ID: 1195945534

View in Genome Browser
Species Human (GRCh38)
Location X:110206773-110206795
Sequence GGGAAGAATGGGACTGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195945534_1195945541 0 Left 1195945534 X:110206773-110206795 CCATGGTCAGTCCCATTCTTCCC 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1195945541 X:110206796-110206818 CATTTTCAGAACCAAATGCTGGG 0: 1
1: 0
2: 4
3: 13
4: 255
1195945534_1195945540 -1 Left 1195945534 X:110206773-110206795 CCATGGTCAGTCCCATTCTTCCC 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1195945540 X:110206795-110206817 CCATTTTCAGAACCAAATGCTGG 0: 1
1: 0
2: 0
3: 18
4: 195
1195945534_1195945543 19 Left 1195945534 X:110206773-110206795 CCATGGTCAGTCCCATTCTTCCC 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1195945543 X:110206815-110206837 TGGGTTTCCCTGTAATAATATGG 0: 1
1: 0
2: 0
3: 13
4: 121
1195945534_1195945544 25 Left 1195945534 X:110206773-110206795 CCATGGTCAGTCCCATTCTTCCC 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1195945544 X:110206821-110206843 TCCCTGTAATAATATGGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195945534 Original CRISPR GGGAAGAATGGGACTGACCA TGG (reversed) Intronic
900001395 1:16792-16814 GGGAAGAAGGTGTGTGACCAGGG + Intergenic
900021115 1:187314-187336 GGGAAGAAGGTGTGTGACCAGGG + Intergenic
900431959 1:2606749-2606771 GGGCTGGATGGGACTGGCCACGG + Intronic
900655612 1:3755316-3755338 TGGATGCATGGGACTGAGCAAGG - Intronic
901262736 1:7885722-7885744 GGGAAGAATGGGCATGGCCTAGG + Intergenic
901460370 1:9387594-9387616 GGGAAGAATGGGGGTGAAGATGG + Intergenic
902259500 1:15214200-15214222 GGGAAGAGAGAGACTCACCACGG + Intronic
904559976 1:31389927-31389949 GGGACTCCTGGGACTGACCACGG - Intergenic
904578234 1:31520017-31520039 GGGAAGAATGGGACTGTGATGGG + Intergenic
904621684 1:31779147-31779169 GGCAAGACTGGGAAGGACCATGG - Intergenic
904959288 1:34318723-34318745 TGGGAGAATGGGGCTGAACATGG + Intergenic
905103486 1:35546141-35546163 GGAATGAATGAGACTGCCCAGGG + Intronic
905105146 1:35559426-35559448 GAGGAGAATGGGACTGAATAAGG + Intronic
905197016 1:36287726-36287748 GGGCAGAATGGGAAAGGCCAAGG + Intronic
908838859 1:68257721-68257743 GAGTAGAATGGTGCTGACCAAGG - Intergenic
910321467 1:85949873-85949895 GGAAAGAAAGGGTCTGAACAAGG - Intronic
916704143 1:167329415-167329437 GGGGAGAGTTGGACTGAGCAGGG + Intronic
918161439 1:181904436-181904458 GGGAAGAATGTGAGTGACTTTGG + Intergenic
920092009 1:203461261-203461283 GAGCAGAATGGCAGTGACCAGGG + Intergenic
921452194 1:215322462-215322484 GAGAAGAATGAGATAGACCATGG - Intergenic
922818456 1:228468047-228468069 GGGGAGAATGGGACTGAGACAGG + Intergenic
923481453 1:234388993-234389015 GGTAAGAAAGGGACTGACCTAGG + Intergenic
924094942 1:240541342-240541364 GGGAACAATGGGACTGGCCAGGG + Intronic
924466405 1:244302612-244302634 GGGAAGAATGGAAATAACCTTGG + Intergenic
1065466536 10:26030106-26030128 GGGAAGAATGGGGCTGAGTGTGG - Intronic
1065918788 10:30373355-30373377 TGGAAGAATGGCACAGGCCATGG - Intronic
1066485383 10:35838110-35838132 GGGAAGAAAGGGGATGGCCAAGG - Intergenic
1066803893 10:39223151-39223173 GGCAAAAATGGGAATAACCAAGG + Intergenic
1068555500 10:58454189-58454211 GGGAAAAATGAGACTCAGCAAGG + Intergenic
1070515751 10:77204267-77204289 AAGAAGAATGGGAATGACCTTGG + Intronic
1071503981 10:86222021-86222043 GGGAAGAAGGGGACAGGCCAAGG + Intronic
1072614759 10:97042209-97042231 GGCAAGAAAGGGAGAGACCAGGG + Intronic
1073395543 10:103214443-103214465 GGGTAGTATGGCACTGAACATGG - Intergenic
1075909980 10:126116069-126116091 GGGGAGAATGGGAATAACAACGG - Intronic
1078662451 11:13298312-13298334 GGGAAGAATGGTCCAGGCCAAGG - Intronic
1079119627 11:17672574-17672596 GGGAATCTTGGGGCTGACCAGGG + Intergenic
1079146229 11:17854473-17854495 GGGAAGAATGGGCAGGATCAAGG - Intronic
1079740147 11:24048377-24048399 GGGAAGAATGAGGCAGACCCAGG - Intergenic
1081550459 11:44107047-44107069 GGGAAGGAGGGCTCTGACCAAGG - Intronic
1081956094 11:47095209-47095231 GGGAAAAATGGGACTGAGCTGGG + Intronic
1082055868 11:47815875-47815897 GGGCAGATTGGTACTGACCGAGG - Intronic
1084030544 11:66478189-66478211 GGGAGGGATGGACCTGACCAAGG + Intergenic
1085337567 11:75707578-75707600 GGGAAGATTGGGAGAGATCAAGG - Intergenic
1086461916 11:87014507-87014529 GGGAAACATGCAACTGACCAAGG - Intergenic
1087630103 11:100639905-100639927 GAGAAGAATGGGAGAGACTAGGG - Intergenic
1088566681 11:111180029-111180051 GGCAAGAATGAGACTGAGAAGGG - Intergenic
1089961147 11:122618204-122618226 GGGAATGGTGGGACTGGCCAAGG + Intergenic
1090916193 11:131165147-131165169 GAGTAGAATGGTACTTACCAGGG - Intergenic
1091666354 12:2421432-2421454 GGGACAAATGGGATTCACCATGG + Intronic
1092586525 12:9906518-9906540 GGGAAGATTTGGACTGAACGAGG - Intronic
1093474492 12:19539621-19539643 ATGAAAAATGGGAGTGACCATGG + Intronic
1094293050 12:28873547-28873569 GGGATGAAAGGGACTGAGTAGGG + Intergenic
1094512731 12:31105949-31105971 GGGAAGGAGGTGACTGAGCAGGG + Intergenic
1095904664 12:47365687-47365709 TGGTAGAATGGGACTGGCCCTGG - Intergenic
1096478947 12:51925244-51925266 GGGGAGAATGGGGTTGTCCAGGG + Intergenic
1096519134 12:52174300-52174322 GGGAAGCCAGGGAGTGACCAGGG + Intronic
1098899890 12:76101883-76101905 GGGAGGAATGTGCCTGCCCAGGG - Intergenic
1100789114 12:98110839-98110861 TGGAAGAATGGCAGTGTCCAGGG + Intergenic
1101533280 12:105594376-105594398 TGGAAGAAAGGAAATGACCATGG - Intergenic
1101987203 12:109456659-109456681 GAGCAGAATGGCACTGCCCAAGG + Intronic
1102248528 12:111369979-111370001 AGGAAGAACAGGACAGACCAGGG + Intergenic
1105403934 13:20118658-20118680 TGGAAGAAGGGGCCTGACCCTGG - Intergenic
1105882710 13:24617869-24617891 GGGAAGAATAGGAAGGATCAGGG - Intergenic
1106146109 13:27051295-27051317 GGGAAGAGTGGGAGAGGCCAAGG - Intergenic
1109183950 13:59247283-59247305 GGAAAGCATGGGAATGACAAAGG + Intergenic
1110815642 13:79857494-79857516 GTGAAGATTGTCACTGACCATGG + Intergenic
1111300616 13:86344892-86344914 GGGTAGAATGGTAGTTACCAAGG + Intergenic
1111602546 13:90493649-90493671 AGGTAGATTGGGCCTGACCAGGG - Intergenic
1112506460 13:99979216-99979238 GGGAAGAATGGGACGGAGGGAGG + Intergenic
1113756417 13:112814691-112814713 GAGACCAATGGGACAGACCAGGG - Intronic
1114490418 14:23097420-23097442 GGGAAGAATGGGTTTGAAAAAGG + Intronic
1115712072 14:36061667-36061689 GGTAAAAAGGGGACTGAGCATGG - Intergenic
1115852537 14:37599188-37599210 GAGAAGTATGGGCCTGGCCAGGG + Intronic
1117314927 14:54565383-54565405 GGGAAGAGTGGGACTCAGCCAGG + Intergenic
1123918157 15:25052328-25052350 GGGAAGACTGGAAGTGACCCAGG - Intergenic
1124972328 15:34500274-34500296 GGCAAGAAGGGGACCAACCATGG + Intergenic
1125091710 15:35800466-35800488 GGGTAGAATGGTACTTACCAGGG + Intergenic
1126736412 15:51736325-51736347 GGGCAGAATGGGGCTCTCCATGG + Intronic
1127266631 15:57367474-57367496 GGGAAAAGTGAGAGTGACCACGG - Intergenic
1127771217 15:62232416-62232438 GGGAACTATGGGACTTATCAAGG - Intergenic
1128353282 15:66906389-66906411 AGGAAGAAAGGGAATGTCCATGG - Intergenic
1128645336 15:69374718-69374740 GGGAAGAATGGGAGGGAAAAGGG - Intronic
1129029227 15:72606398-72606420 TGGAAGAATGGCACAGGCCATGG + Intergenic
1129037160 15:72657442-72657464 TGGAAGAATGGCACAGGCCATGG + Intronic
1129212727 15:74079784-74079806 TGGAAGAATGGCACAGGCCATGG - Intronic
1129397672 15:75261302-75261324 TGGAAGAATGGCACAGGCCATGG + Intronic
1129401283 15:75285579-75285601 TGGAAGAATGGCACAGGCCATGG + Intronic
1129729868 15:77924105-77924127 TGGAAGAATGGCACAGGCCATGG - Intergenic
1129838650 15:78729877-78729899 TGGAAGAATGGCACAGGCCATGG + Intergenic
1129879371 15:78996829-78996851 GGGAAGAATGGGCCCCAGCATGG + Intronic
1130445629 15:83998726-83998748 GGCAAGAAGGGGCCTGATCAAGG - Intronic
1131098076 15:89668538-89668560 GGGAAGAAATTGACTGAGCAAGG + Intronic
1131222769 15:90598813-90598835 GGGAAGGATGCGATTGGCCAAGG + Intronic
1134245563 16:12537093-12537115 GGGAGGAAAGGGACTGACCGTGG - Intronic
1140120695 16:72080793-72080815 GGGAAGATTTGGACTGAACAAGG + Intronic
1140743525 16:77962181-77962203 AGACAGAAGGGGACTGACCACGG - Intronic
1142007060 16:87694372-87694394 GGAAAGAATGAAACTGACCCAGG + Intronic
1145719964 17:27061660-27061682 GAGTAGAATGGTAGTGACCAAGG - Intergenic
1147135223 17:38430168-38430190 AGGAAGAATGGGAGTGGGCAGGG + Intronic
1148053914 17:44782270-44782292 GGGCAGGAGGGGACTGAGCAAGG + Intergenic
1148866155 17:50629764-50629786 GGGCAGAATGGAACTGGCTAGGG + Intergenic
1150294597 17:64001213-64001235 GGGAAGAAGGGGGCTGGCCAGGG - Exonic
1151018002 17:70579139-70579161 GGGAAAACTGAGACTTACCAAGG - Intergenic
1153687179 18:7557982-7558004 GGGGAGAATGGGACTGGGAATGG - Intergenic
1154468947 18:14679275-14679297 GAGTAGAATGGTAGTGACCAAGG + Intergenic
1156469444 18:37368283-37368305 GGGAAGGATGGGGCTGAAGAGGG - Intronic
1156528679 18:37794393-37794415 GGTGAGAATGGCACAGACCAGGG - Intergenic
1157583455 18:48786827-48786849 GGGAAGGGTGGTAATGACCATGG - Intronic
1158490732 18:57907335-57907357 GGGGAGAGTCGGACAGACCAGGG - Intergenic
1158941637 18:62410376-62410398 GGGCAAAGTGGGACTGAGCATGG + Intergenic
1160781873 19:881099-881121 GGGAAGAAAGGGCCTGAGCTAGG + Intronic
1163711740 19:18851150-18851172 GGGAAGAATGGGGCTGGCTGTGG + Intronic
1164521576 19:28983877-28983899 GGGAAGAATGGGTTTGCCCAAGG + Intergenic
1165783405 19:38446777-38446799 GGGAAGATGGGGAGAGACCAGGG + Intronic
1167191357 19:47992078-47992100 GGGAAGCCTGTGACTGCCCATGG - Exonic
1167751416 19:51382581-51382603 GGGAGGTGTGGGAATGACCATGG - Intronic
1168522630 19:57064706-57064728 GGAAAGGATGGGACTGAGTATGG - Intergenic
925312168 2:2892554-2892576 GAGAAGAGTGGAACTGACCGAGG - Intergenic
925426257 2:3751227-3751249 GGGAAGTGGGGGACTGACGATGG - Intronic
926837920 2:17044928-17044950 GGGAAGCAAGGGGCAGACCAAGG - Intergenic
927666449 2:25036213-25036235 GGGAAGAATATGACAGTCCAGGG - Intergenic
928113009 2:28525621-28525643 GGGTAGAATGAGACTGAGCCTGG - Intronic
932670926 2:73737463-73737485 CGGAAGAATGGGCGGGACCATGG - Intergenic
933796248 2:85922194-85922216 GGGAAAAATGGGTCTGACTCTGG - Intergenic
933806077 2:85998729-85998751 AGCAAGAAAGGGACTGACCTTGG - Intergenic
935505788 2:103900466-103900488 GGGAAGAATGGGAAAGAACTTGG - Intergenic
935591765 2:104851687-104851709 AGGAAGAAGGGGACAGACCTCGG + Intergenic
935984028 2:108654963-108654985 GGGAACAGTGGGAGTGACCCTGG + Exonic
936136464 2:109898617-109898639 GGGAACAGTGGGAGTGACCCTGG + Intergenic
936208233 2:110472868-110472890 GGGAACAGTGGGAGTGACCCTGG - Exonic
938155765 2:128938737-128938759 GGTAAGGATGGGAGTGACCCAGG + Intergenic
939813538 2:146865867-146865889 GGGAAGAGTGGGAGGGGCCAAGG + Intergenic
941503362 2:166309115-166309137 GGGAAGAATGAGAGTGAAGAGGG + Intronic
942640557 2:178056916-178056938 GGGAAAAATGGGGCGCACCAGGG + Intronic
943233114 2:185282959-185282981 GTGAAGAACATGACTGACCAGGG - Intergenic
944824358 2:203466628-203466650 GTGAAGAAAGGGACAGTCCAAGG - Intronic
947739996 2:232480644-232480666 GGCAGGACTGGGACTGACCCTGG + Intronic
948866144 2:240775785-240775807 GGGAAGAAGGGCACAGCCCAGGG + Intronic
1174172391 20:48625667-48625689 GTGAAGAATGGGCCGGCCCAGGG + Exonic
1174858467 20:54068557-54068579 GGGAATAATGGGACTCTGCAAGG - Intronic
1176805573 21:13478396-13478418 GAGTAGAATGGTAGTGACCAAGG - Intergenic
1177375061 21:20259121-20259143 GGCAAGAATGGAAATGAACATGG + Intergenic
1178410538 21:32360090-32360112 TGGAAGATTTGGACAGACCAGGG - Intronic
1180901478 22:19376507-19376529 GAGAAGAATGGGGCTGTCCAGGG - Intronic
1181256553 22:21566692-21566714 GGGAGGCAGGGGACAGACCATGG - Intronic
1183217413 22:36489935-36489957 GGGGAAAGAGGGACTGACCATGG + Exonic
1183642395 22:39100610-39100632 GGAAAGAATGGGAGTGTCCTAGG - Intronic
1184326245 22:43789122-43789144 GGGAGGAATGGGACTGCTGATGG + Intronic
1185259877 22:49855663-49855685 GTGAAGGACGGCACTGACCACGG - Intronic
1185263460 22:49884608-49884630 GGGAAGAATGGGAAGGACCTGGG + Exonic
949571280 3:5295805-5295827 GGGAAGCATGGGGCAGACCAAGG + Intergenic
949823540 3:8140579-8140601 GGGAAGGATGCATCTGACCAGGG - Intergenic
949928511 3:9060197-9060219 GGGGAGTCTGGGACTGAGCAGGG - Intronic
950515024 3:13459498-13459520 GGGAAGAATGGGGAGGACCAAGG + Intergenic
952388078 3:32857282-32857304 AGGGAGAATGGGACAGACCCAGG - Intronic
953098965 3:39807594-39807616 GGGAAGAATGGGAAACACCCTGG + Intergenic
955067247 3:55544053-55544075 GGGCAGCATGGGACTAAGCAAGG + Intronic
956329951 3:68095149-68095171 GGGAAGAACAGGAGTGTCCAGGG - Intronic
957158324 3:76575204-76575226 GGAAAGAATGGGAATTATCAAGG - Intronic
960602447 3:119471283-119471305 GGAAAGAATGGGAGTCATCAAGG - Intronic
961001802 3:123379115-123379137 TGGTACCATGGGACTGACCAGGG + Intronic
961213395 3:125142181-125142203 GGGAGGAAGGGGAGTGTCCACGG + Intronic
963124133 3:141799209-141799231 GGGAAGAAGGGGACTCTACAAGG + Intronic
964096146 3:152934017-152934039 TGGAGGAATAGGACTGACCATGG + Intergenic
964691812 3:159458485-159458507 GGGAAGAAGTGGACTCAGCATGG + Intronic
966043372 3:175519327-175519349 GGGGAGAATGGGACTGAGACAGG + Intronic
968737069 4:2303213-2303235 TGGAGGAGTGGGAGTGACCAGGG - Intronic
971798306 4:31257113-31257135 GGGAAGAATGGGACAAAGCAAGG + Intergenic
972706302 4:41546751-41546773 GGGAAGAATGGGGCTTACCTAGG - Intronic
974465466 4:62249951-62249973 GAGAAGAATGGGCATTACCACGG + Intergenic
974721073 4:65738398-65738420 GGGAGAAATGGGTCTGTCCAAGG + Intergenic
975375895 4:73645696-73645718 GGGAAGAGTGGGAAGGACCGTGG - Intergenic
976380701 4:84394984-84395006 GGGAAGCAGGGAAATGACCAGGG + Intergenic
977634971 4:99286747-99286769 GGGACGAAAGGGCTTGACCAAGG - Intronic
979277245 4:118827994-118828016 GGGTAGAATTGTAATGACCATGG + Intronic
980827936 4:138094569-138094591 GGGAAGTATAGGTCTGACCTGGG - Intergenic
983557152 4:169068792-169068814 AGGAAGCATGGGACAGACCTGGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
985427367 4:189843889-189843911 GGGAAGAAGGGAAATGAGCAAGG - Intergenic
985711336 5:1431509-1431531 GTGAGGGATGGGCCTGACCAGGG + Intronic
985726010 5:1515969-1515991 GGGTAGAATGGGAGTGGGCAGGG + Intronic
985767968 5:1790761-1790783 GGGAAGAATGGGGATGCCCCTGG + Intergenic
987135535 5:14896433-14896455 GTGAAAAATGGGAATAACCATGG + Intergenic
990981285 5:61604570-61604592 GGCAAGCATGGGACTCACCTAGG - Intergenic
991460429 5:66852567-66852589 GGTAAGAAAGGGCCAGACCATGG - Intronic
991527660 5:67579787-67579809 GTGAAGAATAGGATAGACCAAGG + Intergenic
996823373 5:127654759-127654781 GGGAAGGGAGGGACTGAGCAAGG + Intronic
998047927 5:139004922-139004944 GAGTAGAATGGTACTTACCAAGG + Intronic
998827822 5:146122288-146122310 GGTAAGTATTGCACTGACCAAGG + Intronic
1001580303 5:172793698-172793720 GGGAAGAAAGGCACAGACCATGG + Intergenic
1001597323 5:172906621-172906643 GGAAAGAATGAGTCAGACCAAGG - Intronic
1002370859 5:178753073-178753095 GGGAAGTAATGGACTGAACAGGG + Intergenic
1002614428 5:180442058-180442080 GGGAAGACAGGGTCTCACCAGGG - Intergenic
1004649764 6:17598234-17598256 GGGAAGAATGGGATTGAGACAGG - Intergenic
1005917489 6:30365936-30365958 GGGCAGAATGGGAGTGAACAAGG - Intergenic
1007423792 6:41734689-41734711 GGGGAGAAAGAGACTGCCCAGGG + Intronic
1008009533 6:46450754-46450776 GAGTAGAATGGTACTTACCAGGG + Intronic
1013789576 6:113821754-113821776 GGGAAGAATGTGGCTGACAATGG + Intergenic
1015126003 6:129755478-129755500 GGGTAGAATGGTAGTTACCAAGG - Intergenic
1017198603 6:151728758-151728780 AGGCAGAGTGGGACTGCCCAGGG - Intronic
1017746328 6:157449936-157449958 GGGGAGAATACGACAGACCAGGG - Intronic
1018078704 6:160239949-160239971 GGGAAGAAAAGGAATGAGCAGGG + Intronic
1018078953 6:160242346-160242368 GGGAAGAATGGGGATCACAATGG - Exonic
1019191373 6:170253010-170253032 GGGAAGAGCTGGACTGACCTCGG - Intergenic
1019256758 7:57332-57354 GGGAAGGCTGTGACTGACCATGG + Intergenic
1019738443 7:2661542-2661564 GGGCAGAATGGGACAGTACAGGG - Intronic
1020861291 7:13495066-13495088 GGGAAGAATGGGAGAGGTCAAGG + Intergenic
1022187003 7:27979650-27979672 GAGAAGCATGGGACTGTCCCTGG - Intronic
1022291224 7:29005576-29005598 GGAAAGAATGGGATGGATCATGG - Intronic
1022834435 7:34100426-34100448 AGGAGGAATGGGTCTGGCCAGGG + Intronic
1026628606 7:72018346-72018368 GGGAAGGAAGGGACTGAGCGGGG - Intronic
1026651009 7:72215926-72215948 GGTAAGCATGGGTCGGACCAAGG + Intronic
1027807225 7:82843371-82843393 GAGAAGAATGGTAGTTACCAGGG + Intronic
1028582235 7:92420364-92420386 GAGAAGAATGTGGTTGACCATGG + Intergenic
1029376534 7:100180417-100180439 GGAAAGAAAGGGACTGGTCAGGG + Intronic
1029869155 7:103670599-103670621 GTGAAGAATGGGAATTAGCATGG + Intronic
1030936478 7:115590913-115590935 AGGAAGAGTGGGACGGAGCAAGG + Intergenic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1034529594 7:151687589-151687611 GGTAAGAATGGGCATGACCTTGG + Intronic
1035339372 7:158150699-158150721 GGGAAGAATGTGGGTGATCATGG + Intronic
1036765906 8:11549199-11549221 GGCCAGAGTGGGACTGACCAGGG + Intronic
1037654445 8:20871135-20871157 GGGAAGAATGGGACAGGGCCTGG + Intergenic
1038046614 8:23770825-23770847 GGAAAGTGTGGGACTGAACAGGG + Intergenic
1039456516 8:37710984-37711006 GGGAAGAATGGCACTGGGGAAGG - Intergenic
1039895009 8:41710824-41710846 GGAAAGAAAGGGGCTGGCCAAGG + Intronic
1039913890 8:41845516-41845538 GAGGCCAATGGGACTGACCATGG + Intronic
1041946583 8:63450431-63450453 GGAAAGAATAGGTCTGAACATGG - Intergenic
1042846591 8:73174915-73174937 GGGAAGCCTGGGGCTGACAAGGG + Intergenic
1045857406 8:106780462-106780484 GAGAGGAATGGGATGGACCATGG - Intergenic
1046266320 8:111835894-111835916 GGGTAGAATGGAACTAAGCAAGG - Intergenic
1047489507 8:125363014-125363036 GGGTAGAATGGAAGAGACCAAGG + Intronic
1047820962 8:128520173-128520195 GTGTATAATGGGACTGTCCAAGG + Intergenic
1049415674 8:142493785-142493807 GGAAGGACTGGGACTGACCTCGG + Intronic
1050984058 9:12059609-12059631 GGGAAGAGTGGGGCTGAAAAGGG + Intergenic
1051412207 9:16801524-16801546 GTGAGGAATGGGGCTGGCCACGG - Intronic
1053538696 9:38951277-38951299 AGAAAGAATGGGACTGATCTAGG + Intergenic
1054627444 9:67412641-67412663 AGAAAGAATGGGACTGATCTAGG - Intergenic
1054978558 9:71176886-71176908 AGGAAGAATGGGATAGACCAAGG + Intronic
1056720227 9:89064987-89065009 GGGGTGGCTGGGACTGACCAAGG - Intronic
1056816230 9:89803212-89803234 GGGAAGCATGGGACACTCCAAGG + Intergenic
1057899066 9:98933596-98933618 GAGAAGAAGGGGATTGCCCAGGG - Intergenic
1057928185 9:99171051-99171073 GGAAAGAAGGGTACTGGCCAGGG - Intergenic
1058059101 9:100475939-100475961 GGGAAAAAGGGGACTGATCTAGG + Intronic
1058778798 9:108312260-108312282 GGGAACAATTGGAATGACCTGGG + Intergenic
1058820142 9:108722198-108722220 GAGTAGAATGGGAGTCACCAGGG + Intergenic
1059749402 9:117233747-117233769 GTGAGCAATGAGACTGACCAAGG + Intronic
1060553245 9:124495526-124495548 GGGAAGGAGGGGCCTGCCCAGGG + Intronic
1061056021 9:128223292-128223314 GGGTGGAATGGGACTGACTCTGG - Intronic
1061594104 9:131617805-131617827 GGGGAGAATTGCACTGCCCAAGG + Intronic
1061778141 9:132979637-132979659 AGGAACAATAGGACCGACCATGG + Intronic
1062054372 9:134463384-134463406 GGGAAGAAGTGGGCAGACCAGGG - Intergenic
1185619081 X:1442476-1442498 GGGGAGCCGGGGACTGACCAGGG + Intronic
1186829940 X:13379956-13379978 GGGGAGAATGGGACTGAGACAGG + Intergenic
1188302614 X:28524268-28524290 GGGAAGACTGGGCCAGACAAAGG + Intergenic
1190334725 X:49255440-49255462 TGGGAAAATGGCACTGACCAAGG - Exonic
1192116101 X:68412839-68412861 GGGAAGAATGCGACTAAATATGG + Intronic
1195349117 X:103980206-103980228 GGCAAGAAAGGGACTGACTGAGG - Intergenic
1195352601 X:104009263-104009285 GGCAAGAAAGGGACTGACTGAGG + Intergenic
1195356494 X:104044299-104044321 GGCAAGAAAGGGACTGACTGAGG - Intergenic
1195358326 X:104058633-104058655 GGCAAGAAAGGGACTGACTGAGG + Intergenic
1195386698 X:104320342-104320364 TGGAAGAATGGGCCAGCCCAAGG + Intergenic
1195945534 X:110206773-110206795 GGGAAGAATGGGACTGACCATGG - Intronic
1197467064 X:126818001-126818023 GGGAACAATGACAATGACCATGG - Intergenic
1198058595 X:133020803-133020825 GGGGAGAATGGGACTGAGACAGG + Intergenic
1200323764 X:155216614-155216636 GGGAAGAAAGGGGCAGTCCAAGG - Intronic