050310-18050332 TAAAAATTTTTATTAGAAACAGG - Intergenic
1004772813 6:18804365-18804387 TGAGAGTTTTTATTATAAATTGG + Intergenic
1004798081 6:19111901-19111923 TGAGAATTTTTATCATGAAAGGG + Intergenic
1005078920 6:21937131-21937153 TGATAAGCTTAATTAATAACAGG + Intergenic
1005149380 6:22731309-22731331 TGAGAATTTTTTTTTGTAAAAGG - Intergenic
1005162255 6:22877367-22877389 TGACAATTTTAAGAAATAACAGG + Intergenic
1005264507 6:24097504-24097526 TGAGGATTTTGGTTAAAAACAGG + Intergenic
1006280427 6:33048518-33048540 TGAGAGTTTTTATTACGAAAAGG + Intergenic
1007535970 6:42588952-42588974 TGAGAGTTTTTATTATGAATGGG + Intronic
1007639160 6:43323137-43323159 TGAGAATTTTTATTATGAAAGGG - Intronic
1007796267 6:44350461-44350483 TGAGAATCTGTATTTTTAACAGG + Intronic
1008224286 6:48893980-48894002 TGAAAATTTTTATTATTAATGGG + Intergenic
1008409953 6:51165430-51165452 TGAGAGTTTTTAATAATGAAGGG + Intergenic
1008790090 6:55220505-55220527 TGAGTATTTTTATTACGAAAGGG - Intronic
1009338005 6:62517914-62517936 TGAGAATTTTTAAAAATGAAAGG + Intergenic
1009745198 6:67804271-67804293 TGAGAGTTTTTAATTATAAAGGG - Intergenic
1010070813 6:71742857-71742879 TGAAAACTTTTCTTAATAATTGG - Intergenic
1010088050 6:71944643-71944665 GGAGAATTTTTATGAAAAACAGG + Intronic
1010565977 6:77414484-77414506 TGAGGATCTTTTTTAATAAATGG - Intergenic
1010738793 6:79474066-79474088 TGAGTATTTATAATAAAAACTGG - Intergenic
1010941502 6:81923805-81923827 TGAGACTTTTTATTATAAATGGG - Intergenic
1011157927 6:84354525-84354547 TTTGAATTTTTATTTTTAACAGG + Intergenic
1011173387 6:84531512-84531534 TCATAATTTTTATTGAAAACTGG - Intergenic
1011767574 6:90639599-90639621 TGAGAATTTTAAATAAGAAGGGG - Intergenic
1012046275 6:94278595-94278617 TATGAATTTTTAGTAAAAACAGG - Intergenic
1012075995 6:94687351-94687373 GGAGAATTTTTAATATGAACTGG + Intergenic
1012106774 6:95171011-95171033 TGATAATTTTGATGAATTACTGG + Intergenic
1012143597 6:95653585-95653607 TAGGAATTCTCATTAATAACTGG + Intergenic
1012457231 6:99421124-99421146 GGAGAAATTTGATTAATGACGGG + Intronic
1012462538 6:99479656-99479678 TGAGAGTTCTTATTAAGAAATGG - Intronic
1013017080 6:106169592-106169614 TGAGAATCTGTAATAAAAACTGG + Intergenic
1013091289 6:106902981-106903003 TGAGAATGATTATTCATTACTGG + Intergenic
1013447915 6:110249983-110250005 TGAGAATTTTCATTTTTAACTGG + Intronic
1013614945 6:111834354-111834376 TAAGAATTTTTTTTAATATGAGG - Intronic
1013682175 6:112536475-112536497 TGAGAATTTGCATTTATAAAAGG - Intergenic
1013701480 6:112775364-112775386 TGACAATTTTTTTTAACAAAAGG + Intergenic
1014047098 6:116902454-116902476 TTAAAATTTTTATTCATAAATGG + Intronic
1014062427 6:117087830-117087852 TGAGAATTTTTATCATAAACGGG - Intergenic
1014349233 6:120318400-120318422 TGAGTGTTTTTTTCAATAACTGG + Intergenic
1014914771 6:127133031-127133053 TGAGATTTCTTCTTAATATCTGG + Intronic
1015354474 6:132261100-132261122 AGAGAATTTTTACTTATAAGAGG - Intergenic
1015762860 6:136683863-136683885 TCTGAAATTTTATTAATCACAGG + Intronic
1015964168 6:138681869-138681891 TAACAATTTTTAATCATAACAGG + Intronic
1016186779 6:141207099-141207121 TGAAAATATTCACTAATAACAGG - Intergenic
1016491658 6:144611167-144611189 TGAGAGTTTTTATTATGAAAGGG - Intronic
1016646073 6:146409959-146409981 TGAGAATATATTTTTATAACTGG - Intronic
1017209977 6:151844990-151845012 TAATAATTTTAATTTATAACTGG - Intronic
1017253488 6:152307494-152307516 TGTGAATTTTGGTAAATAACTGG - Intronic
1019760322 7:2807320-2807342 TAAGCATTTTTATTACTAATTGG - Intronic
1019839441 7:3425300-3425322 TGAGGACTTTTATGAATGACTGG + Intronic
1021407787 7:20293357-20293379 TGATAATGTTTATTAATATCCGG - Intergenic
1021529341 7:21626168-21626190 TGGGAATTTTTTTTAAAAAGCGG - Intronic
1021596886 7:22326575-22326597 TAAGAGTTCTTACTAATAACTGG - Intronic
1021666065 7:22981870-22981892 TGATAATTTTTTTAAAAAACTGG + Intronic
1022158887 7:27688807-27688829 TGAGAATTCCTATTAAGCACTGG + Intergenic
1022347976 7:29536435-29536457 TGAGGATTTTTATTACAAATGGG + Intergenic
1022960630 7:35423097-35423119 TGAGTATTTTCTTAAATAACAGG - Intergenic
1024050258 7:45616616-45616638 TGAGAATTTTTATCACGAAAGGG - Intronic
1024169688 7:46771213-46771235 TAAGAATATTTATTAATATAAGG - Intergenic
1024191181 7:47011986-47012008 TGAGAGTTTTTATTAGGAATGGG - Intergenic
1024433320 7:49317296-49317318 TGAGAATATTTATCATGAACAGG - Intergenic
1024450575 7:49537502-49537524 TGAGAATTTTTATCACGAAAGGG - Intergenic
1024925657 7:54611792-54611814 TGAAAATATTTTTTAAGAACTGG - Intergenic
1024964535 7:55011670-55011692 TGAGAATTTTTATCATGAATAGG + Intergenic
1024966734 7:55029498-55029520 GAAAAATTTTTATAAATAACTGG + Intronic
1025992580 7:66506749-66506771 TTAGGATTTTTATTAGAAACTGG + Intergenic
1026076372 7:67173815-67173837 TGAGAGTTTTTATTATGAATGGG + Intronic
1026682930 7:72483142-72483164 TTAAAATTTTTTTTAATCACTGG + Intergenic
1026700482 7:72638468-72638490 TGAGAGTTTTTATTATGAATGGG - Intronic
1027741223 7:82008779-82008801 TAAAAATATTTATTAATATCAGG + Intronic
1027825357 7:83107626-83107648 TATTAATTATTATTAATAACTGG - Intronic
1027924298 7:84440808-84440830 TGTGAATTTTTGTTGAAAACTGG - Intronic
1028164993 7:87528561-87528583 TGAGCATTTTTATAAAATACAGG - Intronic
1028180571 7:87717265-87717287 TTTGTATTTTTATTAATAAAAGG - Intronic
1028317063 7:89416292-89416314 TGAAAATCTTTATTTAAAACTGG + Intergenic
1028714853 7:93953682-93953704 TGAGAACTTTTATAAAGAAATGG + Intergenic
1030089447 7:105844527-105844549 TGAGTGTTTTTATTAAGAAGGGG - Intronic
1030231975 7:107217691-107217713 TGAGAGTTTTTATTATAAAAGGG - Intronic
1030790486 7:113721315-113721337 TGAGAATTAATTTTAATAAAAGG - Intergenic
1030889041 7:114974706-114974728 TGACAATTTTTTTAAAAAACTGG - Intronic
1030915504 7:115307251-115307273 GGAGAATATTTTTTAATAAAGGG - Intergenic
1030919877 7:115369685-115369707 TGAGAGTTTTTATCAAAAAAGGG - Intergenic
1031092268 7:117372983-117373005 TTAGAATGTTTATAAATAACAGG + Intronic
1031105317 7:117534575-117534597 TGAAAAATCTTATTAACAACAGG - Intronic
1031843942 7:126781647-126781669 TAAGCATTTCTATTAATTACAGG - Intronic
1032106626 7:129036762-129036784 GGAGAATTTCCATTAATAAATGG + Intronic
1032913567 7:136461731-136461753 TGAGAATATGTATTTCTAACAGG + Intergenic
1033100654 7:138468189-138468211 TGAGAATTTTTATTATGAATGGG + Intronic
1033485500 7:141785322-141785344 TGAGAATTTTTAACTATAGCAGG - Intronic
1034166623 7:149029479-149029501 TGAGACTTTTTTTTAACACCTGG + Intergenic
1034406468 7:150906350-150906372 TAAGAATTTATATTCAAAACTGG + Intergenic
1034740449 7:153468639-153468661 AGAAAAATGTTATTAATAACAGG + Intergenic
1035088704 7:156285853-156285875 TGAGATGTTCTATTAATAGCAGG + Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035896515 8:3408665-3408687 TTAAAATTTTTATTAGTTACAGG + Intronic
1036594459 8:10199795-10199817 TTAGGATTTTTCTTAATAACTGG + Intronic
1037168647 8:15862507-15862529 TGAGAATTTTCAAAAATATCAGG + Intergenic
1037455821 8:19062595-19062617 TTAGATTTATTATTAATAAAGGG + Intronic
1037562361 8:20086515-20086537 TGTGAAGTTTTCTAAATAACAGG - Intergenic
1038041773 8:23729289-23729311 TAAGAATTTTAATTTATAATAGG - Intergenic
1038788976 8:30650386-30650408 TGAGAGTTTTTAGTCATAAATGG - Intronic
1039235234 8:35495809-35495831 AGAGATTTCTTATTAATAAAAGG + Intronic
1039667343 8:39548030-39548052 TGAGAGTTTTTATCAAGAAAGGG + Intergenic
1039958435 8:42225079-42225101 TGAGAAGATTTATTAATAGTGGG - Intergenic
1040654813 8:49495142-49495164 TGATAATTTTCATTAAGAAATGG - Intergenic
1041198640 8:55427517-55427539 CCAAAATTTTAATTAATAACTGG - Intronic
1041236675 8:55809962-55809984 TGTGAATGTTTATTTAGAACAGG + Intronic
1041270984 8:56108734-56108756 TCTGAATTTTTATTCACAACAGG - Intergenic
1041684130 8:60626900-60626922 TGAAAATATTTCTTAAAAACTGG + Intergenic
1041883527 8:62780737-62780759 TGAGAGTTTTTATTCATGAAAGG - Intronic
1042575420 8:70212908-70212930 TTAGTATTTTTAGTAAAAACAGG - Intronic
1042612875 8:70617395-70617417 TGAGCATGTTTATTAATAGATGG + Intronic
1042774696 8:72417495-72417517 TGAGAATTTTTATGATGAATGGG + Intergenic
1042841964 8:73133012-73133034 AGAGAATCTTTAGAAATAACTGG + Intergenic
1043035998 8:75200212-75200234 TGAGAGTTTTTATCAAGAAGTGG + Intergenic
1043044455 8:75303719-75303741 TGAAAGTTGTTATTAATAAAAGG - Intergenic
1043113182 8:76214152-76214174 TGAGAATGTTTGTAAATAAAGGG + Intergenic
1043308502 8:78828001-78828023 TGAGAGTTTTTATTATGAAGAGG - Intergenic
1043637907 8:82410105-82410127 AGAGAATATGTATAAATAACTGG + Intergenic
1043643525 8:82487582-82487604 TTATAATTTTTATTAAAAAGAGG - Intergenic
1043682810 8:83051756-83051778 TGAGAATATTTTTTACTAAAAGG + Intergenic
1044498020 8:92914137-92914159 TGAGAATTTTTATCATGAAATGG - Intronic
1044872178 8:96630194-96630216 TTAGATATTTTATTACTAACAGG - Intergenic
1044902725 8:96965720-96965742 TGAGGATTTTTATTACTATTAGG + Intronic
1045083058 8:98649632-98649654 TTAGAATTTATTTTAATATCTGG + Intronic
1045218262 8:100171037-100171059 TGAGAATTTTTATCATGAATGGG + Intronic
1045879318 8:107019501-107019523 TGAGAATTTTTAATCATGAAAGG - Intergenic
1046030583 8:108778671-108778693 TCACAATTTATATTATTAACTGG - Intronic
1046158576 8:110328915-110328937 TCTGAATTTTTTTTGATAACTGG + Intergenic
1046204516 8:110975352-110975374 TGAAAATTTTGATTAATACCAGG - Intergenic
1047047505 8:121071268-121071290 TGAGAGATTTTATTAACAATAGG + Intergenic
1047819012 8:128497744-128497766 TGAAAATCTTTATTAAAAAATGG + Intergenic
1048719052 8:137301219-137301241 TGAAAATTCTTATAAATAAATGG + Intergenic
1048920081 8:139220593-139220615 TGAGAGTTTTTATTATGAATTGG - Intergenic
1049134844 8:140887118-140887140 TGCGATTTTGTAATAATAACTGG + Intronic
1049742036 8:144245578-144245600 TGAGAACTTTTATCAGGAACAGG + Intronic
1049779421 8:144421843-144421865 TGTGTATTTTTAGTAAAAACAGG - Intergenic
1050060362 9:1702872-1702894 AAAGAATTTTTCTTAATAATTGG - Intergenic
1050136465 9:2470622-2470644 TGAGAATTTTTATGATTATGTGG - Intergenic
1050198734 9:3117144-3117166 TGAGAATTTTTATTATAAAACGG + Intergenic
1050749655 9:8922269-8922291 TGATAATTTTCATCAATACCAGG + Intronic
1051084010 9:13326446-13326468 TGACAATTTTTTTTAAGTACAGG + Intergenic
1051087267 9:13364237-13364259 TGCGAGTTGTTATTAATAACTGG + Intergenic
1052226224 9:26091053-26091075 TACTAAATTTTATTAATAACTGG + Intergenic
1052248004 9:26361802-26361824 TGAAATTTTTTCTAAATAACTGG + Intergenic
1052455925 9:28698338-28698360 TGATAATTTTTTTGAATAACAGG - Intergenic
1052498007 9:29252940-29252962 TAAGAATATTTGTTAGTAACTGG + Intergenic
1052582419 9:30375281-30375303 TGAGAGTTTTTATCATTAATGGG - Intergenic
1054322805 9:63688675-63688697 TGAGAATTTTTCTTTATCACTGG - Intergenic
1054832386 9:69640736-69640758 TGAGAGTTTTTATTATGAATGGG - Intronic
1055027794 9:71740944-71740966 AGAGAATTTGTATTTCTAACAGG + Intronic
1055180106 9:73376886-73376908 TAAGAATTTATATAAATAAATGG - Intergenic
1055844076 9:80539807-80539829 TGAGAAATTTAATTACTTACAGG + Intergenic
1056338088 9:85597066-85597088 TGACAATTTTTATTGAGATCTGG + Intronic
1056482848 9:87023425-87023447 TGAGTATTTTTATTAAGAAAAGG - Intergenic
1056700360 9:88900313-88900335 TGAGAATTTTTATCATAAATGGG + Intergenic
1056995623 9:91454872-91454894 TTAGAAGTTTTCTCAATAACTGG + Intergenic
1057611162 9:96544992-96545014 TGAGAATTTGCATTTCTAACAGG - Intronic
1057960422 9:99450779-99450801 TGAGAGTGTTTAATAATAATGGG + Intergenic
1058299261 9:103349652-103349674 TGAGCATTTTTATCACGAACAGG - Intergenic
1059340697 9:113595934-113595956 TGGCCATTTTTATTACTAACTGG - Intronic
1059681862 9:116593352-116593374 TGATAATTTTTATTAATGTGTGG - Intronic
1203552358 Un_KI270743v1:174061-174083 TGAGTATTTTTATTATAAAAGGG + Intergenic
1186393508 X:9184508-9184530 AGAGAAATTTTCTTAATAACTGG - Intergenic
1186719347 X:12286318-12286340 TGAGTATTTTTATATATGACAGG - Intronic
1187175275 X:16890624-16890646 TTAGAATCTTTCTTTATAACAGG + Intergenic
1187494908 X:19786986-19787008 AGAAAATTTTTATTAAAACCTGG + Intronic
1187714643 X:22090955-22090977 TGAGAATCTATATTTTTAACAGG + Intronic
1190889961 X:54559174-54559196 TTAGAATTTGTATTTCTAACAGG + Intronic
1192447327 X:71220799-71220821 AGAGAATTATTAAGAATAACCGG - Intronic
1192674244 X:73177893-73177915 TGAGAGTTTTTATCATTAATAGG - Intergenic
1193187449 X:78529853-78529875 AGACAATTTTTTTTAATAATTGG + Intergenic
1193523140 X:82555315-82555337 TTAGTATTTTTATTAATTAAAGG + Intergenic
1193730130 X:85093124-85093146 TGTGAATATTTATTAAGAAAAGG + Intronic
1194006835 X:88504988-88505010 TGTGAATGTTTATCAATATCTGG - Intergenic
1194291507 X:92078115-92078137 AGACAATTTTTTTTTATAACTGG - Intronic
1194475444 X:94353744-94353766 TGAGAATTTTTCAGTATAACAGG + Intergenic
1194491812 X:94560383-94560405 TGAGAATTTTTTGTTATACCTGG + Intergenic
1194507330 X:94748751-94748773 TCAGAATGTTTATTACTAAAAGG - Intergenic
1194596331 X:95863345-95863367 TGAGAGTTTTTAATCATAAATGG - Intergenic
1195647461 X:107249069-107249091 TGAGAATTTTTATGAATTGATGG - Intergenic
1195757671 X:108215439-108215461 TGCAACTTTTTATTAGTAACTGG + Intronic
1195940270 X:110161941-110161963 TGAGAATTTTTATTAATAACAGG - Intronic
1196602534 X:117618919-117618941 TGAGAATTTTTAGCAAGAAGGGG + Intergenic
1197643905 X:128996676-128996698 TGAGAATATTTATTAATGCATGG + Intergenic
1197839645 X:130731802-130731824 TGAGAGTTTTTATCAAAAAAGGG - Intronic
1198173531 X:134131497-134131519 TGAGAATTCTAAGAAATAACAGG + Intergenic
1198670174 X:139071685-139071707 GGAGAAATTCTATGAATAACAGG - Intronic
1198839306 X:140839793-140839815 TGAGATTTCTCATTAAAAACTGG - Intergenic
1199049412 X:143219613-143219635 TGAGAGATATTGTTAATAACTGG + Intergenic
1199138779 X:144286303-144286325 TGAAAATTTTTTTGAATATCTGG - Intergenic
1199225961 X:145374605-145374627 TGATTATTGTGATTAATAACAGG - Intergenic
1199251337 X:145665623-145665645 TAAGAATTTTTTTTAAAGACAGG - Intergenic
1199296598 X:146165931-146165953 TGAGAATTTGTATTTCTAACAGG + Intergenic
1199523831 X:148769189-148769211 TTAGAATTTTTATTTTTAAAAGG + Intronic
1199740503 X:150731617-150731639 TGACAATGTTTATTACTTACAGG - Exonic
1200609025 Y:5302698-5302720 AGACAATTTTTTTTTATAACTGG - Intronic
1200620901 Y:5445969-5445991 AGAGAATGTATATTAATACCTGG - Intronic
1200836054 Y:7732459-7732481 TGAGAATTTGCATTTCTAACAGG - Intergenic
1201170618 Y:11259000-11259022 GGAAAATTTTGAATAATAACTGG + Intergenic
1201351300 Y:13045060-13045082 TGAGAGTTTTTATTCATGAAGGG - Intergenic
1201450384 Y:14105221-14105243 TGAGAATTTTAACAAATAAATGG - Intergenic
1201510249 Y:14751829-14751851 TTTGAATTTTTAGTAAAAACGGG + Intronic
1201545754 Y:15160116-15160138 TGTGACTTTTCATTAATATCTGG - Intergenic