ID: 1195947269

View in Genome Browser
Species Human (GRCh38)
Location X:110228608-110228630
Sequence CTGTCAGTGCTGAGTTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195947269 Original CRISPR CTGTCAGTGCTGAGTTATGT TGG (reversed) Intronic
901897620 1:12327896-12327918 CAGTCATTGCTGAATTATTTGGG + Intronic
904316445 1:29669197-29669219 CTGTTAGAGCTGAGTGAAGTTGG - Intergenic
908106708 1:60852025-60852047 CTGTGTGTGTTGAGTTGTGTTGG + Intergenic
908943059 1:69459755-69459777 CTGCCAGTGCTGGGACATGTGGG - Intergenic
909181882 1:72434745-72434767 CTTTCAGTGCTGAGCCTTGTAGG - Intergenic
911429639 1:97767667-97767689 CTGTCAGGGCTGAATTGTGTAGG - Intronic
912114544 1:106389003-106389025 TTATCAGTGTTGAGTTATGCTGG + Intergenic
912295539 1:108467259-108467281 TTGTCATTACTGAGTAATGTAGG + Intronic
915793049 1:158695867-158695889 CTGCCTCTGCTGAGTTATGCAGG + Intergenic
915916826 1:159945510-159945532 CTGGTAGTGCGGAGTTATGGGGG - Intronic
919240653 1:194911967-194911989 CTGTCAGTACTGGGTAATTTCGG - Intergenic
920567529 1:206986876-206986898 CAGTCAGTGCTGTATTATTTTGG + Intergenic
920727046 1:208445929-208445951 CTGTCTCTGCTGAGTCATGCAGG + Intergenic
922547323 1:226467687-226467709 TTGGAAGTGCTGGGTTATGTGGG + Intergenic
923513530 1:234674356-234674378 CTGTAGGTGCTGATTTATGAGGG + Intergenic
1065015035 10:21454974-21454996 CTTTCAGTGCTGTTTTAAGTTGG + Intergenic
1065675760 10:28172357-28172379 CTCCCACTGCTGATTTATGTAGG + Intronic
1065806552 10:29398524-29398546 ACGTCAGTTCTGACTTATGTTGG - Intergenic
1066551843 10:36567561-36567583 CTGTCAGTAGTGGGGTATGTGGG - Intergenic
1072848985 10:98866084-98866106 CTGTCAGTTCTGAGTTGTTTTGG - Intronic
1077288285 11:1777363-1777385 CCATCAGGGCTGAGTTAGGTAGG + Intergenic
1079132386 11:17754858-17754880 CTGCCACTTCTGAGTTACGTGGG + Intronic
1079894138 11:26097576-26097598 CTGCAAGTGCTGAGTTGAGTTGG - Intergenic
1082005327 11:47415905-47415927 CTGTCAGTGCTGAGTGGGGCTGG - Exonic
1084289783 11:68154724-68154746 CTGTGAGTGTTGAGTTCTCTGGG - Intergenic
1085604063 11:77881518-77881540 CTGTCACTGATCAGGTATGTGGG + Intronic
1090339804 11:126007253-126007275 CTGTCAGTCCTGTTTTCTGTTGG - Intronic
1090410997 11:126509689-126509711 ATTTGAGTGCTGAGATATGTTGG - Intronic
1090479154 11:127052729-127052751 CTTTCTGTGCTGAGTCATGGGGG + Intergenic
1090501861 11:127268674-127268696 CTGTCACTGGTGAGCTATATAGG - Intergenic
1095713281 12:45313545-45313567 ATGGCAGGGCTGAGTAATGTAGG - Intronic
1098134261 12:67385005-67385027 CCGTCAGTGCTGGGTAATCTTGG - Intergenic
1099393038 12:82103183-82103205 CTGCCTGTGCTGAGTCATGTAGG - Intergenic
1100320008 12:93481897-93481919 CAGTCTGTGCTGGGTTAAGTAGG - Intronic
1106657400 13:31760488-31760510 CAGTCAGTGCTCAGTTTTGGGGG + Intronic
1107572288 13:41675694-41675716 CTGTCCGAGCTGTGTTAGGTTGG + Intronic
1110881532 13:80578046-80578068 CTGCCTCTGCTGAGTCATGTAGG - Intergenic
1113128191 13:107003836-107003858 CTGTCAATGCTGAGCTAAATAGG - Intergenic
1113329939 13:109317856-109317878 CTGCCTCTGCTGAGTTATGCAGG - Intergenic
1113513277 13:110872475-110872497 CTGTCAGTGCTGTGTTTTGAGGG + Intergenic
1115680307 14:35730633-35730655 CTGCCTCTGCTGAGTTATGCAGG - Intronic
1117229655 14:53702811-53702833 TTGTCAGTGCTGAGTTTAGCTGG - Intergenic
1120070925 14:80101103-80101125 ATGTGGGTGCTGAGTTATGGTGG - Intergenic
1123766866 15:23490046-23490068 CTCTCAGTGCTGAGCTATGCAGG - Intergenic
1125631834 15:41153679-41153701 CCGTCAGTGCTCAGAAATGTGGG - Intergenic
1126125137 15:45288843-45288865 CTGTCAGCTCTAAGTTAAGTTGG + Intergenic
1126577487 15:50210884-50210906 CTGTCTCTGCTGAGTCATGCAGG - Intronic
1127525260 15:59786570-59786592 CTGCCTCTGCTGAGTTATGCAGG + Intergenic
1128579587 15:68799694-68799716 CTGTCAGTGCAGAGTGTTTTGGG - Intronic
1131563263 15:93462644-93462666 CTGTGAGTGCAGAGGTGTGTTGG - Intergenic
1131856339 15:96600281-96600303 CTGTCACTCCTGGGTTATCTAGG - Intergenic
1132566236 16:624833-624855 CTGTCACTGCCGAGATATTTAGG + Intronic
1133200131 16:4199064-4199086 ACTTCAGTGCTGAGTTATGCAGG - Intronic
1144599079 17:16597459-16597481 CTTTCAGGGCTGTGTTATGAAGG + Intergenic
1146041734 17:29461483-29461505 GTGTCAGGGCTGAGGTTTGTTGG - Intronic
1148227023 17:45906186-45906208 CTGCCAGTGCTGACTTCTCTGGG + Intronic
1148533806 17:48420981-48421003 CTGTCTGTCCTGGGTTGTGTAGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151296418 17:73189708-73189730 CTGTCAGTGCTCAGTTCTGCAGG + Intergenic
1151498930 17:74476462-74476484 GTGGCAGCGCTGAGTTCTGTGGG + Intronic
1153685826 18:7544164-7544186 GTGTCAGTTCTGAGTCATGCAGG - Intergenic
1156940701 18:42764124-42764146 CAGTCATTTCTGAGTTCTGTTGG - Intronic
1158568091 18:58572367-58572389 CAGTCATTGCTGAGTCATATGGG - Intronic
1159203733 18:65223319-65223341 CTAAGAGTGGTGAGTTATGTGGG - Intergenic
1159454047 18:68638650-68638672 CTGTCTCTGCTGTGTCATGTAGG + Intergenic
1161770457 19:6228114-6228136 CTGTCAGTGCTGAGCTATCATGG - Intronic
1162321156 19:9971121-9971143 CTGTCAGTGCCCAGGTCTGTGGG + Intronic
1163372489 19:16909139-16909161 CTGTAAATGCTGACTTATTTAGG + Intronic
1164251717 19:23483055-23483077 CTGTCTTTGCTGAGTCATGCAGG - Intergenic
1167431889 19:49459879-49459901 CTAGCACTGCTGAGTCATGTGGG - Intronic
1167605147 19:50477847-50477869 CTGTCTGTCCTGGGTTCTGTGGG + Intronic
928728762 2:34206578-34206600 CTGTCAGTCCTGAATTCTGCAGG + Intergenic
929208881 2:39330671-39330693 CTGTCAGTGCTGATTTTTGTCGG - Intronic
930019607 2:46993542-46993564 CTGGCAGTGCTGGCTTATTTAGG + Intronic
930486524 2:52017877-52017899 CTGTCTCTGCTGAGTTATGCAGG + Intergenic
935444395 2:103140815-103140837 CTGAAAGTGCTGCCTTATGTTGG + Intergenic
936342521 2:111647608-111647630 CTGTCAGTTTTGGTTTATGTTGG - Intergenic
937069271 2:119050388-119050410 CTGTCTCTGCTGAGTCATGCAGG + Intergenic
937521773 2:122720881-122720903 CTGTCTCTGCTGAGTCATGCAGG - Intergenic
937767633 2:125680234-125680256 CTGCCTCTGCTGAGTCATGTAGG + Intergenic
937797796 2:126045413-126045435 CTGACAGTGCTGAGAAATATTGG + Intergenic
938089845 2:128424371-128424393 ATGTCTGTGCTGAGTTATCAGGG + Intergenic
940034727 2:149301804-149301826 CTGTCTCTGCTGAGTTGTGCAGG + Intergenic
941627422 2:167844992-167845014 CTGTCTCTGCTGAGTCATGCAGG - Intergenic
942995166 2:182251743-182251765 CCGTCAGTGATGAGGCATGTTGG + Intronic
944639851 2:201713853-201713875 CTTTCATTGCTGAGTAATTTTGG + Intronic
947302655 2:228705671-228705693 CTGTTAGAGCTGAGTTGTTTTGG - Intergenic
948384155 2:237571308-237571330 CTGTCTGTCCTGATTTCTGTGGG - Intergenic
1170245780 20:14220272-14220294 CTGTCTCTGCTGAGTCATGCAGG + Intronic
1173382982 20:42562736-42562758 TTGTCAGGGCTGAGTGATGAGGG - Intronic
1173710763 20:45153628-45153650 CTGTCAGTGCTGAGATCTGCTGG + Intergenic
1174009655 20:47439283-47439305 CAGCCAGAGCTGAGCTATGTTGG - Intergenic
1174306751 20:49618864-49618886 CCGACATTGCTGAGTTATGAAGG - Intergenic
1174915630 20:54650460-54650482 CTGTCAGTGCTCAGATCTGTAGG - Exonic
1175403043 20:58711377-58711399 ATGTCAGTGCTGGGGTATCTGGG + Intronic
1176383477 21:6125610-6125632 CTGTCAGTGCTGAGGTTGGCTGG + Intergenic
1177620567 21:23586407-23586429 CTGTCAGTGCTGTATCATTTTGG + Intergenic
1179129659 21:38623693-38623715 CTGTCAGTGCTGAGCAACTTAGG - Intronic
1180043655 21:45293031-45293053 CTGACCCTGCTGAGTTCTGTGGG - Intergenic
1180058344 21:45371345-45371367 CTCTCTGTGCTGTGTTCTGTGGG + Intergenic
1185266245 22:49905869-49905891 CTGGCAGTGCTGAGCTCTTTGGG - Intronic
951269604 3:20608265-20608287 CTGTCTCTGCTGAGTCATGTAGG - Intergenic
951736491 3:25871092-25871114 CTGACAGTGCAGAGTGATATTGG - Intronic
954841175 3:53513162-53513184 CTGACATTGCTGAGCTAGGTGGG + Intronic
955175646 3:56611311-56611333 CTGCCTGTGCTGAGTCATGCAGG + Intronic
955319552 3:57964513-57964535 CTGTCTGTCCTGGGTTTTGTGGG - Intergenic
955795990 3:62637481-62637503 CTCACAGTGCTGATGTATGTGGG + Intronic
959279766 3:104323377-104323399 CTGCCACTGCTGAGTCATGCAGG - Intergenic
959897326 3:111619189-111619211 CAGTCAGTGCTGAATTGAGTGGG - Intronic
963826541 3:149960908-149960930 CTGTCAGTGCCCAGTCATTTGGG + Exonic
965064462 3:163829034-163829056 CTTTCAGTCCTGAGTGGTGTAGG + Intergenic
966054534 3:175667998-175668020 CTATCAGTGCTGTGTGATGATGG - Intronic
968476438 4:811849-811871 CTGTCTTTGCTGACGTATGTTGG + Intronic
969065198 4:4473973-4473995 CTTTCAGCGCTGAGTTGTGAAGG - Intronic
969294790 4:6263453-6263475 CTGGCACTGCTCAGTGATGTAGG + Intergenic
973701985 4:53546566-53546588 CTGGCAGGGCTGAGTCATTTGGG + Intronic
974411452 4:61545983-61546005 CTGACAGTGCTTATTGATGTGGG - Intronic
975033799 4:69657125-69657147 CTGCCTCTGCTGAGTCATGTAGG - Intergenic
975517246 4:75260238-75260260 CTGTCTCTGCTGAGTCATGCAGG - Intergenic
980087197 4:128403646-128403668 CTGCCTCTGCTGAGTCATGTAGG + Intergenic
983381499 4:167000616-167000638 CTGTTAACTCTGAGTTATGTGGG - Intronic
983449774 4:167895378-167895400 CTGTCTCTGCTGAGTCATGCAGG - Intergenic
983544945 4:168953158-168953180 CTGCCTCTGCTGAGTCATGTAGG + Intronic
983970379 4:173864125-173864147 CTGGCAGTGCTGGGTAAGGTTGG + Intergenic
984323557 4:178224315-178224337 CTGCCTGTGCTGAGTCATGCAGG - Intergenic
986973020 5:13359257-13359279 CTCTCTGTGCTTAATTATGTTGG - Intergenic
987262866 5:16221357-16221379 CTGGCAGTGCTGTGTCATGTTGG - Intergenic
988902216 5:35745571-35745593 CTGCCTCTGCTGAGTCATGTAGG - Intronic
989054194 5:37351009-37351031 CTCTGAGGGCTGAGTTTTGTAGG + Intronic
989114478 5:37939093-37939115 CTGTCAGTGTTGAGTTTTCTTGG + Intergenic
990233322 5:53739237-53739259 CTGCCTGTGCTGAGTCATGCAGG - Intergenic
994568386 5:101483005-101483027 CTGTCTCTGCTGAGTCATGCAGG + Intergenic
995027472 5:107440573-107440595 CTGACAGTGCTGAGTTTTCATGG - Intronic
995459360 5:112386925-112386947 CTGTCAGTGGTGAGGTCGGTGGG - Intronic
1000718697 5:164679410-164679432 CTTGCAGTGCTGTCTTATGTGGG + Intergenic
1002813834 6:660102-660124 CTGTCTCTGCTGAGTCATGCAGG - Intronic
1003930497 6:10919816-10919838 CTGTCTCTGCTGAGTCATGCAGG + Intronic
1005760259 6:28961176-28961198 CTGCCTCTGCTGAGTCATGTAGG - Intergenic
1008137975 6:47799480-47799502 CTGGCATTGCTGAGATATTTAGG + Intronic
1008321779 6:50122814-50122836 CTGCCAGTTCTGTCTTATGTGGG + Intergenic
1009384142 6:63068714-63068736 CTGCCTCTGCTGAGTTATGCAGG + Intergenic
1009968769 6:70604613-70604635 CTGCCTGTGCTGAGTCATGCAGG - Intergenic
1011559186 6:88598006-88598028 ATGTAAGTGCTGAGTTTTGGGGG + Intergenic
1014603182 6:123441965-123441987 GTGACAGTGATGAGGTATGTTGG - Intronic
1014603887 6:123448484-123448506 CTGTCTCTGCTGAGTCATGCAGG - Intronic
1015143729 6:129963055-129963077 CTCTCAGTGCTGATTGTTGTTGG + Intergenic
1017031730 6:150229903-150229925 GTGTCAGTGGTGAGTGATGGTGG + Intronic
1017780067 6:157708942-157708964 CTTTCACTCCTGTGTTATGTTGG + Intronic
1018533979 6:164799079-164799101 CTGTCTGTCCTGTGTTTTGTTGG - Intergenic
1022421812 7:30230335-30230357 CTGTCAGTCCTTCGGTATGTGGG - Intergenic
1022510725 7:30933450-30933472 CTCTCAGGGCTGTGTTATGGGGG - Intergenic
1022580912 7:31553225-31553247 CTGTGAGTGGTGAGGGATGTGGG + Intronic
1028620337 7:92819630-92819652 CTGTCAGTGTTTAGTTTTTTTGG - Intronic
1031761260 7:125716055-125716077 CTGCCTCTGCTGAGTCATGTGGG + Intergenic
1032998733 7:137479181-137479203 CTGTCATTGCTCTGTAATGTAGG + Intronic
1033772079 7:144563986-144564008 CTTTCATGGCTGGGTTATGTTGG - Intronic
1034851244 7:154495921-154495943 CTGTCAGAGCTGAGTGCTGTGGG + Intronic
1035224146 7:157424396-157424418 CTGTCACTGCTGTGCTGTGTAGG + Intergenic
1035296925 7:157872632-157872654 CTCTCAGTGCTTAGTTATACCGG - Intronic
1035306942 7:157939473-157939495 CTCTCAGTGCTGTGTGTTGTGGG + Intronic
1035472755 7:159120621-159120643 CTGCCTGTGCTGTGTTGTGTCGG - Intronic
1036442178 8:8791218-8791240 CTGTCTGTGCTCCGATATGTGGG - Intronic
1038389302 8:27180234-27180256 CTGTAACAGCTGAGTGATGTTGG - Intergenic
1041890534 8:62863748-62863770 CTGGCTGTGCTGGGATATGTAGG - Intronic
1044064134 8:87678541-87678563 CTGTTAGTGATGAGTTATGTGGG + Intergenic
1046895048 8:119463366-119463388 CTGTCAGACCTGAATTCTGTAGG + Intergenic
1047130774 8:122017510-122017532 CTGTCTCTGCTGAGTCATGCAGG + Intergenic
1048432260 8:134381527-134381549 CTGTCAGTGCTGAGCTCAGCAGG + Intergenic
1051915393 9:22200883-22200905 CTGTCAGTTCTGAATTCTGTAGG - Intergenic
1056018080 9:82412706-82412728 CTTCCAGTGCTAAGTGATGTGGG - Intergenic
1056179324 9:84066369-84066391 CTGACTGTGATGAGATATGTTGG - Intergenic
1056990255 9:91404112-91404134 CTGTCACTGCTAAGTCATGCTGG - Intergenic
1058308417 9:103471415-103471437 CTGTCTCTGCTGAGTCATGCAGG + Intergenic
1058324828 9:103682105-103682127 TTCTGAGTGCTGACTTATGTGGG + Intergenic
1058907035 9:109490217-109490239 CTTTCCCTGCTGAGTGATGTGGG - Intronic
1186836590 X:13444459-13444481 CTGTCAGTGTTAAGTGGTGTAGG - Intergenic
1186954473 X:14666901-14666923 CTATCAGTGCTGAGTTAGAGTGG - Intronic
1189567180 X:42255001-42255023 CTGCCTCTGCTGAGTTATATAGG - Intergenic
1189962151 X:46333854-46333876 CTGTCTCTGCTGAGTCATGAAGG - Intergenic
1191606271 X:63066049-63066071 CTGGCCGTGCTGAGTTGTGGTGG - Intergenic
1193154583 X:78158812-78158834 CTGCCTCTGCTGAGTCATGTAGG - Intergenic
1195019488 X:100812502-100812524 CTGTCTCTGCTGAGTCATGCAGG + Intergenic
1195947269 X:110228608-110228630 CTGTCAGTGCTGAGTTATGTTGG - Intronic
1197820444 X:130536202-130536224 TAGTCAGTACTGTGTTATGTTGG - Intergenic
1198843230 X:140880946-140880968 CTGTCACTGCTGAGTTACGCAGG - Intergenic