ID: 1195945723

View in Genome Browser
Species Human (GRCh38)
Location X:110209079-110209101
Sequence TTCCAAAGGCTAGTGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195945718_1195945723 1 Left 1195945718 X:110209055-110209077 CCTAGAGATGTGACTTAGTTTAC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1195945723 X:110209079-110209101 TTCCAAAGGCTAGTGGGGACAGG 0: 1
1: 0
2: 1
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195945723 Original CRISPR TTCCAAAGGCTAGTGGGGAC AGG Intronic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
901415526 1:9113526-9113548 CTACAGAGGCCAGTGGGGACTGG - Intronic
903758133 1:25677464-25677486 TTCTAGAACCTAGTGGGGACAGG + Intronic
904587095 1:31586608-31586630 CTCCAAAGGCAACTGGGGGCTGG + Intronic
905213540 1:36390945-36390967 TCCCACAGGCTGGTGGGCACTGG + Intergenic
907269953 1:53285165-53285187 GTTCAAAGGCTAGTGGTGAGAGG + Intronic
908964446 1:69741076-69741098 TTCTACAGGCTAGTGGGTAAGGG + Intronic
909005425 1:70270496-70270518 TTCCACAGACTGGTGGGGACTGG + Intronic
910086818 1:83412841-83412863 TGCCGAAGGCCAGTGGGGCCTGG + Intergenic
914195433 1:145445925-145445947 GTCCTCAGGCAAGTGGGGACTGG - Intergenic
914243179 1:145866517-145866539 TTCTAAAGGGGAGTGGGGAAAGG - Intergenic
915792097 1:158683625-158683647 TTCCTAAAGCCAGTGGGGACAGG - Intronic
916714675 1:167439038-167439060 TTGCAAAGGCTAGAGGGGGGTGG - Intronic
918513146 1:185333461-185333483 TTCCAAATGCTATTGGAGCCTGG + Intergenic
919302039 1:195783002-195783024 TTCCACAGTCTAATGGGCACTGG - Intergenic
920351866 1:205343214-205343236 GGCCAAAGGCAAGTGGGGCCAGG - Exonic
922395467 1:225196031-225196053 TTCCATAGGTTATTGGGGAACGG + Intronic
923147207 1:231206606-231206628 TTCCAAATGCTAGAGGAGCCTGG + Intronic
924017746 1:239745644-239745666 TTCTAAAGGGTGGTGGGGGCGGG - Intronic
1063749429 10:8926004-8926026 CTGGAAAGGATAGTGGGGACTGG - Intergenic
1066542207 10:36459357-36459379 TTCCTAAGGGTAGTGGAGGCTGG - Intergenic
1073036071 10:100565027-100565049 TTCCAGAGGGAAGGGGGGACAGG + Intergenic
1074149501 10:110745463-110745485 ACACAAAAGCTAGTGGGGACAGG - Intronic
1078134912 11:8643743-8643765 TTTAAAAGCCTAGTGGGGGCAGG + Intronic
1079742546 11:24081117-24081139 TACTAAAGGCAAGAGGGGACAGG - Intergenic
1080291904 11:30680590-30680612 TTCCAAAGGCTGGTGGTACCAGG + Intergenic
1080309215 11:30869808-30869830 TTCCAAAGGCCTTTGGGCACAGG + Intronic
1080611107 11:33904693-33904715 TTCTAAAGGCTAGGAGGGAAAGG - Intergenic
1081608769 11:44545812-44545834 ATCCAAAGGCTTGGGGAGACGGG + Intergenic
1081814231 11:45929631-45929653 GTCCAAAGGCTGCTGGGGAAGGG + Intronic
1082299764 11:50491699-50491721 TTCCAAAGATTAATGGGGATTGG + Intergenic
1083853226 11:65379666-65379688 TGCCACAGGGAAGTGGGGACAGG + Intronic
1085371520 11:76011265-76011287 TTCCTAAGGGTAATGGGGAATGG - Intronic
1086081043 11:82902278-82902300 TTCAAGAGGCTGGTAGGGACTGG - Intronic
1093189152 12:16055360-16055382 TAACAAATGCTAGTGAGGACAGG + Intergenic
1096655712 12:53090272-53090294 TTCCCAGGGCTAGTGGTGACTGG - Intergenic
1099508169 12:83503843-83503865 ATCCAAAGGCTAATGGAGATTGG + Intergenic
1100976081 12:100124003-100124025 TTCCAAAGTGTTGTGGGTACAGG - Intronic
1101544055 12:105694037-105694059 TTCCATAGGTTATTGGGGAAGGG + Intergenic
1101586939 12:106093355-106093377 TTTCAAAGGATAGTAGGGATTGG + Intronic
1102937484 12:116910096-116910118 TTCCACAGGTTATTGGGAACAGG + Intergenic
1103111865 12:118287193-118287215 TTCCATAGGTTATTGGGAACAGG - Intronic
1105798747 13:23884202-23884224 TGCCAGAGGTTAGTGGGGAGGGG + Intronic
1106086340 13:26545643-26545665 TTTCAAAGGCTAGAGGGCAGTGG + Intergenic
1107610943 13:42112440-42112462 TTCCAAAGCCACGTGGGGCCAGG - Intronic
1108174748 13:47780654-47780676 GTCCATAGGGTAGGGGGGACAGG + Intergenic
1110750286 13:79106721-79106743 TTCCAGAGGTTAGAGGGGAAGGG + Intergenic
1110860233 13:80339649-80339671 TTTCAAAGGGGAGGGGGGACTGG - Exonic
1112388266 13:98960064-98960086 TTGCAAATAATAGTGGGGACCGG - Intronic
1113167260 13:107455699-107455721 TGCCAGAGGTTAGTGGGGAGAGG - Intronic
1119425405 14:74531717-74531739 TCCCAGAGGCCAGTTGGGACTGG + Intronic
1120355909 14:83433696-83433718 TTCCATAAGTTATTGGGGACAGG + Intergenic
1121827959 14:97026264-97026286 TACCAAAGGGAAGTGGGGTCTGG + Intergenic
1122508933 14:102250342-102250364 TGCCAAAGGCTGGGGGGGAGTGG + Intronic
1122877948 14:104677454-104677476 TTCCTAGGGCTATGGGGGACAGG + Intergenic
1126413227 15:48393586-48393608 TTCCACAGGCTGGTGGGGTTGGG + Intergenic
1126773088 15:52077014-52077036 TTCCCAAGGGTAGAGGGGAGGGG - Intergenic
1128548367 15:68582181-68582203 TTCCTAAGGCTAGTTAGGGCAGG - Intronic
1128679484 15:69637647-69637669 TTCAGAAGAATAGTGGGGACTGG + Intergenic
1132727256 16:1344323-1344345 TTCCAAAGCCCAGTGGAGGCCGG + Intronic
1132905029 16:2278106-2278128 TGCCAAAGGCTTGTGCAGACAGG + Intronic
1134766064 16:16759105-16759127 TCCCAAAGGCTAGCTGGGGCTGG - Intergenic
1134979982 16:18600109-18600131 TCCCAAAGGCTAGCTGGGGCTGG + Intergenic
1135844292 16:25904542-25904564 TTTCACTGGCTTGTGGGGACAGG + Intronic
1135898312 16:26430777-26430799 TTCCATAGGTTATTGGGTACAGG - Intergenic
1137403482 16:48172045-48172067 TACCAAGGGCTGGTGGGGAGGGG - Intronic
1144782498 17:17815061-17815083 TCCCACAGGCTGGTGGGGAGAGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1150590850 17:66560870-66560892 TCCCAAAGGCAAGGGTGGACAGG - Intronic
1152629958 17:81406413-81406435 TCCCAGAGGTTAATGGGGACCGG - Intronic
1154336921 18:13473371-13473393 TTCAAAAACCTAGTGGGGGCTGG + Intronic
1157114057 18:44846725-44846747 TTCCAAAGCCTAGTGGGATTAGG + Intronic
1157181771 18:45504693-45504715 TTCCACAGGCTAGTGCTGCCAGG - Intronic
1157181981 18:45506205-45506227 TCTCAAAGGCTAGTGGGAGCAGG - Intronic
1157370733 18:47109177-47109199 TCCCAAAGGCAACTGGGAACAGG + Intronic
1158212732 18:55068834-55068856 TTTCAAAAGCCAGTGGGGGCTGG - Intergenic
1158880374 18:61773407-61773429 TTTCAAAGCCTTGTGGGGATGGG - Intergenic
1159687247 18:71438003-71438025 CTCCAGAGGCCAGTGGGGCCAGG + Intergenic
1160698047 19:494156-494178 ATCCACAGGCTTGTGGGGGCGGG - Intronic
1161106174 19:2445165-2445187 TTGCAAAGGCTGGTGGGGGCAGG - Intronic
1164687116 19:30174150-30174172 TGCCACAGGAGAGTGGGGACTGG + Intergenic
1167433332 19:49465397-49465419 ACCCAGAGGCTAGTGGGAACAGG + Intronic
1167622367 19:50567232-50567254 CCCCAAAGCCTAGTGGGGTCAGG + Intronic
1168683132 19:58330712-58330734 TGCCAAAGGCTAGTGTGGCCTGG + Intronic
928442727 2:31305429-31305451 TTCCATAGGTTTTTGGGGACAGG + Intergenic
929009725 2:37429083-37429105 TTCCATAGGTTATTGGGAACAGG + Intergenic
929109669 2:38396133-38396155 TTCCCAAGGTTTGTGGGGAGAGG - Intergenic
929795132 2:45053470-45053492 TTCCAAATGCCTGAGGGGACAGG + Intergenic
930422764 2:51175142-51175164 TTCCACAGACTGGTGGGGAAGGG - Intergenic
932470310 2:71950846-71950868 TTCCCAAGGCCAGTGAGGAAGGG - Intergenic
934515933 2:94986599-94986621 TTCCAAAGGCTGCTGGGCTCTGG - Intergenic
940768651 2:157817364-157817386 TGCCAAGGGCTAGTGGGGATGGG + Intronic
941339156 2:164284661-164284683 TTCCAGAGGGTAGAGGGGAAGGG + Intergenic
946195983 2:218033360-218033382 TTCCCCAGGATGGTGGGGACAGG - Intergenic
948268114 2:236653400-236653422 TTCCAAAGTCTATTGGTGACTGG - Intergenic
948871267 2:240799398-240799420 TTCCAGAGGCTACAGGGGAGGGG + Intronic
949035362 2:241813620-241813642 CTCCAAAGCCGAGTGGGGCCCGG - Intronic
1168953110 20:1815946-1815968 TTCCTAGGGGTAGTGGGGAGAGG + Intergenic
1169497596 20:6130061-6130083 TTCCAGAGACCAGTGGGAACTGG - Intergenic
1173632962 20:44530500-44530522 TTCCCAAGGCTAGTTTGGCCTGG + Intergenic
1175901886 20:62363207-62363229 TTCCGGAGGCCTGTGGGGACCGG + Intronic
1182460927 22:30483542-30483564 TGCCTAAGGCTACTGGGGAGAGG + Intergenic
1184322064 22:43749443-43749465 TTCCATGGGCCAGTGGGGAGGGG + Intronic
949111926 3:271159-271181 TTCCTAAGGATTGTGGGGAGGGG + Intronic
953428314 3:42814854-42814876 TTTCAAAGGCTTCTTGGGACTGG + Intronic
954364862 3:50140318-50140340 TTCCAAGGGCCAGGGGGGCCTGG - Intergenic
954625795 3:52021278-52021300 TCCTAATGGCTGGTGGGGACTGG + Intergenic
960528981 3:118742211-118742233 TCCCAAGGGCTAGTGTGTACAGG - Intergenic
960662796 3:120079239-120079261 TTTCAAAGGATAGAGGAGACAGG - Intronic
960910457 3:122644277-122644299 TTTGAAAGGCTAATGGGGGCTGG + Intergenic
961631041 3:128298732-128298754 TACCAAAGGCTGGTGGGCAGGGG - Intronic
963654415 3:148026467-148026489 TTCCATAGGCTGGTGTGGCCTGG + Intergenic
964531056 3:157668454-157668476 TTCCAAAGGCTAGTTAGTATAGG - Intronic
969184819 4:5467307-5467329 CTCCAAAGGCTATAGGGGAGGGG + Intronic
971701362 4:29981842-29981864 TTCCAGAGGCTGATGGGGTCAGG + Intergenic
971790202 4:31160437-31160459 TTCTAAAGGCTAATGAGGACAGG + Intergenic
972893098 4:43584185-43584207 TTCCAAAGGCTGGGGGTGAGAGG + Intergenic
974722214 4:65755066-65755088 ATTCAAACGCTAGAGGGGACAGG + Intergenic
975521683 4:75308258-75308280 TCCCAAAGACCAGTGGGGACAGG + Intergenic
977538489 4:98284949-98284971 TCTCAAAGGCTAGGGGTGACTGG - Intronic
977785320 4:101026676-101026698 TTCCAAAGTTAAGTGGAGACAGG - Intronic
981064299 4:140464986-140465008 TTCAAAAGGCAAGTGAGGTCTGG - Exonic
982950096 4:161683759-161683781 TTCCATAGGTTATTGGGGAATGG + Intronic
983089260 4:163485110-163485132 TTCCAAAGGCAAGGGTGCACAGG + Intergenic
983439738 4:167766142-167766164 TTCCACAGACCAGTGGGGAGGGG + Intergenic
983569786 4:169193262-169193284 TTCCATAGGTTATTGGGGAATGG - Intronic
993615979 5:90113116-90113138 TTCCAAAGGAGAGTGGGGGGTGG + Intergenic
999325771 5:150642488-150642510 AGCCAAAGGCTACAGGGGACAGG - Intronic
1001159741 5:169302059-169302081 TTCCAGATGCCAGTGGGGAGGGG + Intergenic
1001296828 5:170504339-170504361 TTCCGAAGGCTCGCGGGGAGCGG + Intronic
1001341562 5:170851287-170851309 TTCCACAGGTTATTGGGGAACGG + Intergenic
1001598591 5:172914551-172914573 GTCCAAAGACTACAGGGGACAGG - Intronic
1002566474 5:180114920-180114942 GTCCACAGGCTTGTGGGCACCGG + Intronic
1002872922 6:1183725-1183747 GTCCAAAGGATGGTGGAGACTGG - Intergenic
1003295698 6:4825159-4825181 TTCCAACAGCTAGTGGGGCACGG - Intronic
1006780930 6:36631788-36631810 TTCCAAATGCTAGGGGTGGCAGG + Intergenic
1008453121 6:51675742-51675764 TCCAAAAGGCTAGGGTGGACAGG + Intronic
1010379573 6:75208903-75208925 TTCCAAAGGGTATTAGGAACTGG - Intergenic
1012578503 6:100833283-100833305 TTCCCAAGGCTACAGGGGAAGGG + Intronic
1012973009 6:105751721-105751743 TACCAGAGGATAGTGGGGAGGGG - Intergenic
1013286354 6:108685565-108685587 TGCCAAAGCCTACTGGGGATGGG + Intergenic
1015544257 6:134345951-134345973 TCCCAAAGGCAAGTGGGAATGGG + Intergenic
1015876547 6:137828404-137828426 TTCCAAAGGCCAAGGGGGAAAGG - Intergenic
1016257524 6:142126050-142126072 TGCCAGAAGCTAGTGGGGAGTGG - Intergenic
1016600258 6:145850191-145850213 TTTGCAAGGCTAGTGGGGAGGGG + Intergenic
1017228087 6:152043135-152043157 ATCCAAAGGCTTATGGAGACTGG - Intronic
1017973481 6:159333350-159333372 CTTCACAGGCTAGTAGGGACAGG - Intergenic
1019951102 7:4373432-4373454 TTCCAAAAGCTAGCTGGGCCTGG - Intergenic
1023942791 7:44780859-44780881 TTCCAAAGTCCAGTGTTGACAGG - Intergenic
1024305291 7:47923513-47923535 TTCCATAGGTTATTGGGGAACGG - Intronic
1026013430 7:66654403-66654425 ATCCAAAGGGTCGAGGGGACTGG - Intronic
1026577297 7:71582943-71582965 TTCCATAGGTTATTGGGGAACGG - Intronic
1027303697 7:76869322-76869344 TGCCGAAGGCCAGTGGGGCCTGG + Intergenic
1028649663 7:93137610-93137632 TTCCACAGGGTAGTGGGGGATGG - Intronic
1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG + Exonic
1029604441 7:101590224-101590246 GTCCAAAGCCCAGTGGGGCCTGG + Intergenic
1030150506 7:106399677-106399699 TTGCAAAAGGTAGAGGGGACAGG - Intergenic
1031369953 7:120952660-120952682 TTTAAAAGGCTATTGTGGACTGG + Intronic
1032613597 7:133442542-133442564 TGCCTCAGGCTAGTGGGGATGGG + Intronic
1032634839 7:133695116-133695138 TTAGAAAGGGTAGTGGGGGCCGG - Intronic
1039491808 8:37953335-37953357 TTCCAGAAGCGAGTGGGGATGGG - Intergenic
1042465154 8:69121244-69121266 TTCCAATGGTTTGTGGGGAAAGG + Intergenic
1043389297 8:79776612-79776634 AGTCAAAGGCTAGTGGGGCCAGG + Intergenic
1047585833 8:126271400-126271422 TTCAAAAGGCTACTGTGCACGGG + Intergenic
1053015584 9:34660225-34660247 GTCCATACGCTGGTGGGGACGGG - Intronic
1054849455 9:69831781-69831803 TTCCAAAGACTCTTGGGGAAAGG - Intronic
1056873063 9:90303199-90303221 TTTCACAGGCTAGTGGAGAAGGG + Intergenic
1058539876 9:106000428-106000450 TTTCACAGACTAGTGGGGTCTGG - Intergenic
1059231033 9:112721775-112721797 TTAAAAAGGCTAGTCTGGACGGG - Intergenic
1060959772 9:127671972-127671994 TTTGCAAGGCTAGTGGGCACAGG - Intronic
1061257473 9:129460898-129460920 TGCCAAAGGCTTGTGGGGGTGGG - Intergenic
1062699231 9:137890425-137890447 GTCCTCAGGCAAGTGGGGACTGG + Intronic
1185833959 X:3328390-3328412 TGCTAGAGGATAGTGGGGACAGG + Intronic
1187193283 X:17056989-17057011 TTTCAAAGGCAAATGGGCACTGG + Intronic
1187701607 X:21968897-21968919 TTCCATAGGTTATTGGGGAACGG - Intronic
1191891829 X:65951366-65951388 TTCCATAGGTTATTGGGGAAAGG + Intergenic
1192410029 X:70925935-70925957 TAGCAAAGCCTAGTGGGGAAAGG + Exonic
1194601817 X:95930663-95930685 TTCCATAGGATTGTGGGAACAGG - Intergenic
1195945723 X:110209079-110209101 TTCCAAAGGCTAGTGGGGACAGG + Intronic
1196816456 X:119668798-119668820 TTCCATAGGTTTTTGGGGACAGG + Intronic
1197170799 X:123431640-123431662 TTCCAAAACCTAGTGGAGAATGG - Intronic
1198064702 X:133084754-133084776 TTCCATAGGTTATTGGGGAACGG + Intronic
1198590490 X:138175000-138175022 TACCAAAGGCTATTGGGGTGAGG - Intergenic
1199498712 X:148485124-148485146 TTCCATAGGTTACTGGGGACAGG - Intergenic
1199627346 X:149752646-149752668 ATCCAAAGGCTAATGGAGATTGG - Intergenic