ID: 1195957432

View in Genome Browser
Species Human (GRCh38)
Location X:110346874-110346896
Sequence TTTCTTCGTAGCGGCGACGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9
Summary {0: 1, 1: 1, 2: 2, 3: 0, 4: 5}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195957428_1195957432 2 Left 1195957428 X:110346849-110346871 CCTCCAGCTGGAGCTGTTGAACC 0: 1
1: 1
2: 4
3: 12
4: 168
Right 1195957432 X:110346874-110346896 TTTCTTCGTAGCGGCGACGCTGG 0: 1
1: 1
2: 2
3: 0
4: 5
1195957427_1195957432 6 Left 1195957427 X:110346845-110346867 CCGGCCTCCAGCTGGAGCTGTTG 0: 1
1: 1
2: 2
3: 39
4: 386
Right 1195957432 X:110346874-110346896 TTTCTTCGTAGCGGCGACGCTGG 0: 1
1: 1
2: 2
3: 0
4: 5
1195957429_1195957432 -1 Left 1195957429 X:110346852-110346874 CCAGCTGGAGCTGTTGAACCACT 0: 1
1: 1
2: 2
3: 10
4: 113
Right 1195957432 X:110346874-110346896 TTTCTTCGTAGCGGCGACGCTGG 0: 1
1: 1
2: 2
3: 0
4: 5
1195957426_1195957432 7 Left 1195957426 X:110346844-110346866 CCCGGCCTCCAGCTGGAGCTGTT 0: 1
1: 0
2: 3
3: 24
4: 310
Right 1195957432 X:110346874-110346896 TTTCTTCGTAGCGGCGACGCTGG 0: 1
1: 1
2: 2
3: 0
4: 5

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195957432 Original CRISPR TTTCTTCGTAGCGGCGACGC TGG Exonic
910183013 1:84506056-84506078 TTTCTTCATAGCGGCGACGCTGG + Exonic
922929124 1:229375194-229375216 TTTCATCGTATTGGCCACGCTGG + Intergenic
1088640105 11:111864267-111864289 TTTCTTCATAGCGGCAACGCTGG - Intronic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1162930282 19:13954043-13954065 TTTCTTGGGGGCGGTGACGCTGG + Intronic
1163748836 19:19063691-19063713 TTTCTTCGTAGCCCCGCCCCTGG + Intergenic
1182043263 22:27254808-27254830 TTTCTCCTTAGCGGAGACCCTGG - Intergenic
1018678040 6:166240458-166240480 TTTCTTCATAGCTGCGACGCTGG + Intergenic
1195957432 X:110346874-110346896 TTTCTTCGTAGCGGCGACGCTGG + Exonic