ID: 1195941748

View in Genome Browser
Species Human (GRCh38)
Location X:110173113-110173135
Sequence CTTTATAAACAGGTGGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195941737_1195941748 23 Left 1195941737 X:110173067-110173089 CCTCTAGCTTGACTCACTCAGAA 0: 1
1: 0
2: 0
3: 13
4: 274
Right 1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG 0: 1
1: 0
2: 0
3: 17
4: 156
1195941741_1195941748 -2 Left 1195941741 X:110173092-110173114 CCGAGGGGAGAGAAGAAATCCCT 0: 1
1: 0
2: 0
3: 27
4: 248
Right 1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG 0: 1
1: 0
2: 0
3: 17
4: 156
1195941736_1195941748 30 Left 1195941736 X:110173060-110173082 CCAGAGGCCTCTAGCTTGACTCA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG 0: 1
1: 0
2: 0
3: 17
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195941748 Original CRISPR CTTTATAAACAGGTGGGGAT TGG Intronic
900987169 1:6079947-6079969 CTTCATGAGCAGGTGTGGATTGG + Intronic
901183937 1:7360101-7360123 ACTTATAAAAAGGTGGGGGTTGG - Intronic
911346094 1:96698461-96698483 CTTTTTGAAGAGGTGGGGTTTGG + Intergenic
917196082 1:172467140-172467162 CTCTATAATCCAGTGGGGATGGG - Intronic
919037109 1:192327182-192327204 CTTAATAAAGAGGTGGATATGGG + Intronic
919235782 1:194840276-194840298 CTTTACATACGGGTGGAGATGGG + Intergenic
919460942 1:197876058-197876080 CTTTTTAAAGAAGTGGGGCTGGG - Intergenic
921374890 1:214463625-214463647 CTTTGTAAGCAGGTGGAGAGAGG + Intronic
921654344 1:217717120-217717142 ATTTATAAAGAGGTTAGGATGGG - Intronic
923632918 1:235665852-235665874 CTTTATAAACAGGATGGTTTGGG + Intronic
923651015 1:235873866-235873888 CTTTATAAACAGGAATGAATAGG - Intronic
924301654 1:242645342-242645364 CTTTAAAAAAAGGAGGGGAAGGG - Intergenic
924956458 1:248932882-248932904 CTTTATAATTAGGTGTGTATAGG - Intergenic
1063906703 10:10787503-10787525 CTTTATAAACAGGAGAGAAATGG + Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064891693 10:20182317-20182339 CTTTATATATAGGTGTAGATTGG - Intronic
1066481474 10:35799453-35799475 CTCTATCAACAGGTGAGGACTGG + Intergenic
1067580075 10:47439242-47439264 CTTTATAAACAGAAGGTCATGGG - Intergenic
1069030700 10:63593011-63593033 TTTTAGAAACAGGTAGGGAGGGG + Intronic
1070804054 10:79260307-79260329 CTTTAAAAGCAGGTGGTGATAGG + Intronic
1071194751 10:83145033-83145055 CTTTTTAAAGAGGTGTGTATTGG + Intergenic
1072450663 10:95537108-95537130 CGTTACAGACTGGTGGGGATGGG - Intronic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1076962261 10:133773769-133773791 CTTTATAATTAGGTGTGTATAGG - Intergenic
1077080759 11:723767-723789 CTTTGGAAACAGGTGGGGCTGGG - Intronic
1077772990 11:5241529-5241551 ATTTATAATGAAGTGGGGATGGG - Intergenic
1078617966 11:12882435-12882457 CTACACACACAGGTGGGGATGGG - Intronic
1079364616 11:19798470-19798492 CTTTAAAAAGATGTGGGGAGGGG + Intronic
1080828806 11:35872149-35872171 CATTAAAAACAGGTTGTGATGGG + Intergenic
1082108030 11:48242112-48242134 CTTGATAAGCAGGGGGGGAGGGG + Intergenic
1083572361 11:63767606-63767628 CTTTAAAAACAAAAGGGGATGGG + Intronic
1084449097 11:69222292-69222314 CTTTAAAAACATTTGGGGCTGGG + Intergenic
1086486302 11:87306027-87306049 CTTTATTAACAGTAGGGAATGGG + Intronic
1086980762 11:93195847-93195869 TTTTATAAAATGGTTGGGATGGG - Intronic
1089592779 11:119555413-119555435 CTTAATAAAATGGTAGGGATCGG + Intergenic
1090896339 11:130979102-130979124 CTTTATAGACTGGTGGTGCTTGG + Intergenic
1094480203 12:30875424-30875446 ATTTAAAAACAGATGGGGAAAGG - Intergenic
1094742145 12:33301997-33302019 TTTTGTAAACTGATGGGGATGGG + Intergenic
1096475392 12:51906577-51906599 CTTTAGATAGAGGTGGGGAATGG - Intergenic
1098685819 12:73419148-73419170 TTTTATAAAGAGATGGGGGTAGG - Intergenic
1101034241 12:100689276-100689298 CTTAATATTCAGGTGGTGATGGG - Intergenic
1103173920 12:118845161-118845183 CCTTATAAAAAAGTGGAGATTGG + Intergenic
1104086195 12:125476274-125476296 CATTTTAAGCAGGTAGGGATTGG + Intronic
1104182745 12:126398518-126398540 CCTTAAAGACAGGTGGAGATGGG - Intergenic
1106937519 13:34739513-34739535 CTTTTTAAAAAGGGGGAGATGGG + Intergenic
1109354245 13:61219253-61219275 CTTAATATACAGGTGGGGAGAGG + Intergenic
1109354820 13:61222976-61222998 CCTAATATACAGGTGGGGAGAGG + Intergenic
1109355717 13:61228853-61228875 CCTAATATACAGGTGGGGAGAGG - Intergenic
1109754997 13:66745943-66745965 AATTTTAAACAGGTGGCGATAGG - Intronic
1110412057 13:75215286-75215308 CTTTATAAGCACTTGGGGAAAGG + Intergenic
1111672971 13:91351314-91351336 CTTTCTACACAGGTTGGGATCGG + Intergenic
1116018099 14:39431354-39431376 CTTTATAAACAGTGGTGGACGGG - Intronic
1116387639 14:44351078-44351100 CTTAAGAGACAGGTGGGGAATGG - Intergenic
1117495910 14:56303659-56303681 TTTTTTAAACAGGTGGTGTTTGG - Intergenic
1118230120 14:63939642-63939664 CTTATTAAACAGGTAGGGGTCGG - Intronic
1118935147 14:70281080-70281102 CTTGATAAACAGGTTGGGGGTGG + Intergenic
1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG + Intergenic
1125858137 15:42971008-42971030 GATTAAAAACAGGTGGGGCTGGG - Intronic
1126205654 15:46042049-46042071 CATTATGAACAGTTAGGGATGGG + Intergenic
1128628436 15:69236929-69236951 CTTTATAAAAAGGGGGGTAGAGG - Intronic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1131243615 15:90770474-90770496 CTAGATAAATATGTGGGGATTGG - Intronic
1138781663 16:59795941-59795963 CTTTAGATACAGGTGGGCATTGG + Intergenic
1139708165 16:68756364-68756386 CTTTATGAACAGGTGGGGTGGGG + Intronic
1146646756 17:34581372-34581394 CTTTATAACCAGGAGAGGACTGG - Intronic
1146918852 17:36696351-36696373 CTGTATAAATATGTGGGGATTGG - Intergenic
1147418165 17:40308556-40308578 GAGTATAAACAGGTGGGGTTAGG - Intergenic
1148029003 17:44607289-44607311 CTTTATCCACAGATGGGCATTGG - Intergenic
1149436128 17:56634945-56634967 CTTAATAAATATCTGGGGATGGG + Intergenic
1150363352 17:64558443-64558465 CTGTATAAACTGGTCGTGATAGG - Intronic
1151752635 17:76049367-76049389 CTTGAAAAACAGATGGGGTTTGG + Intronic
1152951374 17:83235435-83235457 CTTTATAATTAGGTGTGTATAGG - Intergenic
1156157847 18:34324725-34324747 CTTTACAAACAGTTGGTGGTAGG + Intergenic
1156318492 18:35994529-35994551 CTTCATAAGCAGGTGGATATCGG + Intronic
1160771928 19:835881-835903 CTTTATAAAGAGGAGAGGAAAGG + Intergenic
1163382003 19:16975339-16975361 CGTGATAAAGAGGTTGGGATGGG - Intronic
1166626959 19:44366648-44366670 CTTTTTAAAAAAGTGGGGGTGGG - Intronic
1168121558 19:54254886-54254908 CTTTAGACACAGCGGGGGATGGG + Exonic
1168727403 19:58594473-58594495 CTTTATAATTAGGTGTGTATAGG - Intergenic
925489172 2:4372991-4373013 GTTTATAACCAGGTGGTGAGTGG + Intergenic
929878951 2:45820262-45820284 CTTGAGAAACATGTGGGGAGAGG + Intronic
932170289 2:69549071-69549093 CTTTCTAAACAGGTAAGGCTGGG + Intronic
933534942 2:83559669-83559691 CTTTTTAAAAAGGCAGGGATTGG - Intergenic
936571147 2:113616721-113616743 CTTTATAATTAGGTGTGTATAGG + Intergenic
941527919 2:166628933-166628955 CTTGATAAAGAGTGGGGGATGGG + Intergenic
943426674 2:187746434-187746456 CTGTATACAAAGGTGTGGATAGG + Intergenic
945654001 2:212601172-212601194 GTTTATAAACAGCTGGTGAACGG + Intergenic
945685761 2:212967755-212967777 CTTTAAAAATAGTAGGGGATGGG + Intergenic
946966139 2:225040419-225040441 CTTTAAAAAGAGGTGGGGGAGGG - Intronic
947337827 2:229105483-229105505 CTTTGTAAATGGGTGGGGCTAGG + Intronic
947553976 2:231072689-231072711 TTAAAAAAACAGGTGGGGATAGG + Intronic
948052579 2:234989655-234989677 ATTGATAAACTGGTGGGGCTGGG + Intronic
1169880105 20:10337969-10337991 TTTTATGAACAGGTAGGGAAAGG - Intergenic
1169880195 20:10339166-10339188 TTTTATGAACAGGTAGGGAAAGG - Intergenic
1170093773 20:12621987-12622009 CTGTATGAGGAGGTGGGGATGGG - Intergenic
1171133589 20:22677286-22677308 CCTTATAAACAGGGGAGGCTGGG + Intergenic
1171875399 20:30570608-30570630 CTTTTTAAAAAAGTGGGGGTGGG + Intergenic
1173449643 20:43151382-43151404 GTTAATAAAGAGGTGGGGGTGGG + Intronic
1180262843 21:46686275-46686297 CTTTATAATTAGGTGTGTATAGG - Intergenic
1184407868 22:44310252-44310274 CTTTATAAACATGTGTTAATTGG + Intronic
1185429044 22:50794149-50794171 CTTTATAATTAGGTGTGTATAGG - Intergenic
949659201 3:6258055-6258077 TTTTTTATACATGTGGGGATGGG + Intergenic
949926110 3:9043150-9043172 CTTAAAAAACAGCTGGGGGTGGG - Intronic
950419097 3:12886352-12886374 CTTTCTATACAGGTGTCGATAGG + Intergenic
950691435 3:14661385-14661407 CTTTGTAAACATTTGGGGAGTGG + Intronic
954472470 3:50709528-50709550 TTTTTTAAACAGGTGGGGCTGGG + Intronic
955769633 3:62374319-62374341 CTCCTTAAACAGGTGGAGATGGG - Intronic
955962933 3:64359386-64359408 TTTTAAAAAAAGGTGGGGGTGGG + Intronic
956129348 3:66039187-66039209 CATTTCAAACAGGTGGGGGTTGG + Intergenic
956721916 3:72125459-72125481 CTACATAAACAGGTGGGATTTGG + Intergenic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
957080038 3:75629661-75629683 CTTTATAATTAGGTGTGTATAGG + Intergenic
957995984 3:87690812-87690834 CTTTATAAACAGGAGAAGTTTGG + Intergenic
959720280 3:109479249-109479271 CTCTATAAACAAGAGGGGATGGG + Intergenic
962583322 3:136818147-136818169 CTATTTAAAAAGGTGTGGATGGG + Intergenic
968373803 4:20081-20103 CTTTATAATCAGGTGTGTATAGG + Intergenic
968431323 4:560846-560868 CTTGAGAAATGGGTGGGGATGGG + Intergenic
972157671 4:36184574-36184596 CTTTTTAAACATGTGTGGATTGG + Intronic
975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG + Intergenic
976258502 4:83123730-83123752 TTTTTTAAACAGGTGTGTATAGG - Intronic
980968346 4:139545536-139545558 CTTTACAAAAAGGTGGGGTTGGG + Intronic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
983393357 4:167162094-167162116 GTTCATAAATAGGTGGGGAGTGG - Intronic
983741545 4:171140410-171140432 CTTTATATAAAGGAGGGGATTGG + Intergenic
984727678 4:183036985-183037007 CTTCATAAAGAAGAGGGGATCGG - Intergenic
985250177 4:188016091-188016113 CTTAAAAAACAGGTGGGGCGCGG + Intergenic
985460931 4:190106183-190106205 CTTTATAATCAGGTGTGTATAGG - Intergenic
985465493 4:190191249-190191271 CTTTATAATTAGGTGTGTATAGG - Intergenic
985468112 5:16846-16868 CTTTATAATTAGGTGTGTATAGG + Intergenic
986610043 5:9558026-9558048 CTTTAAAAACAGGTGAGTTTTGG - Intergenic
986635083 5:9813125-9813147 CTTTATAAAAAGGGGGAAATTGG + Intergenic
987192847 5:15497030-15497052 CCTTATAGCCAGGTGGGGGTGGG + Intergenic
988197161 5:28018902-28018924 CTTTATAAACATGTGAAGACAGG - Intergenic
991298697 5:65106666-65106688 ATTTATAGACTAGTGGGGATAGG - Intergenic
993245814 5:85451858-85451880 CTTTATAGACAGAAAGGGATAGG - Intergenic
993550838 5:89271717-89271739 CTTTATAGACAGGTCATGATGGG + Intergenic
996720322 5:126623766-126623788 TTTTATAAACAAGAAGGGATTGG + Intronic
999129842 5:149273816-149273838 ATTTAAAAACTGGTGGGGAGTGG - Intronic
1001377816 5:171279463-171279485 CTTTATAAAAAGGTTGAGTTTGG - Intronic
1001815273 5:174663514-174663536 CATAACAAACAGGTGTGGATAGG - Intergenic
1002028284 5:176410465-176410487 CTTTATAAACAGTCAGGGGTGGG - Intronic
1002070388 5:176675945-176675967 CTTCAAAAGCAGGTGGGGCTAGG + Intergenic
1003733678 6:8854074-8854096 CTTTATAAAATGGTGGGGTGGGG - Intergenic
1005979475 6:30825544-30825566 CTTTATGAAAAGTTAGGGATAGG - Intergenic
1009419326 6:63447202-63447224 TTTTATAAACAGTTGTGGAATGG + Intergenic
1010063005 6:71646379-71646401 CTTAGTAAAGTGGTGGGGATGGG - Intergenic
1016596757 6:145812007-145812029 GTTTAAAAAGAGGTGGGGTTGGG + Intronic
1017104216 6:150872962-150872984 CTTTTAAAATAGTTGGGGATGGG - Intronic
1028749148 7:94362806-94362828 CCCTATAAAATGGTGGGGATGGG + Intergenic
1032200911 7:129822184-129822206 AGTTATAAACTGCTGGGGATTGG + Intergenic
1034507963 7:151510207-151510229 CTTGATCATCAAGTGGGGATGGG - Intronic
1034758940 7:153652869-153652891 CTCTAAAAATAGGTGGGGAATGG - Intergenic
1035514046 8:216543-216565 CTTTATAATTAGGTGTGTATAGG + Intergenic
1038734640 8:30157633-30157655 CTTTGTAAACATGTGGGGACAGG + Intronic
1040302272 8:46194246-46194268 CTTTATAGCCTGCTGGGGATAGG - Intergenic
1041249009 8:55916879-55916901 TTTTAAAAACAGATGGGGCTGGG + Intronic
1043068856 8:75612778-75612800 CTATATAAATAGATGGGGTTGGG - Intergenic
1043673697 8:82922230-82922252 CTTTATAAAGATGTGAGGAATGG + Intergenic
1045927853 8:107591807-107591829 CTTAATATTCAGGTGGGGAGAGG + Intergenic
1046333756 8:112755612-112755634 CTTTATAAACAGGGTGAGAACGG + Intronic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1048787053 8:138061828-138061850 ATTTATAAAGAGCTGGGGAAAGG - Intergenic
1055399788 9:75910853-75910875 CTTCACAAACATGTGGGTATCGG + Intronic
1056452625 9:86730816-86730838 CTTTCTAAGCAGGTGGGGAAAGG - Intergenic
1060651598 9:125332108-125332130 CTTTATAAATAGGAGGGGGTAGG - Intronic
1186192198 X:7076792-7076814 CTCTATAAGCAGTTGGGGAGGGG + Intronic
1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG + Intronic
1197269050 X:124406040-124406062 CTTTGCAAACAGCTGGGTATTGG + Intronic
1197526233 X:127567328-127567350 CTGAATAAACAGGAAGGGATTGG - Intergenic
1197590739 X:128406923-128406945 ATTTAAAAACAGGTGTAGATTGG + Intergenic
1198688221 X:139250501-139250523 CTTAAAAGACAAGTGGGGATTGG + Intergenic
1199470853 X:148194005-148194027 CTATACTAACAGGTGGGGAGTGG + Intergenic
1200345599 X:155443839-155443861 CCTTATAAACAGGAGAGAATTGG + Intergenic
1201564153 Y:15348241-15348263 CTCTATAAGCAGTTGGGGAGGGG + Intergenic