ID: 1195943051

View in Genome Browser
Species Human (GRCh38)
Location X:110180842-110180864
Sequence ATGGAGAAGGGAAGTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1082
Summary {0: 1, 1: 0, 2: 10, 3: 98, 4: 973}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195943051_1195943058 -5 Left 1195943051 X:110180842-110180864 CCTTCCACACTTCCCTTCTCCAT 0: 1
1: 0
2: 10
3: 98
4: 973
Right 1195943058 X:110180860-110180882 TCCATCCAAGGGGCTTGCCCAGG 0: 1
1: 0
2: 2
3: 18
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195943051 Original CRISPR ATGGAGAAGGGAAGTGTGGA AGG (reversed) Intronic
900498725 1:2989266-2989288 ATGGAGGATGGATGGGTGGATGG - Intergenic
900869222 1:5289878-5289900 ATGGTGAATGGATGGGTGGATGG + Intergenic
900869257 1:5290060-5290082 ATGGTGAATGGATGGGTGGATGG + Intergenic
901107125 1:6765173-6765195 GTGGAGAAAGGAAGTGAGCAGGG - Intergenic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901419761 1:9143031-9143053 AGGGAGAAGGGAAGGAAGGATGG - Intergenic
901863726 1:12090425-12090447 ATGGATGGGGGAAGGGTGGATGG - Intronic
902322324 1:15676735-15676757 ATGTAGAAGGGAAGTGATGTGGG - Intergenic
902709820 1:18230993-18231015 ATGGAGAAAGGAAGCTGGGACGG - Intronic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903181699 1:21608235-21608257 ATGGAGAATGGCAGTGGGGGCGG - Exonic
903210739 1:21816736-21816758 ATGGGGAAGGTAAGTGTGTGGGG - Intronic
903269389 1:22178172-22178194 ATGGTGATGGGATGGGTGGAAGG - Intergenic
903313654 1:22482386-22482408 GTGGAGAATGGGAGTGGGGAGGG - Intronic
904024211 1:27492007-27492029 ATGGGTGAGGGAAGAGTGGAGGG - Intergenic
904277478 1:29393898-29393920 AGGGAGGAAGGAAGTGGGGAGGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904513282 1:31032452-31032474 AGAGAAAAGGGAAGTGTAGAAGG - Intronic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
905011704 1:34751550-34751572 CTGGAGGTGGGAAGGGTGGAAGG - Intronic
905276405 1:36821476-36821498 ATGGACCTGGGAAGTGTGAAGGG + Intronic
905649349 1:39646215-39646237 ATGGAGCAGGAAAGTGATGATGG - Intergenic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
906575577 1:46886423-46886445 AAAGGGAGGGGAAGTGTGGAGGG + Intergenic
906596399 1:47081473-47081495 AAAGGGAGGGGAAGTGTGGAGGG - Intronic
906680274 1:47721531-47721553 GTGGAGATGGGAAATGTGGATGG - Intergenic
907492460 1:54816894-54816916 ATGGAGTAGGGAAGCGTCCAAGG + Intronic
907527662 1:55063295-55063317 AGGGAGAAATGAAGTGTGGGTGG + Intronic
908397532 1:63740157-63740179 AAAGGGAAGGGAAGAGTGGAAGG - Intergenic
909296402 1:73954436-73954458 ATAGAGAAGGGAAGGAAGGAAGG - Intergenic
909503221 1:76358598-76358620 GTGGAGGAGGCAAATGTGGATGG - Intronic
910005516 1:82391349-82391371 ATGGGGTAGAGAAGTGTGGAGGG + Intergenic
910239779 1:85074072-85074094 AAGGGGTAGGGAGGTGTGGAGGG - Intronic
910380327 1:86620379-86620401 ATGCAGGAGGGAAGTGAAGACGG - Intergenic
910429833 1:87149580-87149602 GAGGAGAAGGGAAGAGTGAAAGG - Intronic
911054162 1:93696563-93696585 ATGGAGAAGGGCAGGATGGGAGG - Intronic
912025961 1:105172742-105172764 ATGTACAAGGAAATTGTGGAGGG - Intergenic
912913742 1:113790170-113790192 ATGGAGAAGGGAAAGGTTGGAGG + Intronic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
914915625 1:151817486-151817508 ACAGAGGAGGGGAGTGTGGAGGG + Intronic
915365266 1:155311595-155311617 ATGGGGAAGGAAACTGGGGAGGG + Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915445228 1:155970739-155970761 AAAGAAAGGGGAAGTGTGGAGGG + Intronic
915724922 1:158010707-158010729 AGGGAGGAGGGAAGGGTGGAGGG - Intronic
915806525 1:158859222-158859244 GTGGAGAAGGGATGTGAGAATGG - Intergenic
915879361 1:159650036-159650058 ATGGAAAAGTGTAGTGGGGAAGG - Intergenic
915924188 1:160003820-160003842 ATAGGGAAGGGAAGTGTGCTGGG + Intergenic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916077355 1:161209587-161209609 AGGGAGAAGGTAAGAGTGGGAGG + Exonic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
916629197 1:166593590-166593612 AAGGAGATGGGAGCTGTGGATGG - Intergenic
916845327 1:168644460-168644482 CTGGTAAAGGGAAGTTTGGATGG + Intergenic
917076183 1:171207467-171207489 CTGGAAAAGGGAAGTGTGTCTGG - Intronic
917253420 1:173088077-173088099 AAGAAGAAGGGATGTGGGGAGGG + Intergenic
917264867 1:173210297-173210319 GTGCAGAAGGGAAGGGTGCAGGG + Intergenic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917591430 1:176480532-176480554 ATGGAGGCGGGAAGGCTGGAAGG + Intronic
917670994 1:177273417-177273439 CTGGAGAAGGGAAGTATAAAGGG + Intronic
917846385 1:179024038-179024060 ATGGAGAAGGGAAAACTGGGGGG + Intergenic
918304423 1:183233108-183233130 ATGCAGAAGGGAGGTGAGGCAGG - Intronic
918446617 1:184623404-184623426 TTCCAGCAGGGAAGTGTGGAAGG - Exonic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918865730 1:189896863-189896885 ATTGAGAAGGGTGGTGTGGGTGG + Intergenic
919094212 1:193010384-193010406 ATGAAGGATGGAAGTGTGGCGGG + Intergenic
919112955 1:193242419-193242441 AAGGAGAAGGGAAGCCAGGATGG - Intronic
919241448 1:194921837-194921859 TTGGAATGGGGAAGTGTGGAAGG + Intergenic
920281010 1:204843671-204843693 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
920412750 1:205774978-205775000 AGGGAGGCGGGAAGTGTGGTCGG + Exonic
920605759 1:207383165-207383187 CTGGAGTAGGCAAGAGTGGATGG - Intergenic
920654160 1:207863141-207863163 GCAGAGAAGGGAAGAGTGGAAGG - Intergenic
920693292 1:208163182-208163204 ATGGGGAAGGGATGTAGGGAGGG + Intronic
921131838 1:212226396-212226418 ATGGAGAGAGGAAGTGGGGAAGG - Intergenic
921333738 1:214065684-214065706 GTGGAGAAGGGGGGTGTGTAGGG - Intergenic
921852063 1:219941665-219941687 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
922355870 1:224774557-224774579 AGGGAGGGAGGAAGTGTGGAAGG - Intergenic
922464036 1:225834412-225834434 AGGGAGAAAGGAAGGATGGACGG + Intronic
922465068 1:225841007-225841029 AAGGAGAGGGGATGTGGGGAGGG - Intronic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
922861172 1:228818158-228818180 CTGCAGCAGGGAGGTGTGGATGG + Intergenic
922887216 1:229029286-229029308 GTGGGGAAGGCAAGTGAGGACGG - Intergenic
923235782 1:232031447-232031469 AAGGAGAAGGGAAGGGAGAAGGG + Intronic
923385850 1:233464659-233464681 CTGAAGAAGGGAAGTGGGGATGG - Intergenic
923474185 1:234317380-234317402 GAGGAGAAGGGAAGTGAGGGGGG - Intronic
923986122 1:239384631-239384653 ATGGACAAGGTAAATGTAGATGG - Intergenic
1062818514 10:517183-517205 ATGGAGAAGGGAAAAGGAGAAGG - Intronic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1063330806 10:5157496-5157518 AGGGAGGAGGGCAGTGTGGAAGG - Intergenic
1063492621 10:6478839-6478861 GTGTAGAAGGGATGTTTGGATGG + Intronic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1064753497 10:18555140-18555162 ATGGAGAATGGAATGGAGGATGG + Intronic
1064756085 10:18572814-18572836 ATGGAGAATGGAATGGAGGATGG - Intronic
1064797494 10:19029728-19029750 AGGGAGAAGGGAAGTGAAGGGGG - Intergenic
1065097682 10:22297884-22297906 AGGGAGGAGGGAGGTTTGGAGGG - Intergenic
1065194339 10:23248062-23248084 CAGGAGAAGGGATGTGTGCATGG + Intergenic
1065327609 10:24563064-24563086 ATGGAGAAGGGTGGGGAGGAGGG - Intergenic
1066183194 10:32983323-32983345 AAGGAGAAGGGAAGTGGTGTGGG - Intronic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1067216912 10:44310944-44310966 ATGGAGAAGGGGAGGGTGCGCGG + Intergenic
1067429302 10:46232577-46232599 GTTGAGAAGTGAAGTGTGGAGGG + Intergenic
1067444437 10:46331828-46331850 GTTGAGAAGTGAAGTGTGGAGGG - Intergenic
1067541157 10:47154602-47154624 ATGGAGCAGGGGTGTGTGAAGGG - Intergenic
1067829840 10:49605241-49605263 ATGAAGATGGGAAGGGTGGGAGG + Intergenic
1068222033 10:54057259-54057281 GTGCAGAAGGGAAATGTGGGTGG - Intronic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1070339144 10:75480815-75480837 TTGGAGCAGTGGAGTGTGGAAGG + Intronic
1070368253 10:75757217-75757239 ATGGGGAAGGGAGGTTGGGAGGG - Intronic
1070417409 10:76203916-76203938 ATGGAATAGGGATGGGTGGACGG - Intronic
1070888612 10:79925818-79925840 AGGGAGAAAGGAAGGGAGGAAGG - Intergenic
1071920759 10:90347290-90347312 ATGAAGAAGGGAAGTCGGAAGGG + Intergenic
1071972510 10:90922360-90922382 TGGGAGAAGGGAATTGTGAATGG + Intergenic
1073070753 10:100791775-100791797 ATGGAGATGGCAGGTGAGGAGGG - Intronic
1073077708 10:100835113-100835135 TTGGAGAAGGGAGATGTGGATGG - Intergenic
1073112325 10:101070087-101070109 ATGGGGAAGGGAGGTGGGGGTGG - Intergenic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1073757420 10:106595507-106595529 ATGGAGTATGGAGGTGTGGAGGG - Intronic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1074133198 10:110602537-110602559 ATGAAGAAAGGAGATGTGGAGGG + Exonic
1074154107 10:110783213-110783235 AGGGAGAGAGGAAGGGTGGAGGG + Intronic
1074348716 10:112713989-112714011 GTTGAGAGGGGAAGAGTGGAAGG - Intronic
1074399312 10:113128749-113128771 ATGAAGGAGGGGAGTGTGGGAGG - Intronic
1074456998 10:113603920-113603942 ATAGAGCAGGGAAGTGGGGCAGG - Intronic
1074612497 10:115035657-115035679 ATGGTGAAGGGAAGGGTTGTAGG + Intergenic
1074909002 10:117890392-117890414 ATGGAGTGGGGAGGTGGGGAAGG + Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075256353 10:120928738-120928760 AGGGAGAAGGGAAGGGAGGGAGG - Intergenic
1075387272 10:122064295-122064317 ATGGAGGAGGGAAGTGTGCATGG - Intronic
1075529158 10:123212907-123212929 ATGGGGAAGGAAAGTGCGGGGGG - Intergenic
1075907196 10:126091918-126091940 AAGGAGGAAGGAAGGGTGGATGG + Intronic
1075985327 10:126780088-126780110 ATAGAGATGGAAAGTGAGGAAGG - Intergenic
1076257787 10:129042270-129042292 ATGGAGTAGGGAAGGGTGGATGG - Intergenic
1076461173 10:130648668-130648690 TTGGTGAAGGGAGGTGCGGATGG - Intergenic
1076571955 10:131438901-131438923 AGGGAGAAGGGAAGAGAGGAGGG - Intergenic
1076630414 10:131848934-131848956 ATGGGGAAGGGAAGCGCGGGCGG - Intergenic
1076856620 10:133118568-133118590 AGAGAGAAGGGAAGAGTGAAGGG + Intronic
1077307167 11:1873594-1873616 ATGGAGAAGGGAGGAAGGGAAGG + Intronic
1078449066 11:11426830-11426852 ATGGAGCAGGGTAGAGGGGAGGG + Intronic
1078895288 11:15592032-15592054 ATGGAGGAAGGAGGGGTGGAAGG + Intergenic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079206155 11:18416723-18416745 ACGGAGAAGGGAAAGGGGGAAGG - Intronic
1079339398 11:19599543-19599565 TTTGAGGAGAGAAGTGTGGAAGG + Intronic
1080132517 11:28813689-28813711 ATGGATAGGGGCAGTGAGGAGGG - Intergenic
1080550350 11:33369139-33369161 AGGGAGAAGGGAAGGGAGAAGGG - Intergenic
1080640903 11:34157734-34157756 ATGGACCAGGGAAGAGTGGATGG - Intronic
1081114795 11:39187203-39187225 TTTGAGAAGGGTAGTGAGGAGGG - Intergenic
1081396794 11:42595695-42595717 ATGGAGAAGGGAATTATTCAGGG - Intergenic
1081482566 11:43503303-43503325 ATGGTGAATGGAAGTTTGGAGGG + Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081860044 11:46327847-46327869 TGGGAGAGGGGCAGTGTGGAGGG + Intergenic
1082061532 11:47865204-47865226 ATGGAGAAGGGAACAGGGTAAGG - Intergenic
1082132437 11:48506528-48506550 AGGGAGAAGGGAAGGGGGAAGGG - Intergenic
1082132443 11:48506540-48506562 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1082565871 11:54677089-54677111 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083659041 11:64243719-64243741 ATGGAGAAGGGTAATGGAGATGG - Intronic
1084779626 11:71399775-71399797 CTGGGGGAGGGCAGTGTGGAGGG + Intergenic
1085299524 11:75450090-75450112 ATGGAGCAGGGCAGAGGGGAGGG + Intronic
1085508837 11:77075093-77075115 AAGGTGATGGGGAGTGTGGAAGG - Intronic
1085753961 11:79188647-79188669 AAGCAGAAGAGAAGTGAGGATGG + Intronic
1085887364 11:80536251-80536273 ATGTAGAGGAGAAGTGTGGCAGG - Intergenic
1086518678 11:87645883-87645905 AGGGAGAAGGGAAGGGGGAAAGG - Intergenic
1086623298 11:88914195-88914217 AAGGTGATTGGAAGTGTGGAAGG - Intronic
1087217394 11:95508496-95508518 ATGGAGAAATGAAGAGTGCAAGG - Intergenic
1087932257 11:103991321-103991343 ATGGAGAAGGGAGGAGGAGAAGG - Intronic
1088076725 11:105858638-105858660 AGGGAGGAGGGAAATGGGGATGG - Intronic
1088584944 11:111353920-111353942 AGGGAGAAGGGAAGGAGGGAAGG + Exonic
1088584963 11:111353977-111353999 AGGGAGAAGGGAAGGAGGGAAGG + Exonic
1088879027 11:113959015-113959037 AATGGGAAGGGAAGTGGGGAAGG + Intergenic
1089506917 11:118969532-118969554 AGGGAGGAGGGAAGGGAGGAGGG + Intergenic
1089602001 11:119622128-119622150 CTTGAGAAGAGAAGTGTGTATGG + Intergenic
1089748507 11:120633800-120633822 AGGCAGAAGGGAAGTGTGGCTGG + Intronic
1089853974 11:121524400-121524422 AGGGACAAGGCACGTGTGGAGGG - Intronic
1090003831 11:122983424-122983446 AAGGAGAAGGGAAGGGAAGAAGG + Intergenic
1090109096 11:123885594-123885616 ATAGATAACGGAAGTGAGGAAGG - Exonic
1090145945 11:124322762-124322784 ATAGAGAATGGAAGGATGGATGG - Intergenic
1090429594 11:126634899-126634921 TTGCACTAGGGAAGTGTGGAGGG + Intronic
1091568199 12:1662735-1662757 AGGGAGGCGGGAAGTGAGGAGGG - Intergenic
1091800712 12:3323027-3323049 AAGGAGAAGGGAAGGGAGAAGGG + Intergenic
1091836341 12:3588757-3588779 ATGGGGAAGGGAACTGTGGGAGG + Intronic
1091936690 12:4440451-4440473 ATGGAGAAGGATGGGGTGGAAGG + Intronic
1091946094 12:4544452-4544474 ATGGAGAAGAGATGGGCGGAAGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092137759 12:6161461-6161483 TTGAAGCTGGGAAGTGTGGAGGG - Intergenic
1092218806 12:6699697-6699719 GGGGAGAAAGGAAGTGGGGAAGG + Intronic
1092850277 12:12619851-12619873 AGGTAGAAAAGAAGTGTGGAGGG - Intronic
1094040310 12:26114615-26114637 CTGGAGCAGGGAAGGGAGGAAGG + Intergenic
1094185860 12:27642001-27642023 ATGGTGAAGGGAAAAGTAGATGG + Intronic
1094198815 12:27777558-27777580 ATAGAGAATGGAAGTGTGAAGGG + Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095361311 12:41343574-41343596 CTGGAGAGGGGAAGTGGGGGAGG + Intronic
1095957794 12:47816763-47816785 CTGGAGGAGGGCAGTGGGGATGG + Intronic
1096539139 12:52294471-52294493 ATGGGGAAGGGAGGAGGGGAGGG + Intronic
1096568181 12:52498608-52498630 AGGGAGATGGGAACTGGGGAAGG - Intergenic
1096603084 12:52744302-52744324 AAAGAGAAGGGAAGGGAGGAAGG + Intergenic
1096604734 12:52756476-52756498 ATTGAAATGGGAACTGTGGAGGG + Intergenic
1096866182 12:54564956-54564978 ATGAAGAAGGGAGGCGGGGAAGG - Intronic
1097198961 12:57261901-57261923 AAGGAGAGGGGACGTGTGAATGG + Intronic
1097908811 12:64947685-64947707 ATGGAGAAGGGAAAGGCTGAAGG - Intergenic
1098030010 12:66243706-66243728 ATGGCGAAGGAAACTGTGGGTGG + Intronic
1098389696 12:69956541-69956563 AAGAAGAAAGGAAATGTGGAGGG - Intronic
1098576029 12:72043313-72043335 AGGGAGAAGGAAAGAATGGATGG - Intronic
1098754170 12:74337142-74337164 GTGGAGAAGGAAAATGTGGTAGG + Intergenic
1099201056 12:79677698-79677720 AGGAAGGAGGGAAGTATGGAGGG + Intronic
1099578151 12:84406024-84406046 ATGGTGAAGAGATATGTGGATGG + Intergenic
1100184984 12:92129118-92129140 AAGGAGAGGGGAAGTTGGGAGGG + Intronic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100642054 12:96491501-96491523 ATGGAGAAGGGAAGAGTCCAAGG + Intronic
1100894041 12:99159372-99159394 CTGGAGTAGGGAAGGATGGAGGG - Intronic
1101309415 12:103562806-103562828 ATAGAGAGGTGAGGTGTGGAAGG - Intergenic
1101418664 12:104531067-104531089 AAGGAGAAGGGAAGAGATGAAGG - Intronic
1101484054 12:105133123-105133145 ATGGGGAAGGGATTTGTGGAAGG - Intronic
1101910079 12:108854869-108854891 ATGGAGACAGCAAGTGTGTATGG - Intronic
1102076978 12:110067489-110067511 ATGGGAAAAGGAAGTGAGGAGGG - Exonic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102517210 12:113457716-113457738 ATGGAGGAGGAAAGGGAGGAGGG + Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102844016 12:116158266-116158288 AAGGTGAAGGGAAGAGGGGATGG + Intronic
1103038226 12:117673472-117673494 ATGGAAAAGGGAAGAATGGTGGG + Intronic
1103070514 12:117937360-117937382 CTTGAGAAGGGTAGGGTGGAGGG - Intronic
1103139115 12:118533454-118533476 ATGGAGAAGGGAAGGTGGAAAGG + Intergenic
1103479981 12:121244633-121244655 AGGGAAAAGGGAAGTGAGAAGGG + Intronic
1103640495 12:122347606-122347628 ATGGAGAAGGGAAGAGGTGGAGG + Intronic
1103794550 12:123494414-123494436 ATGGGGCAGGGAAGAGAGGAGGG - Intronic
1104213327 12:126711519-126711541 AGGGAGAAGGGAGGGATGGAGGG + Intergenic
1104463316 12:128971715-128971737 ATGGAGGGGGGAAGGGAGGAGGG - Intronic
1104759220 12:131287091-131287113 AGGAAGGAGGGAAATGTGGAGGG - Intergenic
1104896434 12:132167136-132167158 ATGGATAAGGGATGGGTGGGTGG - Intergenic
1105059432 12:133134980-133135002 ATGGAGAAAGGAAATGTGGCTGG - Intronic
1105338058 13:19493302-19493324 GTGTTGAAGAGAAGTGTGGATGG + Intronic
1105748701 13:23401378-23401400 ATGAAGACTGGAAGTGGGGAGGG - Intronic
1106085306 13:26536352-26536374 ATGGAGAAGGGAAGAAGGGCAGG + Intergenic
1106132771 13:26953250-26953272 AAGGAGAAGGGAAGGGAGGGGGG + Intergenic
1106360042 13:29022638-29022660 AATGAGGAGGAAAGTGTGGAAGG + Intronic
1106413630 13:29528050-29528072 ATGGAGAAGGGAACAGCAGAGGG - Intronic
1106584984 13:31049040-31049062 AGGGAGAAGGGATGTCTGGAGGG + Intergenic
1106892378 13:34259721-34259743 ATTGAGAAGGGCAGAGTAGATGG + Intergenic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107880820 13:44830506-44830528 AAGGAGATGTGAATTGTGGATGG - Intergenic
1108258248 13:48631120-48631142 ATGGAAGAGGGAAGTGTGTTTGG - Intergenic
1108315702 13:49235119-49235141 AGGGAAGGGGGAAGTGTGGAGGG + Intergenic
1108462683 13:50682898-50682920 AGGGAGAGGGGAAGTGAGGTGGG - Intronic
1108753936 13:53477263-53477285 ATAGAGAAAGGAAGTGAGAATGG - Intergenic
1109034617 13:57240388-57240410 ATGGAGAAGACAAGAGTTGATGG + Intergenic
1109154425 13:58888347-58888369 ATGAAGAACTGAAATGTGGAGGG + Intergenic
1109671402 13:65613322-65613344 TTGGAGAAGGGATCTTTGGAAGG - Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110619567 13:77579809-77579831 ATGCAAAGGGGAGGTGTGGATGG + Intronic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1110885495 13:80628874-80628896 AGGGAGAAGTGAAGAGTGAAGGG - Intergenic
1110933638 13:81254497-81254519 TTAGAGAATGGAAGTGAGGATGG - Intergenic
1111084136 13:83351810-83351832 AGGGAGAAAGGAAGGGGGGAAGG + Intergenic
1112353459 13:98655386-98655408 ATGGAGAGGGGAAGTGCGCAGGG - Intergenic
1112585056 13:100711746-100711768 ATGGAGGAAGGAAGTATGGGAGG - Intergenic
1113066317 13:106376809-106376831 ATGGATTAGGGAAGTGGGGAAGG - Intergenic
1113086261 13:106572313-106572335 TTGGAGAAGGGAATGGAGGAAGG - Intergenic
1113110183 13:106814323-106814345 AGGAAGAAGGGAAGGGAGGAAGG + Intergenic
1113166687 13:107450707-107450729 ATGGAGAAATGAAGTGGGGCTGG + Intronic
1113574932 13:111388648-111388670 AGGGAGGAGGGAAGCGAGGAGGG - Intergenic
1114179177 14:20350929-20350951 AGGGAGAAGGGAAAGGTGAAAGG - Intronic
1114854764 14:26424833-26424855 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
1114863214 14:26553526-26553548 ACAGAGAAGGGAAGTGGGCATGG - Intronic
1115053064 14:29088720-29088742 GTGGAGAGGGGAAATGGGGATGG + Intergenic
1115432876 14:33341548-33341570 ATGCGGGAGGGAAGTGGGGATGG + Intronic
1115924922 14:38421982-38422004 GAGGAGGAGGGAAGTGGGGATGG - Intergenic
1116043483 14:39714677-39714699 GTGGAGAAGGGCAATGTGAAAGG - Intergenic
1116065834 14:39981867-39981889 ATGGAGGAGGCAAGAGTAGAAGG - Intergenic
1117265340 14:54080486-54080508 ATGGGGAAGAGAAATATGGATGG - Intergenic
1117474268 14:56078054-56078076 ATGCAGCAGGGAGGTGTGGCTGG + Intergenic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1118513822 14:66505857-66505879 ATGGAGATGGGGAGGGTTGATGG - Intergenic
1118723843 14:68612844-68612866 AGGGAGAGGGGAAGGGAGGAAGG + Intronic
1118908408 14:70040803-70040825 GAGGAGAAGGGAACTGTGGGAGG + Intergenic
1118946150 14:70389296-70389318 TGGGAGAAGGAAAGTGTGGAAGG - Intronic
1118981927 14:70724189-70724211 CTGGAGAAGGGAAGTGATTATGG - Intronic
1119028862 14:71175871-71175893 TTGGAAGAGAGAAGTGTGGAGGG + Intergenic
1119438132 14:74611422-74611444 ATGGGAGAGGGAAGTTTGGAGGG - Intronic
1119529856 14:75352517-75352539 ATGGGGAAGGGAAGAGAGGGTGG - Intergenic
1119542516 14:75450083-75450105 ATGGACAAGGGGAGTTGGGAGGG + Intronic
1119727138 14:76928365-76928387 GTGGAGGAGGGGAGTGGGGAAGG - Intergenic
1119896057 14:78220784-78220806 ATTGAGAAGGGAAGTAGGGAAGG + Intergenic
1119932043 14:78556969-78556991 AGGGAGAAGGGAAGGGAGGGAGG - Intronic
1119940270 14:78633448-78633470 ATGTTGAAGGGGAGTGGGGAGGG - Intronic
1119977362 14:79040064-79040086 AGCGAGATGGGAACTGTGGAAGG - Intronic
1120411261 14:84159068-84159090 AGGGAGAGGGGAAGTATGGCAGG + Intergenic
1120612088 14:86654678-86654700 ATGGCGAATGGAAGAATGGAAGG - Intergenic
1120635348 14:86943992-86944014 AGGGAGGAGGGAAGGGAGGAGGG - Intergenic
1120635362 14:86944032-86944054 AGGGAGGAGGGAAGGGAGGAGGG - Intergenic
1120739553 14:88092540-88092562 CTGGACAAGGGAAGTGTGTGAGG + Intergenic
1120929236 14:89831660-89831682 ATGGTGAAGGGAAGAATGGAAGG + Intronic
1120966437 14:90171654-90171676 AGGAAGAATGGAAGTGGGGAGGG + Intronic
1121186163 14:91971617-91971639 AAGGGGAAGGGAAGAGAGGAAGG + Intronic
1121189076 14:92008245-92008267 TTAGAGAATGGAAGTGAGGAAGG - Intronic
1121235978 14:92391492-92391514 ATGGGGTAAGGGAGTGTGGACGG - Intronic
1121414199 14:93767747-93767769 ATGGAGAGGGGGGGTGTGTAGGG - Intronic
1121504995 14:94470261-94470283 ATGGATAAAGAATGTGTGGAGGG - Intronic
1121578745 14:95010486-95010508 AGGAAGAAGGGAAGGGAGGAAGG + Intergenic
1121595819 14:95161461-95161483 TTGGAGAAGAGAAGGGTTGAAGG + Intergenic
1122098253 14:99386986-99387008 ATGGACAAGGGGAGACTGGAAGG + Intergenic
1122713810 14:103681090-103681112 AGTGAGAAAGGAAGCGTGGAAGG - Intronic
1123058832 14:105585344-105585366 ATGGAGGATGGAAGGGTGGATGG - Intergenic
1123083159 14:105705570-105705592 ATGGAGGATGGAAGGGTGGATGG - Intergenic
1123881692 15:24682578-24682600 CTGGAGGAGGGAACTGTGGTAGG - Exonic
1124100389 15:26687548-26687570 AGGGAAAAGGGAAGAGAGGAAGG - Intronic
1124122073 15:26895991-26896013 AGGGTGCAGGGAAGGGTGGAAGG - Intronic
1124131194 15:26987250-26987272 GTGGAGCTGGGAAGTATGGAAGG - Intronic
1124145537 15:27121974-27121996 ATGGAGCGGGGAAGTGGGAATGG + Intronic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1125701490 15:41689351-41689373 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
1126460160 15:48906503-48906525 ATTGAGAAGGGGAGTGGGTAGGG - Intronic
1127070229 15:55281719-55281741 AGGGAGAAGGGAAGGGGGAATGG + Intronic
1127328439 15:57916986-57917008 GGGGAGAAGGAAAGCGTGGAGGG + Intergenic
1127341391 15:58048524-58048546 ATTGAGAAGGGAAGTATGGATGG + Intronic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1127691117 15:61398660-61398682 AGGGAGAGGGGAAAGGTGGAGGG + Intergenic
1127953991 15:63836483-63836505 TTGGAGATGGGAAGAGTGGATGG + Intergenic
1128304132 15:66586984-66587006 AGGGGGAAGGGAAGTGGGGAGGG - Intronic
1128323025 15:66705780-66705802 GGGAAGAAGGGAAGTGTGCAGGG + Intronic
1128337842 15:66798815-66798837 ATGGTGGAGGGAGGTGGGGAGGG + Intergenic
1128370532 15:67036004-67036026 GAGGAGAAGGGAAGTGAGGTGGG - Intergenic
1128443458 15:67736163-67736185 ATGGAGATGGCAAGTGTAGCAGG + Intronic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1128885109 15:71279569-71279591 CTCCAGGAGGGAAGTGTGGAGGG + Intronic
1129178298 15:73855694-73855716 ATGGGGAAGGGAAGTGTTTTGGG + Intergenic
1129518890 15:76173278-76173300 TTGGAGAGAGGAAATGTGGAGGG + Intronic
1130379113 15:83356805-83356827 GTGGAGGAGGGAAGAGGGGAAGG - Intergenic
1131633653 15:94206802-94206824 ATGGAGATGAGAAGTTTAGAAGG - Intergenic
1131780064 15:95846328-95846350 AGGGAGAAGGGAAGAGAGGAGGG + Intergenic
1131949533 15:97666111-97666133 ATGGAGAGGGGAAGAGTGAATGG - Intergenic
1133048446 16:3102388-3102410 GGGGAGATGGGAAGTGAGGAAGG + Intergenic
1133087454 16:3375924-3375946 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
1133758654 16:8781055-8781077 AGGGAAAAAGGAAGTGTGGAGGG + Intronic
1133855249 16:9543590-9543612 AGGGAGGAGGCAAGTGTGGCTGG - Intergenic
1134241072 16:12507409-12507431 ATGGAAAACGGAATTGGGGAGGG - Intronic
1134610110 16:15601337-15601359 ATGGAGAAGGGAACTGGGCTAGG - Intronic
1134860146 16:17553612-17553634 AAGGAGAAGGGATGGGTAGATGG + Intergenic
1135223698 16:20637272-20637294 CTGGAGCAGGGAAGTGCGGCTGG + Intronic
1135234289 16:20741442-20741464 CGGGAGGAGGGAAGGGTGGAGGG - Intronic
1135379057 16:21978510-21978532 ATGGAAAAGGCAGGTGGGGAAGG - Intronic
1135939922 16:26813692-26813714 ATGGACATGGATAGTGTGGATGG + Intergenic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1137003189 16:35249815-35249837 AGAGAGAAGGGAGGTGTAGAGGG + Intergenic
1137067362 16:35862438-35862460 AGGGAAAGGGGAAGTCTGGAAGG - Intergenic
1137554196 16:49460475-49460497 ATGGAGAAGGGGAGGTTTGAGGG + Intergenic
1137973094 16:53005226-53005248 ATGGAAAAGTGGAGTATGGATGG + Intergenic
1138520300 16:57567283-57567305 AGGGAGATGGGAGATGTGGAGGG + Intronic
1138646258 16:58427245-58427267 TTGGAGAAGGGAAGTCTTGAGGG - Intergenic
1139209983 16:65067861-65067883 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1139968248 16:70757474-70757496 CTGGAGAAGGGAAGACGGGAGGG + Intronic
1140128531 16:72137589-72137611 ATGGAGGAGGCAAGTGCGGCTGG + Intronic
1140387214 16:74551792-74551814 AAAGAGAAGGGAAGTGGGGAAGG + Intronic
1140771271 16:78205985-78206007 ATGGAGACAGGAAGGGAGGAAGG - Intronic
1141230990 16:82167427-82167449 GTGGAGAGGGGAAGGGTAGATGG + Intronic
1141313208 16:82935210-82935232 ATGGAGAAGTGCAGAGTGAAGGG + Intronic
1141314319 16:82946260-82946282 ATGTGGGAGGGAAGGGTGGAAGG + Intronic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141562711 16:84880084-84880106 GTGGAGGAGGAAAGGGTGGAGGG - Intronic
1141606495 16:85156929-85156951 ATGGAGAAAGGATGGATGGATGG - Intergenic
1141924129 16:87156069-87156091 ATGGAGATGGGTGGTGTTGATGG + Intronic
1142234513 16:88915448-88915470 GTGGAGGAGGGGAGAGTGGAGGG + Intronic
1142251462 16:88993815-88993837 AAGGAGGAGGGAAGAGAGGAGGG - Intergenic
1203113784 16_KI270728v1_random:1469528-1469550 AAGGAGAAGGGAAGGGAAGAGGG - Intergenic
1142607744 17:1091382-1091404 GTGGAGATGGGCTGTGTGGATGG - Intronic
1142635034 17:1251846-1251868 TTGGAGCAGGGCAGTGTGGTGGG - Intergenic
1142958241 17:3535438-3535460 AAGGAGGAAGGAAGTGAGGAGGG - Intronic
1143306295 17:5949714-5949736 ATGAAGGATGGAAGTGTGGGTGG - Intronic
1143473931 17:7192468-7192490 ATGGAGAAAGGAACCGTGGAGGG + Intronic
1143695185 17:8609345-8609367 ATCGAGAAGGAAAGGGAGGAAGG + Intronic
1143770038 17:9162709-9162731 GTGGAGAAGGGAGGAGTTGAGGG + Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1144574997 17:16423781-16423803 CTGGAGAGGGGAAGTGGGAAGGG - Intronic
1145846542 17:28042975-28042997 GAGGAGGAGGGAGGTGTGGAAGG - Exonic
1145940059 17:28738646-28738668 GGGGAGAAGGGCAGTGAGGAAGG - Intronic
1145978734 17:28999092-28999114 ATGGAGAATGGAAGGATGGATGG + Intronic
1146559162 17:33853229-33853251 AGGGAGAGGGGAGGTGGGGATGG + Intronic
1146722381 17:35132452-35132474 GTGGAGAAGGGAAGGGTGTCAGG + Intronic
1146904276 17:36608208-36608230 AAGGACAAGGGAAGAGAGGACGG - Intronic
1146948981 17:36892739-36892761 AGGGAGCAGGGGAGTGTTGAGGG - Intergenic
1147874867 17:43613968-43613990 ATGGAGAAGGGAGGTGGGGGAGG + Intergenic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1148797759 17:50205300-50205322 ATGGAGGGAGGGAGTGTGGAGGG + Intergenic
1149031865 17:52092629-52092651 ATGGAGGTGGGAAGGATGGAGGG - Intronic
1150645714 17:66976404-66976426 ATGGAGGTGGGAAGGATGGAGGG - Intronic
1151271014 17:72996057-72996079 GTGAAGGAGGGCAGTGTGGAGGG - Intronic
1151300824 17:73224031-73224053 AGGGAGAAAGGAAGAGAGGAAGG + Intronic
1151336054 17:73440437-73440459 GTGCAGGAGGGAAGTGTGCATGG - Intronic
1151443411 17:74148207-74148229 ATGCAGAAAGGAGGTGGGGAGGG - Intergenic
1151458232 17:74239328-74239350 ATGGAGGAGGCACGTGGGGAGGG + Intronic
1151724787 17:75877681-75877703 ATGGAGATGGGAAGGGAGGAAGG - Intronic
1151881131 17:76895381-76895403 AGGGAGAGGGGCAGTGGGGATGG - Intronic
1152251605 17:79215461-79215483 ATGGAGAAAGGAAGGGAGGTTGG - Intronic
1152433633 17:80262414-80262436 CTGGAGAGGGGAGGTGTGCAGGG + Intronic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1153129356 18:1836824-1836846 ATGATGATGGGAAGTGGGGATGG + Intergenic
1153718943 18:7881698-7881720 AAGGAGAAGGGAAGAGGGTACGG - Intronic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1154949095 18:21190865-21190887 AGGGGGAAGGGAACTGGGGAAGG - Intergenic
1155358143 18:24973515-24973537 TGGTAGAAGGGAAGGGTGGAGGG - Intergenic
1155797382 18:30057563-30057585 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
1155797396 18:30057663-30057685 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
1156123155 18:33869932-33869954 ATGAAGAAAGGCAGGGTGGATGG + Intronic
1156148989 18:34222317-34222339 GTGGAAGAGGGAAGTGAGGAAGG + Intronic
1156540279 18:37903036-37903058 GTGGAGAAGGGCAGTGATGATGG + Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156673704 18:39502000-39502022 GTGGAGAAAAGAAGAGTGGAGGG + Intergenic
1157231106 18:45916860-45916882 ATGGAGTTGGGGAGTGAGGAGGG - Intronic
1157447435 18:47755935-47755957 ATTGAGATGGAAAGTGTTGAAGG - Intergenic
1157619223 18:49006447-49006469 ATGGAGATGGTAAGGGTGGAGGG - Intergenic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1157873186 18:51248765-51248787 TTGGAGAAGGGCAGTTGGGAAGG - Intergenic
1157884190 18:51350575-51350597 AGGGAGAAGGGAAGGGGGAAGGG - Intergenic
1158117289 18:54009900-54009922 AGAGGGAAGGGAAGTGGGGATGG + Intergenic
1158406592 18:57165452-57165474 ATGGAGGAGGGAGGTGAGGTGGG - Intergenic
1158491172 18:57910928-57910950 ATGGGGAAGGCAGGTCTGGAAGG + Intergenic
1158875305 18:61728553-61728575 ATGGAGAATGGAGGGATGGAAGG + Intergenic
1159022010 18:63151171-63151193 GTGGAGAAGGGAATTTTGGGGGG - Intronic
1159087348 18:63809065-63809087 AATGGAAAGGGAAGTGTGGATGG + Intergenic
1159325984 18:66918370-66918392 AGGGAGGAGGGAAGGATGGAAGG - Intergenic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1160040680 18:75342728-75342750 AAGGCGAAGGGAAGAGTGGGAGG - Intergenic
1160147158 18:76375235-76375257 AAGGAGAAAGGAAATGCGGAAGG + Intronic
1160436077 18:78853831-78853853 ATGCAGTAGGCAAGTGTGCAGGG - Intergenic
1160535527 18:79589557-79589579 AGGGAGAAGGGAGATGGGGAAGG + Intergenic
1160676843 19:395529-395551 ATGGAGAAGGGTGATGGGGAAGG + Intergenic
1161222747 19:3125480-3125502 ATGGAGCAGGGAAGTGGGACAGG + Intergenic
1161268243 19:3375097-3375119 GAGGAGAGGGGAAGTGGGGAGGG + Intronic
1161329081 19:3677926-3677948 ATGGAGAATGGAGGGATGGAGGG + Intronic
1161329173 19:3678267-3678289 ATGGAGAATGGAGGGGTGGAGGG + Intronic
1161354446 19:3811070-3811092 ATGGGGTCGGGAAGTGTGGAAGG - Intronic
1161770837 19:6229999-6230021 ATGGAGGAGGGGGGCGTGGAGGG - Intronic
1161821493 19:6533433-6533455 ATGGAGAGGGGAAGGGGGAAGGG - Intronic
1162065621 19:8123698-8123720 CTGGAGATGGGAAGTGTGTTTGG - Intronic
1162226309 19:9225512-9225534 AAGGAGAGGGGAATTGAGGATGG + Intergenic
1162322554 19:9978754-9978776 ATGGTGGAGGGAACTGGGGAAGG - Intronic
1163078185 19:14915257-14915279 AATAAGAAGGAAAGTGTGGACGG - Intergenic
1163295329 19:16408049-16408071 ATGGATAAGGGAAGGGAAGATGG + Intronic
1163445887 19:17346282-17346304 TTGGAGAAGGGATGGATGGAGGG + Intergenic
1164731002 19:30504439-30504461 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
1165797706 19:38528430-38528452 AGGGACAAGGGAAGCGTGAAGGG + Intronic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1165953975 19:39490154-39490176 GTGGAGAAGGGAAGAGAGGATGG + Exonic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1166704021 19:44898372-44898394 GTGGAGAAGGGAAGGGAGGTTGG - Intronic
1166816621 19:45550264-45550286 TTAGAGAAGGGAGGTGAGGATGG + Intronic
1167371584 19:49085743-49085765 ATGCAGAAGGGACCTGTGGCGGG - Intronic
1167485804 19:49762286-49762308 ATGGAGAAAGGAAGGCAGGAGGG - Intronic
924996084 2:363016-363038 ATGGAGATGGAAAGTGTAAAAGG - Intergenic
925264606 2:2558191-2558213 ATGGAGAGAGGAAATGTGGCTGG + Intergenic
925294638 2:2768915-2768937 AATGAGAGGGGAGGTGTGGAGGG - Intergenic
925294658 2:2768986-2769008 AGGGGGAGGGGAGGTGTGGAGGG - Intergenic
925638426 2:5964918-5964940 GTGCAGAAGGGAAATGTGGTGGG - Intergenic
925659158 2:6184141-6184163 AAGGAGAAGAGAAGGGTGGGAGG + Intergenic
925791036 2:7488608-7488630 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791080 2:7488759-7488781 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791094 2:7488805-7488827 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791114 2:7488875-7488897 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791155 2:7489015-7489037 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791186 2:7489123-7489145 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791200 2:7489169-7489191 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
926137436 2:10346778-10346800 ATGGAGAAGGAAGGGGAGGAAGG - Intronic
926236990 2:11053102-11053124 AGGAAGAAGGGAGATGTGGAGGG + Intergenic
926433869 2:12818361-12818383 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
927083590 2:19653617-19653639 ATGGAGGAGGGCAGAGAGGATGG + Intergenic
927197153 2:20555879-20555901 ATGCAGAGGTGAAGTGGGGAAGG - Intergenic
927280837 2:21305024-21305046 AAGGAGAAGGGAAGTGGGGAAGG + Intergenic
927389182 2:22573846-22573868 ATTGGGAAGGGAAGTAGGGAGGG + Intergenic
927451377 2:23212339-23212361 ATAGAGAGGGCAGGTGTGGAAGG - Intergenic
927738478 2:25545041-25545063 AAGGAGATGGAAAGTGTGAAAGG - Intronic
927813173 2:26191693-26191715 ATGCAGAATGGAAGTCGGGATGG + Intronic
927839213 2:26427718-26427740 ACTGAGAAGGGTAGTGTGGAGGG - Intronic
927859367 2:26550908-26550930 ATGCATCAGGGGAGTGTGGAGGG - Intronic
929172957 2:38949585-38949607 ATGGAGAAGAGAGGGATGGAAGG + Intronic
929457775 2:42078150-42078172 ATGGAGTGGGGTAGGGTGGAGGG - Intergenic
929501101 2:42492760-42492782 ACGGAGACGGGACGTATGGACGG + Intronic
929744638 2:44643272-44643294 ATGGAGAGGGTAAGAGTTGAGGG + Intronic
929769784 2:44881903-44881925 ATGGATAAGGAAAGAATGGAAGG - Intergenic
930319616 2:49837941-49837963 ATAGAGAAAGGAAGGGAGGAAGG - Intergenic
930394572 2:50804830-50804852 TGGGAGAAGGGAAGAGTGGTTGG - Intronic
930472104 2:51829824-51829846 AAGGAGAAGAGAAGAGGGGAGGG - Intergenic
930694548 2:54397834-54397856 ATGGAGGAAGGAAGAGTGGAGGG + Intergenic
930729483 2:54713635-54713657 AAGGAGAAGGAAAGTCTAGATGG + Intergenic
931220480 2:60284399-60284421 ATGGGGAAGGGGAGTGGGGCTGG - Intergenic
931246674 2:60498117-60498139 TGGGAGAATGGAGGTGTGGAGGG + Intronic
931927196 2:67086387-67086409 AGGGAGATGGGAAGAGGGGAGGG - Intergenic
932336658 2:70935672-70935694 AGGGAGAAGGGAAGAGGGGAGGG - Intergenic
932793934 2:74679350-74679372 ATGGATTAGGGAAATGTGGGTGG + Intronic
933637292 2:84721966-84721988 ATAGAGAAGGGAATCTTGGAAGG + Intronic
934249397 2:90336257-90336279 AGGGAGAAAGGAAGTGAGGGAGG - Intergenic
934294773 2:91733578-91733600 ATGGTGGGGGGATGTGTGGAAGG + Intergenic
935008160 2:99102267-99102289 ATGAAGAAAGGAGATGTGGAGGG + Intronic
937552133 2:123107551-123107573 ATGGGGGAGGGAAAAGTGGAAGG - Intergenic
938108131 2:128547066-128547088 ATGGAGAATGGATGGATGGATGG - Intergenic
938189154 2:129258805-129258827 ATGTAGAGGAGGAGTGTGGAGGG + Intergenic
938245256 2:129771796-129771818 ATGGAGAAGGTAAGTATATAAGG - Intergenic
938519123 2:132048670-132048692 AGGGAGAAAGGAAGGGAGGATGG - Intergenic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939481528 2:142753989-142754011 ATGGAGAAGGGAAAGGTGTGAGG + Intergenic
940101803 2:150048640-150048662 AGGGAGATGGGAGATGTGGAAGG + Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
940569955 2:155418294-155418316 AGGGAGGAGGGAAGTGGGGGAGG - Intergenic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
941795587 2:169595538-169595560 ATGGGGACTGGAAGTGAGGATGG - Intronic
942165731 2:173238998-173239020 ATGGAGGATGCAAATGTGGATGG - Intronic
942572536 2:177328428-177328450 ATGGAGAAGGTAATTGGAGATGG + Intronic
942661259 2:178267431-178267453 TGGGAGAAGTGAAGTGGGGAAGG - Intronic
942778117 2:179609194-179609216 TTGGGGAGGGGAAGTGGGGATGG - Intronic
942798769 2:179852171-179852193 ACGGAGAAGGGAAGGCAGGAAGG + Intronic
943248369 2:185484942-185484964 CTGTAGTAGGGCAGTGTGGAGGG + Intergenic
943967666 2:194357988-194358010 AGGTGGGAGGGAAGTGTGGATGG + Intergenic
944950525 2:204743839-204743861 TTTCAGAAGGGAAGTGTGGATGG + Intronic
944963036 2:204898428-204898450 GTGGATGGGGGAAGTGTGGATGG - Intronic
945066038 2:205948606-205948628 ATGGGAAAGGGAAGTGTGACCGG + Intergenic
945214828 2:207422153-207422175 AAAGAGAAGGGAAGTGGGGTCGG + Intergenic
945463615 2:210141133-210141155 GTGGGGAAGGGAAGGGAGGAAGG - Intronic
945675878 2:212855134-212855156 AGGGAGAGGGGAGGAGTGGAAGG - Intergenic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946353242 2:219169121-219169143 ATGGAGAAGAGAAGGGTGAATGG + Intronic
946441979 2:219704387-219704409 CTGGGGGAGGGCAGTGTGGAGGG - Intergenic
946759886 2:222982998-222983020 ATGGAGACGGGAAGTGGGGAAGG - Intergenic
946822727 2:223647097-223647119 AAGTAGAAGGGAAGTGTGAAAGG - Intergenic
947037755 2:225878844-225878866 AGGAAGAAAGGAAGTGAGGAAGG - Intergenic
947102670 2:226638163-226638185 ATGAAGAAGGGAAGAGGGAATGG + Intergenic
947442299 2:230133826-230133848 GTGCAGAAGGGAAATGTGGGTGG - Intergenic
947624825 2:231612913-231612935 AGGGAGAAGGGAAGGGGGGACGG + Intergenic
947946047 2:234103207-234103229 ATTTAAGAGGGAAGTGTGGATGG - Intergenic
947958225 2:234213104-234213126 ATGGAGAGGGGGAGGGTGCATGG + Intergenic
947958230 2:234213123-234213145 ATGGAGAGGGGAATGGTGTATGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948375516 2:237518015-237518037 ATGAAGGAGGGAGGGGTGGATGG + Intronic
948677648 2:239608185-239608207 ATGGAGAAAGGGAGTGTAAAGGG - Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1169127310 20:3138772-3138794 TGGGGGTAGGGAAGTGTGGAAGG + Intronic
1169235385 20:3926051-3926073 ATGGAGAGGGGAGAAGTGGATGG + Intronic
1169333189 20:4732576-4732598 CTAGAGAAGGGAAGTCTGAAAGG + Exonic
1169471827 20:5892776-5892798 AGGTAGAAGGGAAGTTTGGGTGG - Intergenic
1169607137 20:7334398-7334420 ATACAGAAGGGAACTGGGGAAGG + Intergenic
1169683382 20:8242519-8242541 ATTGAGAGGGGAAGTTTGCAAGG + Intronic
1169744712 20:8931934-8931956 CTGGAAAAGAGAAGGGTGGATGG - Intronic
1169774258 20:9235126-9235148 ATGGATAATGAAAGTGTGGTAGG + Intronic
1169849678 20:10035378-10035400 CTGGAGAAGAGAGGAGTGGAGGG - Intronic
1170113812 20:12835567-12835589 CTGGAGATGGGAAGTCTGTATGG - Intergenic
1170405621 20:16032748-16032770 AGGGAGGAGGGAAGAGAGGAAGG + Intronic
1170459617 20:16564962-16564984 ATGGAGAGAGGAAGGGAGGAAGG - Intronic
1170527949 20:17260125-17260147 ATGGGGTAGGGAAGTATGCAAGG - Intronic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1171045412 20:21805788-21805810 ATGAAAAAATGAAGTGTGGATGG - Intergenic
1171077036 20:22137838-22137860 GTGCAGAAGGGAAATGTGGATGG - Intergenic
1171358921 20:24572913-24572935 ATTCAGATGGGTAGTGTGGATGG + Intronic
1171815604 20:29783542-29783564 AGGGAGAAGGGATTAGTGGAGGG - Intergenic
1172144163 20:32744433-32744455 CTGGAGCAGGGAAATGTGGGGGG + Intergenic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1173125418 20:40331942-40331964 TTGGAGAAGGGAAGTGCCCAAGG + Intergenic
1173739195 20:45384914-45384936 ATGGAGGAGGGAGGTATAGATGG - Intronic
1173865489 20:46309743-46309765 ATGGAGATGGAAATTGGGGAAGG - Intergenic
1174062768 20:47844150-47844172 AGGGAGAAAGGAAGGGAGGAAGG + Intergenic
1174375956 20:50126907-50126929 AGGGAGGAGAGAAGTGTGGGAGG - Intronic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174736349 20:52969383-52969405 ATGGACCAGGGCAGGGTGGATGG + Intergenic
1175135215 20:56818365-56818387 AGGGAGGAGGGAAGGGAGGAAGG + Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1175385680 20:58593507-58593529 ATGAAGAAGGGATGGATGGATGG + Intergenic
1175537244 20:59723282-59723304 AGGGAAAGGGGAAGTGGGGAGGG - Intronic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1175594682 20:60221682-60221704 AGGTTGAAGGGAATTGTGGAAGG + Intergenic
1175625670 20:60486638-60486660 CTGGGGAAGGGAAGTGTTTAGGG + Intergenic
1175763345 20:61576034-61576056 AAGGAGAAGGGACAAGTGGAGGG + Intronic
1175772627 20:61633170-61633192 ATGGAGGATGGATGGGTGGATGG - Intronic
1175890596 20:62314200-62314222 ATGGAGAGGTGAAGGGTGGTGGG + Intronic
1175902169 20:62364268-62364290 CTGGAGAAGGTAGGTGTGGGCGG + Intronic
1175934869 20:62509923-62509945 ATGGAAGATGGAAGGGTGGAGGG - Intergenic
1175934936 20:62510100-62510122 ATGGAGGATGGAGGGGTGGAGGG - Intergenic
1175934945 20:62510123-62510145 ATGGAAGAGGGACGGGTGGAGGG - Intergenic
1175934972 20:62510207-62510229 ATGGAGGCTGGAAGGGTGGAGGG - Intergenic
1175935000 20:62510283-62510305 ATGGAGACTGGAGGGGTGGAGGG - Intergenic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1175935179 20:62510768-62510790 GTAGAGGATGGAAGTGTGGAGGG - Intergenic
1175983977 20:62755172-62755194 AGGGAGGAGGGAGGGGTGGAGGG - Intronic
1176016167 20:62934251-62934273 GTGGAGAAGGGATGGGTGGAGGG - Intronic
1176071565 20:63229413-63229435 GGGGAGACGGGGAGTGTGGACGG - Intergenic
1176106921 20:63393778-63393800 AGGGAGGACGGAAGGGTGGATGG + Intergenic
1176757768 21:10738416-10738438 GTGGAGAGGAGAGGTGTGGAGGG - Intergenic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177144994 21:17397800-17397822 AGGGAGAAGGGAAGGGAGGGAGG + Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177698900 21:24610778-24610800 ATTGAGAAGAGAACTGTGGTAGG - Intergenic
1177763513 21:25430277-25430299 CTGGAGAAGGTAATTGTGGTGGG - Intergenic
1178050677 21:28743585-28743607 AGGGAGAATGGAAGAGAGGAAGG + Intergenic
1178150830 21:29791495-29791517 AAGGAGAAGGGAAGTGGGGGGGG + Intronic
1178462797 21:32818327-32818349 AAGGGGAAGGGAAGTTGGGAAGG - Intergenic
1178478986 21:32962860-32962882 ATGGTGAGGTGAAGGGTGGATGG - Intergenic
1178723045 21:35027116-35027138 ATCAAGAAGGGCAGGGTGGAGGG + Intronic
1178797680 21:35760130-35760152 AGGAAGAAGGGAAGTGGGGCAGG - Intronic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1178941884 21:36913420-36913442 AGGGAGAAGGGCAGTGGGCAGGG + Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1180006310 21:45022577-45022599 CTGAAGAAGGGCAGTCTGGAGGG + Intergenic
1180590166 22:16930604-16930626 AAGGGCAAGGGGAGTGTGGATGG + Intergenic
1180605740 22:17057719-17057741 ATGGAGAAGGGAAGGCCTGAAGG - Intergenic
1180930786 22:19589567-19589589 ATGGAGAAGGGATTGATGGAAGG - Intergenic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1181459650 22:23078591-23078613 ATGGATAGAGGAGGTGTGGAGGG + Intronic
1181762459 22:25067636-25067658 ATGGAGAGAGGAAGAGAGGATGG - Intronic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1181789213 22:25250488-25250510 AAGGAGAAGGGAAGGGAGGGAGG - Intergenic
1181876831 22:25946077-25946099 AATGAGAAGGGAAGAGGGGAAGG - Intronic
1181959005 22:26609613-26609635 ATGGAGAATGGATGTATGTATGG + Intronic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182083220 22:27543652-27543674 AAGGAGGAGGGAAGGGAGGAGGG - Intergenic
1182086704 22:27565790-27565812 AGGGAGAAAGGAAGGATGGATGG + Intergenic
1182413246 22:30204670-30204692 AATGAGAAGGGAACTGTGGTTGG + Intergenic
1182474799 22:30571203-30571225 AAGGAGCTGGGAAGTGTGGGTGG + Intronic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182529532 22:30944642-30944664 ATGAAGAGGGGAAGTATGGAGGG - Intronic
1182650783 22:31849444-31849466 AAGGAGAAGTGCAGAGTGGAGGG + Intronic
1182815365 22:33157452-33157474 ATGCAAATGGGAAGTGGGGAGGG - Intergenic
1183136529 22:35894530-35894552 TTGGAGAAGGCAAGTGGGGCAGG - Intronic
1183153111 22:36053589-36053611 AGGGAGAAGGGAAGGGAGAAGGG - Intergenic
1183153127 22:36053637-36053659 AGGGAGAAGGGAAGGGAGAAAGG - Intergenic
1183153149 22:36053712-36053734 AGGGAGAAGGGAAGGGAGAAGGG - Intergenic
1183153153 22:36053724-36053746 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1183153160 22:36053748-36053770 AGGGAGAAGGGAAGGGAGAAGGG - Intergenic
1183153172 22:36053779-36053801 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183153185 22:36053810-36053832 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183318975 22:37153542-37153564 AGAGGGAAGGGCAGTGTGGAAGG - Intronic
1183475095 22:38031765-38031787 ATGGGGCAGGGAAGCGGGGAGGG - Intronic
1183533635 22:38380823-38380845 GTGTTGAAGAGAAGTGTGGACGG + Intronic
1183533937 22:38383912-38383934 GTGGTGAAGAGAAGCGTGGATGG + Intronic
1183698813 22:39438208-39438230 AGGGAGAAGGGAAGGAAGGAGGG - Intergenic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184835705 22:47019803-47019825 AGGGAGAAGCGAAGGATGGAGGG - Intronic
1184976224 22:48064302-48064324 AAGGCTAAGGCAAGTGTGGATGG + Intergenic
1185009662 22:48306021-48306043 GTGGACAGGGGAGGTGTGGACGG + Intergenic
1185009677 22:48306074-48306096 GTGGACAGGGGAGGTGTGGACGG + Intergenic
1185025576 22:48408738-48408760 GTGGTGAAGGGATGTGAGGATGG - Intergenic
1185176179 22:49328302-49328324 GTGCAGGAGGGATGTGTGGAGGG - Intergenic
1203298630 22_KI270736v1_random:61560-61582 ATGGAGTAGAGAGGAGTGGAGGG + Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
949951798 3:9235328-9235350 ATAGAGACGTGAAGTCTGGAAGG + Intronic
950352761 3:12373289-12373311 AGGGAGAAGGGCAGGGGGGAAGG + Intronic
950360811 3:12448305-12448327 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
950552337 3:13674284-13674306 ATGGGGAAAGGAAGTGAGGGAGG - Intergenic
950556885 3:13701364-13701386 AGCGAGAAGGGCAGAGTGGAGGG - Intergenic
950578609 3:13847875-13847897 CTGGAGATGGAAAGTGGGGATGG + Intronic
951258625 3:20481023-20481045 ATGCAGAAGGGAAATGTAGTCGG + Intergenic
951575887 3:24113655-24113677 ATGGAGGCTGGAAGTGGGGAGGG - Intergenic
952247781 3:31614408-31614430 ATGGACAAGGAAACTGGGGAGGG - Intronic
953518911 3:43622436-43622458 ATGGAAGAGGGAAATGTGAAGGG - Intronic
953550162 3:43895855-43895877 GTGGAGAATGGAGGTGAGGAAGG - Intergenic
953757671 3:45661145-45661167 ATGGAGTAGGGGAATGTGGGTGG - Intronic
954505459 3:51067525-51067547 AGGGAGAAGGGAAGTGGGGAGGG - Intronic
955050889 3:55409812-55409834 AAGGAGAGGGGATGTGGGGAGGG + Intergenic
955159190 3:56447431-56447453 AGGGAGACGAGAAGTGGGGAAGG + Intronic
955532336 3:59887057-59887079 ATGGAGCAGGGAGGCTTGGAAGG + Intronic
956187937 3:66580308-66580330 ATAGGAAAGGGAAGTGTTGATGG + Intergenic
956368195 3:68529235-68529257 GTGAAGAAGGGCAGGGTGGAGGG - Intronic
956510270 3:69985658-69985680 AGGGAGAAGGGATGTGGGGAGGG + Intergenic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
957416912 3:79917373-79917395 AAGGAAAAAGGAAGTGAGGAAGG + Intergenic
957558331 3:81788668-81788690 TTGGAGAAGGGAAGTGGGTAGGG - Intergenic
957839892 3:85654327-85654349 ATTGAGTAGGGAAGAGGGGATGG + Intronic
958116688 3:89229011-89229033 AGTGAAAAGGGAAGTGAGGAAGG - Intronic
958783462 3:98570815-98570837 ATGGAGAATGGAACTGAGGCAGG - Intronic
959163865 3:102752120-102752142 ATGGAGAAAGGAAGAAAGGAAGG - Intergenic
959593475 3:108103973-108103995 ATGGAGTAACGCAGTGTGGAAGG - Intergenic
960268570 3:115649490-115649512 ATAGAGAAGGGAAGACTGAAAGG + Intronic
960865478 3:122195050-122195072 ATGGAGAAGGGAGGGATGGAGGG - Intronic
961126706 3:124425117-124425139 ATAGAGAAGGGTAGAGGGGAGGG + Intronic
961555314 3:127693026-127693048 AGGCAGAAGGGAAGTCTGGCTGG - Intronic
962105597 3:132385465-132385487 ATGGAGGAGAGAAGTGGTGATGG - Intergenic
962169354 3:133084360-133084382 AGAGAGAAGGGAAGAGTGGCTGG - Intronic
962291042 3:134136583-134136605 AGGGAGGAAGGAAGGGTGGAAGG + Intronic
962338413 3:134559800-134559822 AAGGAGAAAGGGAGTGTGGAGGG + Intronic
962803443 3:138909826-138909848 ATGGAGAAGAGAGGGGAGGAAGG + Intergenic
963307831 3:143673560-143673582 ATGGAGTAGGGAAGGGTGGGAGG + Intronic
963405397 3:144856681-144856703 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
964310527 3:155386954-155386976 TGGGAAAAGGGAAGTGGGGAGGG + Intronic
964394213 3:156228584-156228606 TTGGAGGTGGGAAGTGGGGAGGG + Intronic
964810398 3:160657263-160657285 ATGGAGAAGGGGGGCTTGGAAGG - Intergenic
965275746 3:166679634-166679656 ATGGAGAAGGACGGTGTGGTTGG - Intergenic
965397831 3:168181833-168181855 GTGAAGAAGGGAAGTTTGGAAGG + Intergenic
965419322 3:168437260-168437282 TTGGAAAAGGGAATTATGGAAGG + Intergenic
966491141 3:180529776-180529798 AAAGAGAAGGGAAGAGTGGGAGG + Intergenic
966754143 3:183352722-183352744 ATCCAGAAGGGAAGTGAGGAGGG - Intronic
966826430 3:183968751-183968773 AGGGAGAGTGGTAGTGTGGACGG + Intronic
967364344 3:188669099-188669121 ATTGAGAAGGGAAGTGAGTGGGG + Intronic
967788670 3:193523985-193524007 AAGCAGAAGGGAAGTGGGCATGG - Intronic
968090086 3:195894009-195894031 GTGGAGATGGCAGGTGTGGATGG + Intronic
968181107 3:196596110-196596132 ATGGAGGGGAGAAGTGTGGGTGG - Intergenic
968428158 4:536528-536550 ATGCAGAATCGAAGTCTGGAAGG - Intronic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968936038 4:3611048-3611070 ATGGATAATGGATGGGTGGATGG - Intergenic
969032135 4:4223989-4224011 ATGGAGGAAGGAAGAGAGGAAGG + Intronic
969612208 4:8233704-8233726 ATGGATAATGGAAGGATGGATGG - Intronic
969612219 4:8233762-8233784 ATGGATAATGGAAGGATGGATGG - Intronic
969724357 4:8910598-8910620 CTGGAGAAGAGAAGGGTGAAGGG - Intergenic
970211753 4:13717214-13717236 ATGGAGGAGGGAAGAGTGGCTGG - Intergenic
970213832 4:13738094-13738116 AAGGTGATGGGAAGAGTGGATGG + Intergenic
970636862 4:18020715-18020737 ATGGGGATGGGAGGTGGGGAGGG + Intronic
970832077 4:20351662-20351684 ATGGAGGTGGGAAGAGTGGATGG + Intronic
970966524 4:21934685-21934707 AAGGACAGGGGAAGAGTGGAGGG - Intronic
971194725 4:24461769-24461791 AGGCAGAAGGAAAGTGTAGAAGG - Intergenic
971397207 4:26239713-26239735 AAGGAGAAGAGAAGAGGGGAGGG + Intronic
972004523 4:34083148-34083170 AGGGAGGAAGGAAGGGTGGAAGG - Intergenic
972176960 4:36419923-36419945 GTGGAGAGGGGATGTGAGGATGG - Intergenic
972316963 4:37935774-37935796 ATGGCGAAGGTAAGACTGGAGGG - Intronic
972322119 4:37981647-37981669 AGGGAGAAGGGAGGTATGGCTGG + Intronic
972466838 4:39365948-39365970 AGGGAGAAAGGAAGAGAGGAAGG - Intronic
972492289 4:39599276-39599298 AAGGAGAAGAGTAGGGTGGAAGG + Intronic
973121748 4:46529679-46529701 ATGGAACAGGGAAGTGTGAGTGG - Intergenic
973251731 4:48067706-48067728 CTGGAAAAGGGAAGTGGGGGTGG + Intronic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975433914 4:74328656-74328678 GTGGAGAAAGGAATTGTGGTTGG + Intergenic
975723287 4:77268744-77268766 ATGGAGGAGGGAGGTGAGCAGGG + Intronic
975770369 4:77714477-77714499 CTGGAGTGGGGAAGTATGGAGGG - Exonic
975955339 4:79830527-79830549 GTGGAGAAAGGAAGTAAGGAGGG + Intergenic
976114529 4:81712758-81712780 TTGGACAAGGAAAGAGTGGAAGG + Intronic
976484723 4:85588371-85588393 ATGAAGAAGGGAATCATGGAAGG - Intronic
977180331 4:93866184-93866206 GGGGAGGAGGGATGTGTGGAGGG - Intergenic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
978469059 4:109041762-109041784 ATAGATAAGGAAAGAGTGGAGGG - Intronic
978477595 4:109148556-109148578 ATAGAGCAGGGCAGTGTGAAGGG - Intronic
981220231 4:142223436-142223458 ATGGAGGAGGGAAAAGTGTATGG - Intronic
981308102 4:143267934-143267956 ATGGGGAAGAGAAATGTGGTTGG + Intergenic
981318315 4:143363526-143363548 TTGAAGAAGGAAAGTGTGGTTGG + Intronic
981355827 4:143788022-143788044 AAAGAGAAGGGAATAGTGGAAGG + Intergenic
981377150 4:144028913-144028935 AAAGAGAAGGGAATAGTGGAAGG + Intergenic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
982099441 4:151953742-151953764 ATAGAGAAGGGGTGTGGGGAAGG - Intergenic
982169093 4:152643946-152643968 GAGGAGAAGGGAAGAGTGGGAGG - Intronic
982199644 4:152947829-152947851 AGAGAGAAGGGAAGGATGGAAGG + Intronic
982233545 4:153231432-153231454 ATGGAAGAGGGAAGTGGGAAGGG + Intronic
983006771 4:162493525-162493547 GTATAGAAGGGAAATGTGGATGG + Intergenic
983234569 4:165164528-165164550 ATGGAAAAAGGAGGTGTGGTAGG + Intronic
983552552 4:169032394-169032416 AAGGAGAAAGGAAGGGAGGAAGG - Intergenic
983805038 4:171983871-171983893 ATGGAGTAGGGAAGTGGAGAAGG + Intronic
983913256 4:173264131-173264153 TTTGAAAAGGGAAGGGTGGAGGG - Intronic
984052587 4:174884205-174884227 CTTGAGAGGGGAGGTGTGGAGGG - Intronic
984070382 4:175103519-175103541 AGGGAGAAGGGAGGAGTGGGAGG + Intergenic
984177258 4:176434781-176434803 AGGAAGAAGGGAAGAGAGGAAGG - Intergenic
984911236 4:184676393-184676415 AGGGAGAAGGGAAGGGGGAAGGG - Intronic
984911242 4:184676405-184676427 AGGGAGAAGGGAAGGGAGAAGGG - Intronic
984911248 4:184676424-184676446 AGGGAGAAGGGAAGGGGGAAGGG - Intronic
984911458 4:184676979-184677001 AGGGAGAAGGGAAGTGAAGGGGG - Intronic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985564987 5:611284-611306 ATGGTGTAGGGGAGTGTGTAGGG - Intergenic
985709273 5:1419203-1419225 ATGGATAATGGATGGGTGGATGG - Intronic
985870894 5:2555980-2556002 AATGAGAATGGAAGTGTGAATGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986001147 5:3631795-3631817 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
986022973 5:3821998-3822020 ATGGAGGAGGGCATTGTGGAGGG + Intergenic
986383105 5:7206325-7206347 ATGTCGAAGTCAAGTGTGGATGG + Intergenic
986468366 5:8049962-8049984 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
986468443 5:8050296-8050318 AAGGAGAAGGGAAGGAAGGAGGG + Intergenic
986702479 5:10424372-10424394 ATGGTGTAGGGAAGTGGGGTGGG + Intronic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987347574 5:16992034-16992056 ATGGAAAAAGGAAGAGTGAATGG - Intergenic
987353898 5:17045530-17045552 ATGGAAAAAGGAAGAGTGAATGG - Intergenic
987384692 5:17318265-17318287 ATGGACAAGGGATGGATGGACGG - Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
987954883 5:24726401-24726423 AAGCTGAAGGGAAGGGTGGAAGG + Intergenic
988724068 5:33908286-33908308 ATGGAGGTGGGAAGAGTGTAGGG + Intergenic
988883350 5:35529495-35529517 AATGAGAAGGGAAAAGTGGAAGG - Intergenic
988926111 5:35992404-35992426 AGGGGAAAGAGAAGTGTGGAGGG + Intergenic
989488146 5:42016156-42016178 ATGGAAAAGGGAATTGGGAATGG - Intergenic
989543006 5:42639940-42639962 TTGAAGAAGGGAAGTGTGGAGGG + Intronic
989550215 5:42726336-42726358 CTGGGGATGGGAAGTGGGGAAGG - Intergenic
989690032 5:44131129-44131151 AAGGAGAAGGGCAGAGTGAATGG - Intergenic
991092890 5:62710057-62710079 AGGGAGAAAGGAAGGGAGGAAGG - Intergenic
991429573 5:66530356-66530378 AGGGAGAAAGGAAGGGCGGAAGG - Intergenic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
992669219 5:79042185-79042207 ATGCAAAAGGGAAATGTGGGAGG - Intronic
992740809 5:79771612-79771634 AAGGAGAAGGGATGGGGGGATGG + Intronic
993355690 5:86904423-86904445 ATGGAGAAGAGAGGTGATGAAGG - Intergenic
994030530 5:95136542-95136564 AAGGGGGAGGGAAGTGGGGAAGG + Intronic
994737729 5:103576366-103576388 ATGAAGAAAGGAAGGGAGGAAGG + Intergenic
994867220 5:105290921-105290943 ATGGAGAAAAGAAATGTAGATGG - Intergenic
995125359 5:108573270-108573292 AGGGAGGAAGGAAGGGTGGAAGG + Intergenic
995180231 5:109224151-109224173 ATGGAGAAGAGAACTCTTGAAGG - Intergenic
995558121 5:113351557-113351579 AAGTAGAGGGGAAGTGGGGATGG + Intronic
995958195 5:117806163-117806185 AAGGAAAAGGGAAGAGAGGAGGG - Intergenic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
996781556 5:127192394-127192416 ATGGATATGGGAAGTTAGGAAGG - Intergenic
996833556 5:127766756-127766778 ATAGAGATGGGAAGTGGGGGTGG - Intergenic
996925858 5:128825828-128825850 TTGGAGAATAGAGGTGTGGATGG + Intronic
997259568 5:132455705-132455727 CTGGAGCAGGGATGTGTGGGGGG - Intronic
998540843 5:142980050-142980072 AGGGAGAAGGGGAGCGAGGAAGG - Intronic
999073588 5:148773670-148773692 GTGGATAAGAGAAGGGTGGAGGG + Intergenic
999265108 5:150261937-150261959 GTGGGGAAGGGAAGTATGGTAGG - Intronic
999955935 5:156701570-156701592 ATAGAGAAGGGAAGAGAGGCAGG + Intronic
1000125270 5:158237606-158237628 CTGGAGAAGTGGGGTGTGGAGGG + Intergenic
1000203135 5:159031398-159031420 GTGGAGATGGGAGGTGAGGAGGG - Intronic
1000209803 5:159098599-159098621 ATGGAGAGAGGAAGGGAGGAAGG + Intronic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1001551095 5:172602869-172602891 AGGGAGAAGGGAGGAGGGGAGGG - Intergenic
1001825733 5:174743427-174743449 ATGGAGAAAGGAAGGAAGGAAGG - Intergenic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1002603725 5:180370064-180370086 AGGCGGAAGGGAAGTGTGTAGGG + Intergenic
1003044874 6:2724482-2724504 CTGGAGAAAGGAAGTGTGAAGGG + Intronic
1003354385 6:5353056-5353078 CTGTAGAAGGGAAGTGTGATTGG - Intronic
1003961167 6:11210792-11210814 ATAGAAAAGAGAAGTGAGGAAGG + Intronic
1003967908 6:11270917-11270939 CTGGAGAAGGGAATTGGGGGTGG + Intronic
1004348795 6:14872704-14872726 GGGGAGAAGGGCAGTGGGGAAGG + Intergenic
1004415323 6:15418085-15418107 ATGGAGCAGGCAAGAGTGGTGGG + Intronic
1004827728 6:19441867-19441889 ATGGATAAAGGAAGAGAGGAAGG + Intergenic
1004896208 6:20150389-20150411 ATGGTGCAGGGAGCTGTGGAAGG - Intronic
1005810529 6:29511987-29512009 AAGGAGAAGGGCAGAGTGAAAGG + Intergenic
1006334710 6:33414589-33414611 ATGGAGAGTGGAAGCCTGGAAGG + Intronic
1006369792 6:33636843-33636865 ATGGAGAAGGGAAGAGGGCCAGG + Intronic
1006430221 6:33991066-33991088 TTGGGGGAGGGAAGTGTGGGTGG - Intergenic
1006706138 6:36023146-36023168 ATGGATAAGGGTACTATGGAGGG - Intronic
1006734278 6:36261452-36261474 AGGGAGGAGGAAAGTGTTGATGG + Intronic
1006810647 6:36818296-36818318 GACGAGAAGGGAAGTATGGATGG - Intronic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1006945046 6:37779307-37779329 AGGGAAAAGGGTAGGGTGGAGGG + Intergenic
1006967604 6:38004451-38004473 ATGGAGAGGGGGAGAGGGGAAGG - Intronic
1007431882 6:41781185-41781207 AGGGGGAAGGGAATTATGGAAGG + Intronic
1007730620 6:43943306-43943328 ATGGGCATGGGCAGTGTGGAAGG - Intergenic
1007737737 6:43992241-43992263 GTGGAGATGGGATGTGTGGCAGG + Intergenic
1007762097 6:44139224-44139246 ATGGAGAAGGGGAGGGATGAAGG - Intronic
1007870197 6:45026948-45026970 GAGTAGAAGGGAAGTCTGGAGGG - Intronic
1007906030 6:45461524-45461546 ATGGAGAAGGAAAGTGCAAAAGG + Intronic
1008427736 6:51379346-51379368 AGGGAGAAAGGAAGAGGGGAGGG + Intergenic
1008533862 6:52491312-52491334 GTGGAGCAGGGAAGTGGGGGTGG + Intronic
1008806067 6:55430095-55430117 CTGGAGAAGGAAAGTTTAGATGG + Intergenic
1009390777 6:63140633-63140655 AAAGAGAAGGGAAGAGGGGAAGG + Intergenic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1009804461 6:68585182-68585204 AAAGTGAAGGGAAGTGGGGAGGG + Intergenic
1010579382 6:77575308-77575330 AGAGAGATGGGAAGTGTGGATGG - Intergenic
1010696719 6:78984131-78984153 GTGGAGAGGGGTAGTGGGGAGGG - Intronic
1011227006 6:85118714-85118736 ATGGTGTAGGGAAGTGGGGAGGG - Intergenic
1011621008 6:89242612-89242634 ATGGAAAAGGGAAGGAAGGAAGG + Intergenic
1012690572 6:102306429-102306451 ATGGATAGGGGAATTGGGGATGG + Intergenic
1013986184 6:116197099-116197121 ATGGAGAAAGGAGGTGGGGGTGG - Intronic
1014255929 6:119159988-119160010 TTGGAGGAGGGAAGTGGGTATGG - Intergenic
1014859487 6:126447461-126447483 ATAGAGAATGGAAGTATGTATGG + Intergenic
1014888788 6:126816266-126816288 AGGAAGAAAGGAAGGGTGGAAGG - Intergenic
1015309664 6:131752654-131752676 ATGGAAAAAGAAAGAGTGGAGGG - Intergenic
1016756780 6:147696211-147696233 AAGGAGAAGGCAAGTTTGGAGGG - Intronic
1016792364 6:148079160-148079182 AGGTAGAAGGGGAGTGAGGAAGG + Intergenic
1017266693 6:152454295-152454317 TTGGAGATGGGAACTTTGGAAGG + Intronic
1017300556 6:152852723-152852745 ATGGAGAAGGGAAGAAGGGAGGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017614224 6:156227661-156227683 GTGGGGAGGGGAAGTGGGGATGG + Intergenic
1018341097 6:162851939-162851961 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019502242 7:1370069-1370091 ATGTGGAGGGGCAGTGTGGATGG + Intergenic
1019549590 7:1595336-1595358 TGGGAGAAGGGATGGGTGGATGG - Intergenic
1019625486 7:2013786-2013808 GTGTAGATGAGAAGTGTGGATGG + Intronic
1019764701 7:2842010-2842032 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1019776132 7:2913060-2913082 GGGGAGGAGGGAAGTGAGGAGGG + Intronic
1019860717 7:3656189-3656211 AAGGAGAAGGGAAGGATGGAGGG - Intronic
1020483055 7:8685789-8685811 ATGGCGGGGGGAAGTGGGGATGG + Intronic
1020571042 7:9861794-9861816 ATTGGGAAGGGTAGTGGGGAGGG + Intergenic
1020678845 7:11211877-11211899 ATGGAACTGAGAAGTGTGGAAGG - Intergenic
1021059995 7:16099469-16099491 AAGGAGAAGGGAAGAGGGAAGGG + Intronic
1021086439 7:16425621-16425643 AGGGAGATGGGGAGTGGGGAGGG - Intergenic
1021585717 7:22205435-22205457 ATAGAGAAGGAAATTGTGGGTGG - Intronic
1022244030 7:28540391-28540413 ATTGAGGAGGGCAGGGTGGAAGG + Intronic
1022310157 7:29189689-29189711 AGGGAGAAGGGGAGTGTAGGGGG - Intronic
1022499822 7:30875709-30875731 AATGAGGAGGGAAGTGGGGAAGG + Intronic
1023305233 7:38818973-38818995 ATGGATTAGGAAAGTGTTGAAGG - Intronic
1023338293 7:39192921-39192943 ATGGAGGAAGGAAGAGAGGAAGG + Intronic
1023522281 7:41060495-41060517 ATTGAGGAGGGAGGTGAGGAAGG - Intergenic
1023601516 7:41885848-41885870 ATGAAGGAGGGACGTCTGGATGG - Intergenic
1023950684 7:44841793-44841815 ATGGAGCAGTGAAGGGTTGAGGG - Intronic
1024175849 7:46840398-46840420 GTGGAGAGGTGGAGTGTGGAGGG - Intergenic
1024368903 7:48558130-48558152 ATGGAGAAAGGAAGGAAGGAAGG - Intronic
1024439754 7:49403678-49403700 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
1024457880 7:49629799-49629821 ATGGAGAAAGTGTGTGTGGAGGG - Intergenic
1024525296 7:50343271-50343293 ATGGAGAAAAGAAGAGAGGAAGG - Intronic
1024737707 7:52323424-52323446 ATGGGGAAGGGAAGGGGGAAGGG - Intergenic
1024737743 7:52323528-52323550 AGGGAGAAGGGAAGTGGGAAGGG - Intergenic
1024957002 7:54932989-54933011 GTGAAGGAGGGAAGTGAGGATGG + Intergenic
1025887623 7:65612932-65612954 ATGAAGAAAGAAAGTGTGAATGG + Intergenic
1026063776 7:67050529-67050551 ATATAGAGGGGAAGTGGGGAGGG - Intronic
1026078891 7:67199575-67199597 ATGCTGAAGGCAAATGTGGAAGG - Intronic
1026178223 7:68016366-68016388 AAGGAGAAAGGAAGGATGGATGG - Intergenic
1026284282 7:68949570-68949592 ATGGAGAAGGGGGGTATGGGAGG - Intergenic
1026355486 7:69553564-69553586 CTGGAGAAGGGAAGTGGGGAAGG - Intergenic
1026439815 7:70434338-70434360 AGGGAGAAGGGAGTTGTGAATGG + Intronic
1026697929 7:72612368-72612390 ATGCTGAAGGCAAATGTGGAAGG + Intronic
1026714572 7:72776931-72776953 ATATAGAGGGGAAGTGGGGAGGG + Intronic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1027297125 7:76788197-76788219 ATGGAGAAGAGAAGTGGAGTGGG - Intergenic
1027608849 7:80334132-80334154 ATGGACAAGGGAAGAGTTAAAGG + Intergenic
1028725891 7:94087599-94087621 ATGGAGTTGGAAAGTGTGCATGG - Intergenic
1028865893 7:95711043-95711065 ATGTGGTAGTGAAGTGTGGAAGG - Intergenic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029607881 7:101609831-101609853 AGGGAGAAGGGAGGAATGGAGGG - Intergenic
1029779802 7:102719876-102719898 TTGGAGATGGGACCTGTGGAAGG + Intergenic
1029888924 7:103905907-103905929 ATAGAGGAGGTAAGTATGGAAGG + Intronic
1029961475 7:104692784-104692806 ATGGAGAAGGAAATTGCAGAAGG + Intronic
1030296328 7:107932285-107932307 AAGGAGAGAGGAAGTGTGGGGGG - Exonic
1030327018 7:108230460-108230482 ATGAAGTAGGGAAATGTTGAAGG - Intronic
1030564879 7:111141305-111141327 ATTGGGAGGGGAAATGTGGAGGG - Intronic
1030872515 7:114774586-114774608 TTGGGGAAGGGAGGTGGGGATGG + Intergenic
1031421807 7:121562048-121562070 GTGGAGAAGGGAAGTGGGACAGG - Intergenic
1031550152 7:123100537-123100559 CTGAAGAAAGGAAGTGGGGAGGG + Intergenic
1031854789 7:126908976-126908998 ATGAAGAAAGAAAGTGTGAATGG - Intronic
1032150663 7:129426811-129426833 ATGGGGAAAGGAATTGAGGAAGG - Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032816980 7:135485696-135485718 ATGGAGAAGGGAAGGGGGAAGGG + Intronic
1033033990 7:137853892-137853914 ATGGAGAAAGGGAATGTGAATGG - Intergenic
1033237101 7:139646780-139646802 GTGGAGAAGGGAAGAAAGGAAGG + Intronic
1033446331 7:141425541-141425563 ATGCAGAAGGGAAGGATGAAAGG - Intronic
1034129430 7:148701331-148701353 AGGGAGAAGGGAAGTGAAGAGGG - Intronic
1034244536 7:149634633-149634655 GTGGAGAAGGCACGTGTGGAAGG + Intergenic
1034336520 7:150327212-150327234 AAGGAGAAGGGAAGTGAAAAGGG + Intronic
1034414784 7:150958619-150958641 ATTGTGAATGGAAGTGGGGATGG - Intronic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034873087 7:154700983-154701005 ATGGTGATGGCAAGGGTGGAGGG - Intronic
1035318748 7:158014599-158014621 ATGGATGAGGGATGGGTGGAAGG - Intronic
1035331863 7:158101831-158101853 ATGAAGAAGGGAGGAGTGGTTGG - Intronic
1035454156 7:158997981-158998003 ATGAAGGTGGGGAGTGTGGAGGG - Intergenic
1035454243 7:158998234-158998256 ATGAAGGTGGGGAGTGTGGAGGG - Intergenic
1035454260 7:158998285-158998307 ATGAAGGTGGGGAGTGTGGAGGG - Intergenic
1035454297 7:158998387-158998409 ATGAAGGTGGGGAGTGTGGAGGG - Intergenic
1035454334 7:158998491-158998513 ATGAAGGTGGGGAGTGTGGAGGG - Intergenic
1035454351 7:158998542-158998564 ATGAAGGTGGGGAGTGTGGAGGG - Intergenic
1035454367 7:158998594-158998616 ATGAAGGTGGGGAGTGTGGAGGG - Intergenic
1035454400 7:158998695-158998717 ATGAAGATGGGGAGTGTGGGGGG - Intergenic
1035454419 7:158998747-158998769 ATGAAGGTGGGGAGTGTGGAGGG - Intergenic
1035454437 7:158998799-158998821 ATGAAGGTGGGGAGTGTGGAGGG - Intergenic
1035454453 7:158998851-158998873 ATGAAGGTGGGGAGTGTGGAGGG - Intergenic
1035673070 8:1434854-1434876 ATGGAGGAGGGAGGGGAGGAAGG - Intergenic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1036546186 8:9771787-9771809 GAGGAGAAGGGAAGTGGGGGAGG + Intronic
1036667818 8:10759170-10759192 GTGGAGAAGGGAAGCCTGGTCGG + Intronic
1036707172 8:11054719-11054741 AAGGAGGAAGGAAGTGTGGGTGG + Intronic
1037726049 8:21483298-21483320 TTGGGGAAGGGAGGTGTGGATGG - Intergenic
1037741454 8:21612357-21612379 ATGCAGAAAGGAAGCCTGGAGGG - Intergenic
1038069274 8:23995440-23995462 ATTGAGAAGTGCAGTGGGGAAGG + Intergenic
1038281957 8:26173844-26173866 ATGGAGAAGGTGAGTTTGCAGGG + Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1038476951 8:27875258-27875280 ATGTAGAAGGGAAGAAAGGAAGG - Intronic
1039347192 8:36719150-36719172 AGGGAGAAAGGAAGGATGGAAGG - Intergenic
1039383839 8:37112980-37113002 ATGGAGATGGGAAGAGTAGAAGG - Intergenic
1039399474 8:37257021-37257043 ATGGAGAAAGGAGGTGTGTCAGG + Intergenic
1039507721 8:38064077-38064099 AGGGAGGAGGGATGTGTTGAAGG + Intergenic
1039641790 8:39230935-39230957 TTGGAGAAGGTAACTGTGGTAGG + Intronic
1040794136 8:51271221-51271243 AAGGAGAGGCGAGGTGTGGAGGG + Intergenic
1041110805 8:54480666-54480688 ATGGAGAAGGGAGGGGAGCAAGG + Intergenic
1041248710 8:55914068-55914090 ATGGAGAATGGAGAGGTGGAGGG + Intronic
1041422139 8:57679532-57679554 AGGTAGAATGGAAGTGTGGGTGG - Intergenic
1042275048 8:66995977-66995999 TGGGAGAAGGGAAGTGTAGTAGG - Intronic
1042346931 8:67737035-67737057 ATTGAAAAGGGAAGATTGGAGGG - Intronic
1042549374 8:69980691-69980713 ATGGAGAAGGGAGGCATGGCTGG + Intergenic
1042599269 8:70481995-70482017 AGAGAGAAGGGTAATGTGGAAGG - Intergenic
1042775515 8:72426523-72426545 GTGGAGAAGTGAAGGGTGTATGG - Intergenic
1042810604 8:72821809-72821831 AAGGTGAAGGGAAGGATGGAGGG + Intronic
1043753625 8:83972728-83972750 ATTGAGGAGTGAAGAGTGGAGGG - Intergenic
1043908335 8:85833088-85833110 ACGGGGAAGGGAAGGGTGGGAGG - Intergenic
1044492367 8:92834608-92834630 GTGGAGAAGGGACAGGTGGAGGG - Intergenic
1045036175 8:98178221-98178243 ATGGGCAGGGGAAGGGTGGAAGG - Intergenic
1045412017 8:101929365-101929387 AGGGAGGAGGGAAGGGAGGAGGG + Intronic
1046353761 8:113050980-113051002 TGGGAGAAGGGAAGTGAGAAAGG + Intronic
1047254774 8:123206975-123206997 AGGGGGAAGGGAAGTGGGAAGGG - Intronic
1047306883 8:123659620-123659642 ATGGAGAATGGATGGATGGATGG - Intergenic
1047465799 8:125112734-125112756 TTGGGGAAGGGAAGGGTGGGAGG + Intronic
1047510100 8:125509285-125509307 ATGGAGGAGGGAGGAGGGGAGGG + Intergenic
1048080840 8:131124584-131124606 ATGGAGAGGACACGTGTGGATGG + Intergenic
1048183641 8:132218871-132218893 GGAGAGAAGGGAAGTGAGGAAGG - Intronic
1048261079 8:132945544-132945566 GCTCAGAAGGGAAGTGTGGATGG + Intronic
1048408074 8:134143100-134143122 AAGGAGGAAGGAAGGGTGGAAGG - Intergenic
1049025070 8:139982879-139982901 ATGGTGGAGGGGAGTGTGGTGGG - Intronic
1049154639 8:141059281-141059303 TGGGAGAAGGGAAGTCAGGAGGG + Intergenic
1049210593 8:141384800-141384822 AGGGAGATGGCAACTGTGGATGG + Intergenic
1049280842 8:141743387-141743409 CTGGAGAAGGGTAATGGGGAAGG + Intergenic
1049289092 8:141792064-141792086 AGGCAGAGGGGCAGTGTGGATGG - Intergenic
1049291494 8:141805298-141805320 GTGCAGAAGGGAAGTGTGGTTGG + Intergenic
1049332453 8:142062201-142062223 ATGAAGAAGGGCAGAGGGGACGG - Intergenic
1049350702 8:142163019-142163041 ATGGAGGATGGATGGGTGGATGG + Intergenic
1049350774 8:142163413-142163435 ATGGAGGATGGATGGGTGGATGG + Intergenic
1049350871 8:142163942-142163964 ATGGAGGATGGATGGGTGGATGG + Intergenic
1049350888 8:142164026-142164048 ATGGAGGATGGATGGGTGGATGG + Intergenic
1049350972 8:142164473-142164495 ATGGAGGATGGATGAGTGGATGG + Intergenic
1049446549 8:142634101-142634123 AGGGAGAAGGGAAGATTTGAAGG + Intergenic
1049455241 8:142683274-142683296 GCGCAGAAGGCAAGTGTGGATGG - Intergenic
1049464996 8:142747036-142747058 ATGGATAGGGGATGGGTGGATGG + Intergenic
1050119059 9:2289331-2289353 AGGGACAAGGGAAGAGTAGAGGG - Intergenic
1050932676 9:11349622-11349644 GTGGAGAAGGGATGTGGGGTTGG + Intergenic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1051264644 9:15298912-15298934 ATGGAGAAGTGATGTGGGGAAGG - Intronic
1051388678 9:16539689-16539711 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1051530198 9:18093835-18093857 TTGGAGAGGGGAAGTGGGGCTGG + Intergenic
1051738145 9:20224651-20224673 AGGGAGAAGAGAAGAGGGGAGGG + Intergenic
1052075804 9:24138602-24138624 ATGGGGAAGGGTAGCCTGGAAGG + Intergenic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1052642437 9:31186177-31186199 ATGAAGAAGTGAAGGGTAGAGGG - Intergenic
1053290868 9:36878983-36879005 ATGCAGAAGGAAAGAATGGAGGG + Intronic
1053404343 9:37858889-37858911 ATGGAGTGGGGAAGGCTGGAGGG - Intronic
1054454247 9:65421394-65421416 ATGGATAATGGATGAGTGGATGG + Intergenic
1055012965 9:71587128-71587150 TTGGAGAAAGGAGGTGTGGTAGG - Intergenic
1055889526 9:81108064-81108086 CTGGAGAAGGGATTTGTGGTAGG + Intergenic
1056226281 9:84498486-84498508 ATGGAAAGAGGAAGTGTTGATGG - Intergenic
1056505565 9:87255060-87255082 ATGGTGAAGGGAAGTGTCTCCGG - Intergenic
1056688036 9:88782861-88782883 ATGGGGAAGGGAAGAGTGGAGGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057495104 9:95554264-95554286 ATAGAGAAGAGAAGGCTGGAAGG - Intergenic
1057517428 9:95734034-95734056 GTGGAGAGGGGAAGGGTAGAAGG - Intergenic
1057961095 9:99457826-99457848 AGGGAGAAGGGAAGGAAGGAGGG + Intergenic
1058347370 9:103980091-103980113 CTGGCGAAGAGATGTGTGGATGG - Intergenic
1059051869 9:110935179-110935201 ATGAAGATGGAAAGTGTGGATGG + Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059615188 9:115942936-115942958 ATAGAGAAAGGAAGTATGAAGGG - Intergenic
1059750689 9:117244634-117244656 ATGGAGGAAGGAAGTAGGGAAGG + Intronic
1059752921 9:117265523-117265545 ATGGAGAGGGTCAGTGTTGAGGG + Intronic
1060128789 9:121075261-121075283 ATGAAGGAGGGAGGTTTGGATGG + Intronic
1060145826 9:121251621-121251643 ATGGACAATGGAGGTGTTGAGGG + Intronic
1060174240 9:121485779-121485801 AAGAAGGAGGGAAGTGGGGAAGG + Intergenic
1060237574 9:121876686-121876708 ACTGAGAGGGGAAGGGTGGATGG + Intronic
1061024935 9:128042397-128042419 ATGGATGAGGGCAGTGTGGCAGG + Intergenic
1061527479 9:131178803-131178825 CTGGAGAAGGGAAGTGAGGGAGG - Intronic
1061590654 9:131595500-131595522 ATGGTGAAGTAAATTGTGGAGGG - Intronic
1061911799 9:133728968-133728990 ATGGAGGACGGAAGAATGGATGG + Intronic
1062248068 9:135579910-135579932 ATGGATAATGAAAGGGTGGATGG - Intergenic
1203367276 Un_KI270442v1:269858-269880 AGGGAGAAGGGATTAGTGGAGGG - Intergenic
1185551267 X:984102-984124 TCAGAGAAGGGAAGTGGGGAGGG - Intergenic
1185762674 X:2700624-2700646 ATGGAGAATGGATGGATGGATGG - Intronic
1186081016 X:5931974-5931996 ATGGAGAAGAGAAGATGGGAGGG - Intronic
1186352375 X:8753437-8753459 GTGTAGAGGGCAAGTGTGGAAGG - Intergenic
1186353063 X:8759641-8759663 TGGGAGAAGGGAAGATTGGAGGG + Intergenic
1186925387 X:14328283-14328305 CTGGAGAGGGGAAATGTGCAAGG - Intergenic
1187296574 X:18007455-18007477 ATGGAGAAGGGAAGAGATGCTGG - Intergenic
1187309063 X:18123127-18123149 AAGGAGAAGGGGAGTGGGGGAGG - Intergenic
1187576195 X:20559078-20559100 AAGGAGAAGGGAAGGGGGAAAGG - Intergenic
1187954205 X:24499886-24499908 ATGGATCTGTGAAGTGTGGAAGG + Intronic
1188520670 X:31034169-31034191 ATGGAGAAGGGAAGATAGGAGGG - Intergenic
1188740209 X:33769136-33769158 AGGGAAAAGGGAAGGGAGGAGGG + Intergenic
1189055591 X:37696459-37696481 ATGGAAAAAGGAAGTGGGCATGG + Intronic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189237833 X:39501872-39501894 AGGCAGAAGGGGAGTGTGGTGGG + Intergenic
1189579300 X:42388916-42388938 AGGGAGGAGGGAAGTGGGGTTGG + Intergenic
1189683443 X:43540011-43540033 AGAGAGAAGGGAAGAGGGGAGGG + Intergenic
1189700584 X:43714237-43714259 ATGGGGACTGGAAGGGTGGATGG + Intronic
1189700798 X:43715239-43715261 GGGGAGAAAGGAAGGGTGGATGG + Intronic
1189700852 X:43715521-43715543 GAGGAGACAGGAAGTGTGGAAGG + Intronic
1190152647 X:47960674-47960696 GTGGAGAAGGGAATTGGAGAAGG + Intronic
1190336915 X:49268270-49268292 ATGGAGAAGGAATGTATGAATGG + Intergenic
1190546250 X:51530872-51530894 ATGGAGGAGGAGAGTGTGGGGGG - Intergenic
1190801982 X:53797789-53797811 AAGGAGAAGGGATTTGGGGATGG + Intergenic
1191013174 X:55782555-55782577 AAGGTGCAGGGAAGTGTGTATGG - Intergenic
1191833230 X:65437281-65437303 ATAGAGCAGGGGAGTGGGGATGG - Intronic
1191881697 X:65849030-65849052 ATGGACAAGGCAAGTGGGGATGG - Intergenic
1191899999 X:66031048-66031070 ACAGAGCAGGGAAGAGTGGAAGG + Intronic
1192053211 X:67746106-67746128 AGGGAGAAAGGGAGAGTGGAGGG - Intergenic
1192130117 X:68541900-68541922 ATGGAAAAGTGGGGTGTGGAGGG - Intergenic
1192176159 X:68886816-68886838 ATGAAGCAGGGAGGTGGGGAAGG - Intergenic
1192264483 X:69529542-69529564 ATGGATAAGGAAGGTGTGGTGGG - Intronic
1192801417 X:74467918-74467940 ATGAAGAAGGTATGTGTGGGTGG - Intronic
1193814086 X:86084681-86084703 AGGGCGAAGGGAAGCGGGGATGG + Intergenic
1194861979 X:99010709-99010731 AGGGAGAAGGGAAGGAAGGAAGG + Intergenic
1195065008 X:101232562-101232584 AGGAAGAAAGGAAGTGGGGATGG + Intronic
1195788790 X:108558699-108558721 ATGGAGCAGGGAAGGGTAAAAGG - Intronic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196003075 X:110807158-110807180 ATGGAGAAAGGAGGGGTAGAAGG + Intergenic
1196236810 X:113291322-113291344 ATAGAGAAAGGAAGAGTGAAGGG + Intergenic
1196871414 X:120116238-120116260 GTGGAGATGGGAGGTGTGGGTGG + Intergenic
1196940386 X:120769968-120769990 CTGGAGAGTGGAAGTGGGGAGGG - Intergenic
1197728971 X:129794355-129794377 AGGGAGAAGGAAAGTGGGAATGG - Exonic
1197882389 X:131180579-131180601 AGGGAGAAGGGATGTTTGGCTGG + Intergenic
1197903090 X:131394296-131394318 ATAGAGAAGGGGAGGCTGGATGG - Intronic
1198225373 X:134640468-134640490 AAGGAGAAGGGAAGGACGGAAGG - Intronic
1198302642 X:135346278-135346300 ATGGTGGAGGGGAGTGGGGAAGG + Intronic
1199024464 X:142920347-142920369 TTGGGGAAGAGATGTGTGGATGG + Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199586785 X:149423354-149423376 ATGGTGCAGGCAAGTGGGGAGGG + Intergenic
1201131058 Y:10952310-10952332 AAGGAGAAGAGAGGAGTGGAAGG - Intergenic
1201741245 Y:17326292-17326314 AGGGAGGAGGGAAGTAAGGAAGG + Intergenic
1201743090 Y:17344176-17344198 AGGGATAGGGGAAGAGTGGAGGG + Intergenic
1202593508 Y:26512108-26512130 GTGGTGAAGAGAAGCGTGGATGG - Intergenic
1202593818 Y:26515239-26515261 GTGTTGAAGAGAAGTGTGGATGG - Intergenic