ID: 1195958537

View in Genome Browser
Species Human (GRCh38)
Location X:110360810-110360832
Sequence CAGTGGGAATGGAAGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 1, 1: 0, 2: 6, 3: 76, 4: 754}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195958532_1195958537 -5 Left 1195958532 X:110360792-110360814 CCTGGACTACAATGGTAGCAGTG 0: 1
1: 0
2: 0
3: 21
4: 149
Right 1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG 0: 1
1: 0
2: 6
3: 76
4: 754
1195958529_1195958537 16 Left 1195958529 X:110360771-110360793 CCAAGTAAGACAAGGTGAGATCC 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG 0: 1
1: 0
2: 6
3: 76
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195958537 Original CRISPR CAGTGGGAATGGAAGGAAAA TGG Intronic
900010095 1:98851-98873 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900026206 1:275435-275457 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900035990 1:409288-409310 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900057614 1:645039-645061 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
901020149 1:6251265-6251287 CATTGGGGTTGGCAGGAAAACGG - Intronic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
901739536 1:11333263-11333285 CAGAGAGAATGGAAGGGCAAAGG - Intergenic
903399549 1:23030890-23030912 GGGTGGGAATGGAAGGACAGTGG + Intronic
903592292 1:24466269-24466291 CAGGTGGAATGGGAAGAAAAGGG + Intronic
903743805 1:25573533-25573555 CACAGGGAAGGGAAGGGAAATGG + Intergenic
904065346 1:27745893-27745915 GCTGGGGAATGGAAGGAAAAAGG + Intronic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904372157 1:30056121-30056143 CAGTGGGAATGGAATGGACGTGG - Intergenic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
904643939 1:31951865-31951887 GGGTGGGAAGGGAAGCAAAATGG + Intergenic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906107666 1:43304633-43304655 CAGTGCGCATGGAAGGGGAAAGG + Intronic
906553767 1:46690223-46690245 CAGTGGGAAGGGAATGGGAAAGG - Intronic
906558511 1:46735376-46735398 GAGTGGAAATGGAAGGACAAGGG + Intergenic
906905529 1:49886697-49886719 CAGTCTGTATGGAAGGAGAATGG - Intronic
906910982 1:49950400-49950422 CAGGGGGAAAGGGAGGGAAAAGG + Intronic
907113804 1:51950896-51950918 CCATGGGAATGGAAGGAAACTGG + Intronic
907115688 1:51966470-51966492 CAGTTTGGATGGAAGGAAAGGGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907252853 1:53154313-53154335 GAGTAGAAATGGAAAGAAAATGG + Intergenic
907273118 1:53302255-53302277 CAGTGCGTTTGGAAGGAAATGGG + Intronic
907355436 1:53869078-53869100 AAGTGGGCATGGAAGGTAGAGGG + Intronic
907426116 1:54380271-54380293 CATGGGGAGGGGAAGGAAAAAGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
909079873 1:71097243-71097265 CAGTGGCAGTGGAACGAAAGGGG + Intergenic
909117982 1:71564015-71564037 GCTTGGAAATGGAAGGAAAAAGG + Intronic
909362033 1:74772050-74772072 CGGTGGGTAAAGAAGGAAAAAGG + Intergenic
909772649 1:79442863-79442885 TAGAGGGTATGGAAGGAGAATGG + Intergenic
910262756 1:85307783-85307805 CAGTAGGCATGGAAGGCAAGGGG - Intergenic
910377400 1:86587527-86587549 CAATGGGAAGGGAAGGAAAATGG - Intergenic
910430839 1:87158319-87158341 GAGAGGGAAAGGAAGGAAGATGG - Intronic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
910481194 1:87660249-87660271 CAGTCATAATGGAAGGCAAAGGG + Intergenic
911321086 1:96414865-96414887 CAGTGGGAGTTGAAAGAATATGG + Intergenic
911389975 1:97229442-97229464 CAGTTAGAATGGAAGAAAGATGG + Intronic
911574307 1:99556846-99556868 CAGTAGGAAGGGAAGAAGAATGG - Intergenic
912118110 1:106432776-106432798 AAGTGGCATTGGAAAGAAAAAGG + Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
912998739 1:114558193-114558215 CAGTGAGTTTGGAAGGAAACTGG + Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913476623 1:119244535-119244557 CAGAGGGAAAAGAAGGAAAGAGG - Intergenic
914218711 1:145658012-145658034 GAGTGGGAATTGGAGGGAAATGG - Intronic
914425292 1:147570578-147570600 GAGTGGGAATGGGGGGCAAAGGG - Intronic
914471293 1:147980876-147980898 GAGTGGGAATTGGAGGGAAATGG - Intronic
914852059 1:151322120-151322142 CAGTCAGACTGGAAGGGAAATGG + Intronic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915525711 1:156475120-156475142 CAGTGGGCATGGAAGAGAAGGGG + Exonic
915909892 1:159908440-159908462 CAGTGAGAATGGGTTGAAAATGG - Intergenic
916010133 1:160697928-160697950 CTTTGGGAATGGGAAGAAAAAGG + Intronic
916446943 1:164881282-164881304 CAGAGAGAAAGGAAGGAAAGAGG + Intronic
916520327 1:165557837-165557859 CAGTGGCAATGGAAAGCAAGAGG - Intronic
916546584 1:165811479-165811501 CAGTGGTCCTGGGAGGAAAAGGG - Intronic
916825507 1:168438293-168438315 CAAGGAGAATGGAAGGCAAAGGG + Intergenic
916880666 1:169016907-169016929 CAGTGAGAATGGAAGATGAAAGG - Intergenic
916955860 1:169833789-169833811 AAGTGGGACTGGGAGGGAAAGGG + Intronic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
917878016 1:179304647-179304669 TAGGAGGAATGGAAGGAAAAAGG - Intronic
918066788 1:181106671-181106693 CCGCAGGAAGGGAAGGAAAAAGG + Intergenic
918248200 1:182679264-182679286 TGGTGGGAATGGAAGCCAAATGG - Intronic
918581462 1:186135766-186135788 CACTGGAAATGGAGGGGAAAAGG - Intronic
918833180 1:189425151-189425173 AAAAGGGAAGGGAAGGAAAAAGG - Intergenic
920710128 1:208287115-208287137 CAGTGGGAAACCAGGGAAAATGG - Intergenic
922020560 1:221700110-221700132 GAGAGGGAATGGAAGGGAGAGGG + Intergenic
922062528 1:222105955-222105977 CAGTGGGACTGGAAGCAGAGAGG - Intergenic
922095085 1:222436463-222436485 CAGAGGTAAAGGATGGAAAAGGG + Intergenic
922552335 1:226505009-226505031 CAGAGGGAAAGGAAGGAGAGAGG + Intergenic
922887684 1:229032411-229032433 CATTGGGAAAAGAAGTAAAATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923560417 1:235035979-235036001 CAAGGGCAATGGAAAGAAAATGG - Intergenic
923760740 1:236841838-236841860 CAGTGGGAATGAGAAGACAATGG - Intronic
924579608 1:245312522-245312544 CATTAGCAATGGTAGGAAAATGG + Intronic
1062822403 10:544532-544554 TAGTGGGAGGGGAAGGAAAATGG - Intronic
1062958659 10:1557090-1557112 CTGAGGCAATGGAAGGAAAGAGG - Intronic
1063225650 10:4013087-4013109 GAGGGGGAAGGGAAGGACAAAGG - Intergenic
1063369985 10:5514902-5514924 CAGTGGGAAAGGAAGGCCCAGGG + Intergenic
1063771740 10:9211483-9211505 CAATGGGAAGGGTATGAAAATGG - Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1063919110 10:10913959-10913981 AAAAGGGAAAGGAAGGAAAAAGG + Intergenic
1063961331 10:11307823-11307845 CACTGAGAAAGGCAGGAAAAAGG - Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064276290 10:13908302-13908324 GAATGGGGAGGGAAGGAAAAAGG - Intronic
1064478374 10:15715960-15715982 CAGTGGGAATGGCCTGAAAATGG - Intronic
1065068915 10:22002823-22002845 CAGGGGGACAGGAAGGCAAAAGG + Intronic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1066227683 10:33400168-33400190 GAGTGGGAAGGGAAGGGAAATGG - Intergenic
1067097898 10:43314468-43314490 CTTTGGGAATGGGAGCAAAATGG + Intergenic
1067122875 10:43489694-43489716 AAGTAGAAATGGAAGAAAAATGG + Intergenic
1067218505 10:44323709-44323731 CAGTGGTGGTGGAAGGAAAGAGG + Intergenic
1068619685 10:59167705-59167727 AACTGGGTATGGAAAGAAAATGG - Intergenic
1068643886 10:59443985-59444007 TAGTGGGAATGTGGGGAAAAGGG + Intergenic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1070170665 10:73930353-73930375 CAGTAGGGGTGGAAGGATAAAGG + Intergenic
1070279013 10:75035376-75035398 GAGTGGGAGTGGAAGGAGAGGGG - Intergenic
1070706702 10:78644843-78644865 CAGAAGGGATGGAAGGACAAAGG + Intergenic
1070707321 10:78649781-78649803 GGGAGGCAATGGAAGGAAAAAGG + Intergenic
1071077680 10:81774087-81774109 GAGCTGGAAGGGAAGGAAAAAGG + Intergenic
1072132219 10:92505824-92505846 CAGTTGGAGTGGAATGCAAATGG + Intronic
1072187233 10:93051717-93051739 CACTGGGAATTCAAGAAAAATGG - Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072904896 10:99443970-99443992 GAATAGGAATGGAAGGGAAAGGG + Intergenic
1073185573 10:101613378-101613400 CTGGGGGAAATGAAGGAAAAGGG + Intronic
1073204534 10:101761951-101761973 CAGAGGGAATGGAAAGCAAAGGG - Intergenic
1073383961 10:103106998-103107020 CTGTGGGAATGAAAGAATAAAGG - Intronic
1073628332 10:105122005-105122027 CATGTGGAAGGGAAGGAAAATGG - Intronic
1073724338 10:106212381-106212403 CAGTAGGAAATGAAGGAACAAGG + Intergenic
1074325938 10:112450833-112450855 CTGTGGGAAAGTAAGGAAAAGGG + Intronic
1074604689 10:114949741-114949763 CAGAGGGAATGGAAAGGAAGGGG + Intronic
1074984058 10:118641882-118641904 CAGTGGGGAGGGAAAGAGAAGGG - Intergenic
1075157215 10:119988368-119988390 CAGTAGGAATAGAAGGAATGGGG + Intergenic
1075366409 10:121894191-121894213 AAATGGAAATGGAAGTAAAATGG + Intronic
1075962475 10:126581245-126581267 CAAAGGAATTGGAAGGAAAAGGG + Intronic
1076066909 10:127456025-127456047 CAAGGGGGATGGAAGGAGAAAGG - Intergenic
1076623763 10:131809254-131809276 CACTGGGAATGAATGGCAAATGG - Intergenic
1078048472 11:7940267-7940289 CAGTTGGATTGGGAAGAAAATGG - Intergenic
1078056750 11:8015428-8015450 CAGTGGGAATGGAAACTAAAGGG + Intergenic
1078971961 11:16424527-16424549 TAGAGGGAATGGAAGTAAAAAGG + Intronic
1079623286 11:22582100-22582122 AAGTGGGAATGCAAACAAAAGGG - Intergenic
1079923482 11:26461139-26461161 CCGGGGGAAAGGAAGGAAAGGGG + Intronic
1079938924 11:26653410-26653432 CAGTGGAAGTGGTATGAAAAGGG - Intronic
1081720397 11:45284910-45284932 CAGTGAGAGTGGAAAGGAAATGG - Intronic
1083369178 11:62164905-62164927 CTGCGGGAATGGTAGGGAAAGGG + Intergenic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1085587896 11:77728573-77728595 GAAAGGGAAGGGAAGGAAAAAGG + Intronic
1085871149 11:80350671-80350693 CAGTTTGAATGGCAGGAAAAGGG + Intergenic
1086170647 11:83832604-83832626 GAGTGGGGAGGGAAGGAAAAGGG + Intronic
1086763911 11:90670434-90670456 CAGAGAGAATTAAAGGAAAACGG - Intergenic
1087555077 11:99708639-99708661 CAGTAGGCATCGAAGAAAAATGG - Intronic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088070226 11:105774440-105774462 AAGTGGAAATTGAAGGAATAGGG + Intronic
1088212705 11:107474209-107474231 GACAGGGAAGGGAAGGAAAAAGG - Intergenic
1088430921 11:109757862-109757884 TTGGGAGAATGGAAGGAAAATGG - Intergenic
1088656442 11:112004427-112004449 TAGTGGGGATGGAAAGGAAAAGG + Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1089119073 11:116119102-116119124 CAGGGAGAAGGGAAGGAAAGGGG - Intergenic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1089943346 11:122441943-122441965 CAGTGGGAAGGAAAAGAAAGGGG - Intergenic
1089982646 11:122785147-122785169 CAATTGGCATGGAAGGAAAAAGG + Intronic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090658618 11:128864676-128864698 GAGGGTGAGTGGAAGGAAAAGGG + Intronic
1090764253 11:129863266-129863288 CAGTGGGGGTGCAAGGAACAGGG - Intergenic
1091192391 11:133706757-133706779 GAGTGGGAAGGGAAAGAGAAAGG + Intergenic
1091204503 11:133810418-133810440 GAGTGGGGAGGGAAGGAAATGGG + Intergenic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091908051 12:4205347-4205369 CAGTGGGAGAGCAAGGACAAAGG + Intergenic
1092317390 12:7432344-7432366 CAGTATGTATGGAAAGAAAAAGG - Intronic
1092482105 12:8869016-8869038 CTGTGGAAAAGGTAGGAAAAGGG - Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093119032 12:15245085-15245107 GAGAGGGAAGGGAAGGGAAAAGG + Intronic
1093233974 12:16583703-16583725 CTGTAGGAATGGATTGAAAAAGG + Intronic
1093988793 12:25567691-25567713 CAGTGAGAGTGGAAGCAAGATGG - Intronic
1094313646 12:29114132-29114154 TAGTGGGAATAGAAAGAAAAGGG + Intergenic
1096103629 12:48984088-48984110 CAGGTGGAAAGGAAGGGAAAGGG - Intergenic
1096253366 12:50047835-50047857 CAGTGGCAATGGAAATAAAAAGG - Intergenic
1096297678 12:50397641-50397663 CAGTGGGGAAGGAAGGAACCAGG - Intronic
1096342914 12:50817554-50817576 CATTGGGCATATAAGGAAAAGGG + Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096869693 12:54585552-54585574 CAGTGGGGAGGGAAGGCAAATGG + Intronic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097210029 12:57360657-57360679 AAGAGGAAAGGGAAGGAAAAAGG + Intronic
1097242912 12:57588472-57588494 ATGTGGGGATTGAAGGAAAAGGG - Intergenic
1097922889 12:65095694-65095716 CAGTTGTAATAGAAGGAAATAGG + Intronic
1098600315 12:72323737-72323759 CTGTGGGAATTGAAGGTCAAAGG + Intronic
1098880613 12:75913687-75913709 GGGAGGGAGTGGAAGGAAAAAGG - Intergenic
1100722033 12:97369341-97369363 CAGGGGGAAAGGATGGAAAAGGG + Intergenic
1100725112 12:97400348-97400370 CAGTGCGAATGGAAGGACCCAGG - Intergenic
1101523047 12:105502669-105502691 CCGTGGGAGTGGCAGGAAATGGG + Intergenic
1101546964 12:105722930-105722952 CAGGGGCAATGGGAGGAAACTGG + Intergenic
1102099399 12:110266842-110266864 CAGTGGGGAGGGAAGGTAAAGGG - Intergenic
1102241632 12:111328177-111328199 CACTGGGCCTGGAAGCAAAAGGG + Intronic
1102572387 12:113834966-113834988 CAGAGGGAAAGGAAAGAAAGAGG - Intronic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1103073917 12:117967326-117967348 CAGTGGGACTGTGAGGAAAGAGG - Intronic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1104624668 12:130341226-130341248 CAGTGGGACTGGAAAGAGAAGGG - Intronic
1107051674 13:36057268-36057290 CATTTTGAAGGGAAGGAAAAGGG - Intronic
1107911898 13:45113108-45113130 CAGAGGGAAGGCAAGGAGAAAGG + Intergenic
1108078508 13:46708185-46708207 GAATGGGTATGGAAGGAATAAGG + Intronic
1108671044 13:52689065-52689087 CAGGGGGAGTGGGAGGCAAACGG + Intronic
1110139219 13:72106515-72106537 CAGTGGTAATTGAAAGATAATGG + Intergenic
1110249645 13:73367014-73367036 CTCTGGGAATGGAAGGTTAAGGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111585878 13:90284305-90284327 GAGTGGGCAGAGAAGGAAAAAGG + Intergenic
1111670384 13:91322206-91322228 CAGTGCAAGTGGAAAGAAAAAGG + Intergenic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1111927867 13:94482379-94482401 CAGAGGGAATGGCAAGACAAAGG - Intergenic
1112111928 13:96310684-96310706 GAGTGGGAAGGGAAGGAGATAGG - Intronic
1112211225 13:97379702-97379724 AAGAAGGAATGGAAGGAGAAAGG + Intronic
1112292862 13:98160342-98160364 CAGTAGCAATGCAAGGAAAGGGG - Intronic
1112378892 13:98869841-98869863 CAGTGGCACAGGAAGGAACAAGG - Intronic
1112629201 13:101141739-101141761 CTGTGGGAAGGGAAAGAAAGCGG + Intronic
1113433884 13:110273919-110273941 TAGTGAGAAAGGAAGGGAAATGG - Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113735948 13:112679208-112679230 GATTGGGAATGGAAGAAGAAAGG - Exonic
1114683709 14:24507919-24507941 CAGAGCAAGTGGAAGGAAAAGGG - Intronic
1114760659 14:25310155-25310177 CAGGGGGAAAGGTAGGAAAAGGG + Intergenic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1114887287 14:26869486-26869508 CAGTCACAATGGAAGGAAACTGG + Intergenic
1114945120 14:27671758-27671780 CAGTAGGAATAGGAGGAAATAGG - Intergenic
1115097615 14:29656907-29656929 CAATGGGAAAAGAAAGAAAAAGG + Intronic
1115466941 14:33725700-33725722 CAGTGGCAATGAAAGGCAACAGG - Intronic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1115785250 14:36818207-36818229 CAGAGACAATGGAAGGGAAAGGG + Intronic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1116213257 14:41975326-41975348 CAGCAGGAATGCAAGCAAAAGGG - Intergenic
1116785293 14:49281288-49281310 CAGTAGGGAGGAAAGGAAAAGGG + Intergenic
1117000520 14:51366422-51366444 CCCTGTGCATGGAAGGAAAAAGG + Intergenic
1117447551 14:55819096-55819118 CAGTGGGAATGCACGAAAGAAGG + Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1117610693 14:57479971-57479993 TACTGGGAATGGAAGAGAAAGGG + Intronic
1117764331 14:59064796-59064818 AAGGGGGAAAGGAAGGAAGAAGG + Intergenic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1117870279 14:60193433-60193455 CAGTGAGGATGTAGGGAAAATGG - Intergenic
1118254741 14:64195833-64195855 CAGTGGGACTGGAAGGATTTAGG + Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1118589083 14:67387615-67387637 GACAGGGAATGGGAGGAAAAGGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119192872 14:72695696-72695718 AAGGGGGAAGGGAAGGAAGAGGG + Intronic
1119673780 14:76539023-76539045 GAAAGGGAAGGGAAGGAAAAGGG - Intergenic
1120084820 14:80260074-80260096 CCATGGGAATGAAAAGAAAAAGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121638186 14:95467741-95467763 CAGTGGGCAAGGAGGGTAAATGG + Intronic
1121640770 14:95483418-95483440 CAGTGGGAAAGAGAGGATAAGGG - Intergenic
1121832681 14:97065744-97065766 CAGTAGGCAGAGAAGGAAAAGGG + Intergenic
1121967278 14:98322136-98322158 GAGAGGAAATGGAAGGAAAAGGG - Intergenic
1121989802 14:98545112-98545134 CAGTGGGAGTCTAAGAAAAAAGG + Intergenic
1122067411 14:99183507-99183529 AAGTGGGTCTGGAAGGAACATGG - Intronic
1122251647 14:100444210-100444232 CCGTGAAAATGGAAGGAAATTGG + Intronic
1122704828 14:103614163-103614185 GGGAGGGAAGGGAAGGAAAAAGG - Intronic
1122870491 14:104635983-104636005 CAGTTGGAATGGAAGGAGGCGGG - Intergenic
1123498424 15:20855178-20855200 CAGTGTGAATCAAAGCAAAATGG - Intronic
1123555658 15:21428806-21428828 CAGTGTGAATCAAAGCAAAATGG - Intronic
1123591901 15:21866137-21866159 CAGTGTGAATCAAAGCAAAATGG - Intergenic
1123678642 15:22739478-22739500 AAGGGGGAAGGGAAGGAGAAAGG - Intergenic
1123692282 15:22848240-22848262 AAGTGAAAATGCAAGGAAAATGG - Intronic
1125495126 15:40186118-40186140 TAGTGGTAATGAAAGGAGAAGGG + Intronic
1125602777 15:40924628-40924650 CAGAAGGAAATGAAGGAAAAAGG - Intergenic
1126287690 15:47032919-47032941 CAGTGAGAATGTAGAGAAAAGGG - Intergenic
1126316441 15:47374842-47374864 GAGTGGGAAAGGTAAGAAAATGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126511735 15:49483856-49483878 CAATGGTAATGGAAGATAAAAGG - Intronic
1126832913 15:52627212-52627234 AAGAGGGAAGGGAAGGAGAAGGG + Intronic
1127267555 15:57374193-57374215 AAAGGGGAAGGGAAGGAAAAAGG - Intergenic
1127309499 15:57739809-57739831 AAGAGGGAAAGGAAGCAAAATGG - Intronic
1127337165 15:57999586-57999608 CAGTGGGAATGTAAACAAAGTGG - Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128607999 15:69051823-69051845 AAACAGGAATGGAAGGAAAAAGG - Intronic
1128881722 15:71249886-71249908 CAGCAGGAGTGGAAGGAAAGGGG - Intronic
1129386573 15:75199621-75199643 CCCTGGGAATGCAAGGTAAAAGG - Intronic
1129403575 15:75300379-75300401 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1130473989 15:84247668-84247690 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1130481402 15:84361736-84361758 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1132082343 15:98877456-98877478 CATTGGGAAAGAAAGAAAAATGG + Intronic
1202964000 15_KI270727v1_random:156016-156038 CAGTGTGAATCAAAGCAAAATGG - Intergenic
1132715219 16:1286675-1286697 CAGTGTGGTTGGAAGGAAAGCGG + Intergenic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135527480 16:23225112-23225134 AAATGTGAATGGAAGGAAAATGG - Intergenic
1136128229 16:28200952-28200974 TAATGGGAAGGGAAGGAAATGGG - Intronic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136281378 16:29213427-29213449 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1137608178 16:49800867-49800889 AACAGGGAAGGGAAGGAAAAAGG + Intronic
1138158705 16:54731905-54731927 CTGTGGCAATGGGATGAAAAAGG - Intergenic
1138200072 16:55081916-55081938 CAGAGGGAAGGGAAGGGAAGGGG - Intergenic
1138242123 16:55435739-55435761 CATGAGAAATGGAAGGAAAAGGG - Intronic
1138753873 16:59458444-59458466 CTTTTGGAATGGAAGGAAAAAGG - Intergenic
1139413895 16:66790229-66790251 AAAAGGGAAGGGAAGGAAAAAGG + Intronic
1139413900 16:66790246-66790268 AAAAGGGAAGGGAAGGAAAAAGG + Intronic
1139435410 16:66934065-66934087 ATGTGGGAAGTGAAGGAAAAGGG + Exonic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1139907673 16:70377966-70377988 CTATGGGAAAGGAATGAAAAAGG + Exonic
1140126609 16:72123525-72123547 AAGTGAGTATGGGAGGAAAAAGG - Exonic
1140137552 16:72220977-72220999 CAGCAGGAAAGGAAGGGAAAGGG - Intergenic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140270397 16:73460107-73460129 GAGTGGGAATGGGAGGGAAGGGG - Intergenic
1140828728 16:78731516-78731538 AAGAAGGAATGAAAGGAAAAAGG - Intronic
1140960297 16:79905475-79905497 GAGTCAGAAGGGAAGGAAAAAGG - Intergenic
1141287795 16:82688829-82688851 GATTGAGAATGGAAAGAAAAGGG + Intronic
1141451469 16:84106474-84106496 CAGTGGGAAAGCAAGTGAAAAGG + Intronic
1141701183 16:85642844-85642866 CAGCGAGCATGGAAGGAAAGGGG - Intronic
1141814954 16:86403561-86403583 CAGTGGTGGTGGAAGGCAAAAGG + Intergenic
1142085748 16:88179355-88179377 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144796343 17:17893814-17893836 ATGTGGGGAGGGAAGGAAAAGGG + Intronic
1145888783 17:28400328-28400350 AAATGGGAATGGAGGGAAATAGG + Exonic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1145992133 17:29085647-29085669 AACTGGAAATAGAAGGAAAATGG + Exonic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1146561759 17:33876210-33876232 CAGTGAGAATGAAATGAAACAGG + Intronic
1147016609 17:37497058-37497080 CAGTGGGAAGGGAAGAGAAATGG - Intronic
1147189568 17:38730674-38730696 CAGTGGAAAGGGAAGGACACGGG - Intronic
1147483853 17:40793722-40793744 CAGTGGGAATGAAAAAGAAAAGG + Intronic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1147703698 17:42411843-42411865 CAGTGGGGATGGGAGGGGAATGG - Intronic
1148029374 17:44608969-44608991 CAGTGGGAAGGGGTGGCAAAGGG + Intergenic
1148552435 17:48558537-48558559 CTCTGAGAATGGAAGAAAAAAGG - Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149333716 17:55612440-55612462 CATTGTGAATGGAATCAAAAAGG - Intergenic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1149520436 17:57314491-57314513 CAGTGGCAAGAGATGGAAAAGGG + Intronic
1149596473 17:57867462-57867484 CAGTGGGACTGGGAGGACTAGGG - Intronic
1150439408 17:65179189-65179211 AAGTGGGAGGGGAAAGAAAAAGG + Intronic
1151226111 17:72649391-72649413 CAGTAGGAGAGGAAGGAGAAAGG + Intronic
1151251459 17:72838928-72838950 CAGTGGGGATGGCAGGGAATGGG - Intronic
1151286113 17:73112553-73112575 TAGTGGGAGTGGAAGGCACAGGG - Intergenic
1151664161 17:75535907-75535929 CAGTGAGGAGGGAAGGAAACAGG + Intronic
1151711057 17:75806911-75806933 CAGTGGGAATGGAAGTGAAGAGG + Intronic
1152243628 17:79173688-79173710 CAGGGGGCCTGGGAGGAAAATGG + Intronic
1152511414 17:80792026-80792048 CAATGGGACTGGAAGGATTATGG - Intronic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1153030771 18:711421-711443 CAGTAGGGAGGGAAGGAAATGGG - Intronic
1153530433 18:6040803-6040825 CCATGGGAATGGCAGGATAAGGG - Intronic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1154456430 18:14531603-14531625 CAGTGTGAATCAAAGCAAAATGG - Intronic
1155156092 18:23158889-23158911 CAGAAGGAAAGGAAGGGAAATGG - Intronic
1155320524 18:24614324-24614346 CAGTGTGAAAGGAAGGGATATGG + Intergenic
1155598826 18:27519253-27519275 CAGTGGGGTTTTAAGGAAAAAGG - Intergenic
1155869608 18:31009498-31009520 TAGTGGGCATGGATGGATAAAGG - Intronic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156696311 18:39772580-39772602 CAATGGGAAAGAAAGGGAAAGGG - Intergenic
1156794222 18:41022503-41022525 CAGTGGGAAGGGAATCAAAACGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157781376 18:50442588-50442610 TAATGGGAATGGGAGGTAAATGG + Intergenic
1157994234 18:52535999-52536021 CACTGAGAATGGAAGAAAAGTGG + Intronic
1158304985 18:56095414-56095436 CAGTGGGAAGGGACAGATAAAGG + Intergenic
1158339916 18:56454808-56454830 GAGAGGGAAAGGAAGGAAGAAGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158716984 18:59889314-59889336 CAGCGAGAATAGATGGAAAAAGG + Intergenic
1159024253 18:63168170-63168192 CATTGGCAATGGATGGAACAAGG - Intronic
1159084218 18:63769969-63769991 CAGTGTGAGTGGAAGGGGAAGGG + Intronic
1159214352 18:65371256-65371278 CAACGGGAAAGGAAGCAAAAGGG + Intergenic
1159561006 18:69994739-69994761 CATTGGTAAGGGAAGGACAAAGG - Intergenic
1160305566 18:77732155-77732177 AACTGGAAATCGAAGGAAAATGG + Intergenic
1160421471 18:78750022-78750044 AAGTGGGTATGGAATTAAAAAGG - Intergenic
1160598091 18:79991277-79991299 CTGAGGGAATGGGAGGGAAATGG - Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1164115749 19:22217146-22217168 CAGTGGGAAGGGTAGGAGAGGGG - Intergenic
1164858259 19:31542153-31542175 CAGTGAGAAAGGGAGGAGAAGGG + Intergenic
1165400399 19:35596079-35596101 AAGAGGGAAGGGAAGGGAAAGGG + Intergenic
1166265138 19:41676882-41676904 TAGTGGTAAAGGAAGTAAAAAGG + Intronic
925709979 2:6729486-6729508 GAATGGGAATGCAAGGAAATGGG + Intergenic
926014622 2:9438832-9438854 AAGGGAGAATTGAAGGAAAAAGG - Intronic
926171146 2:10553222-10553244 CCTTGGGAATGGAAGGAACAGGG + Intergenic
927211964 2:20644615-20644637 CACTTGGTATGGAAGGGAAAGGG - Intronic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927644633 2:24869845-24869867 CACATGGAAAGGAAGGAAAATGG + Intronic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928216153 2:29363062-29363084 CAAAGGGAAGGGAAGGAAAATGG - Intronic
928969744 2:37015442-37015464 AACTGGGAATGGAATAAAAAAGG + Intronic
929633782 2:43494330-43494352 CAGCAGGAATGAAAGAAAAAGGG - Intronic
930151508 2:48064850-48064872 CATTGGCAATGGAAAGAAAATGG - Intergenic
930217228 2:48709225-48709247 AGGGGGGAATGGAAGAAAAAAGG - Intronic
930857618 2:56035866-56035888 CATTGGTATTGGAAGGAAATTGG + Intergenic
931174072 2:59835313-59835335 AAGGGGGAAGGGAAGGAAGAAGG - Intergenic
931241662 2:60459747-60459769 CAATTGGAAAGGAAGAAAAAAGG - Exonic
931332472 2:61301952-61301974 GAGAGGGAAGGAAAGGAAAAAGG + Intronic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932186412 2:69700010-69700032 CAGAGAGAATGGAAGGAGAGAGG + Intronic
932449480 2:71800407-71800429 CAGTGGAAAAGGAAGAGAAAAGG - Intergenic
933174602 2:79160930-79160952 CAGTAAGAATGCAATGAAAAGGG - Intergenic
933213298 2:79596538-79596560 CAATGACAGTGGAAGGAAAAGGG + Intronic
933549559 2:83758765-83758787 CAGTGGGAATGAATGGGGAAAGG - Intergenic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
934958181 2:98642283-98642305 CAGTGGCAATGGAAGGACTCTGG + Intronic
934987795 2:98900150-98900172 CAGTGGGAAGGGGAGGCAGATGG + Intronic
935458747 2:103302410-103302432 GAGAGTGAAAGGAAGGAAAAAGG + Intergenic
935708448 2:105876791-105876813 CAGAGAGAATGAAAGGAAACTGG + Intronic
936534096 2:113298090-113298112 CTGTGGGAAAGGAAGGAATGGGG - Intergenic
936905860 2:117534914-117534936 CAGTCGCAGTGGAAGGCAAAGGG - Intergenic
936946963 2:117939829-117939851 AAGTGGGAATTGTAGGATAATGG + Intronic
937081633 2:119144564-119144586 CAGTGGGCAGGGAAGAAACAAGG + Intergenic
937139008 2:119582202-119582224 CCATGGGAATGGAAGGAGAATGG + Intronic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937259872 2:120578424-120578446 CGGAGGGAATGGGATGAAAATGG + Intergenic
937409962 2:121665911-121665933 CAGTGGGGAGGGAAGAAAATGGG - Intergenic
938270262 2:129964024-129964046 CATTGGGAATGGGGAGAAAAAGG - Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938818909 2:134933527-134933549 AAGTAGGAATGGAAACAAAAAGG + Intronic
939185641 2:138857439-138857461 CAGTAGTAATGGCAGAAAAATGG - Intergenic
939266137 2:139875402-139875424 CAAGGTGAATGCAAGGAAAATGG + Intergenic
939820115 2:146947156-146947178 CAGTGTTCATGGAAGCAAAATGG + Intergenic
940122596 2:150283350-150283372 GTGTGGGAATGGAAGGGCAATGG - Intergenic
940518435 2:154712295-154712317 CATTGTGAATGAAAGGATAAAGG - Intronic
940599701 2:155843195-155843217 AAGTGAGAAAGGAAGGAAGATGG - Intergenic
941589659 2:167403801-167403823 GAAAGGGAAGGGAAGGAAAAGGG + Intergenic
941693144 2:168522642-168522664 CAGTGGGAGGGGAATGAAACTGG - Intronic
942229017 2:173842382-173842404 CAGTGCTACTGAAAGGAAAAGGG + Intergenic
942386585 2:175449725-175449747 CAGTAGGAAAGTAAGGAAACAGG + Intergenic
943235629 2:185315311-185315333 CAGTGAAAATGATAGGAAAATGG - Intergenic
943512070 2:188838630-188838652 AAGTGAGAAAGAAAGGAAAAAGG + Intergenic
943683424 2:190791812-190791834 CAGTGGGAAAGGAAGGACGGGGG - Intergenic
943826170 2:192396351-192396373 AAGGAAGAATGGAAGGAAAAAGG - Intergenic
943976463 2:194484722-194484744 CTGAGAAAATGGAAGGAAAAAGG - Intergenic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
944961217 2:204876150-204876172 CAATGGAAACGGAAGTAAAAAGG + Intronic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
945437397 2:209835132-209835154 CATTGGGAATGAAATGTAAAGGG - Intronic
945456170 2:210054792-210054814 AAGGGGGAAAGGAAGGGAAATGG + Intronic
945718358 2:213386407-213386429 GAGTGAGAATTAAAGGAAAATGG - Intronic
946422677 2:219573547-219573569 AAGTGGGAAAGGGAAGAAAATGG - Intronic
946924038 2:224608486-224608508 CAGTGAGAGAGGGAGGAAAAAGG + Intergenic
947022730 2:225699375-225699397 CTGTGACAATGGAAGGAACAAGG + Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947304876 2:228734467-228734489 TAGGGGGAATGGAGGGGAAATGG - Intergenic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
947494615 2:230625775-230625797 AAAAGGGAAGGGAAGGAAAAGGG + Intergenic
947815184 2:233032079-233032101 CAGTGGGAAAGGAAGAGACAGGG - Intergenic
948021332 2:234736222-234736244 CAGAGGGCATGTTAGGAAAATGG - Intergenic
948061504 2:235045921-235045943 CAGGGAGATGGGAAGGAAAAAGG + Intronic
949085694 2:242152708-242152730 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1169178650 20:3542618-3542640 GAAGGGGAAGGGAAGGAAAAGGG - Intronic
1169573611 20:6933006-6933028 CAAAGGGAATTGAATGAAAAGGG + Intergenic
1169589767 20:7127506-7127528 AGGTGTGATTGGAAGGAAAATGG + Intergenic
1169705821 20:8503544-8503566 TAATAGGAAGGGAAGGAAAAAGG - Intronic
1169773479 20:9226632-9226654 CTATAGGAAAGGAAGGAAAATGG - Intronic
1169910254 20:10642356-10642378 CAGTGGGACTACAAGGGAAAGGG - Intronic
1170084182 20:12510677-12510699 CAGTGGGACTTGGTGGAAAATGG + Intergenic
1170455922 20:16532637-16532659 CTGTGGGAATGGGAGGAATCTGG - Intronic
1170698970 20:18686008-18686030 CACTGGGAAGGGAAGTAAGAAGG - Intronic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171095963 20:22332494-22332516 GGGTTGAAATGGAAGGAAAATGG - Intergenic
1171118881 20:22550941-22550963 CAGTGGGGAGGGAAGGTGAAGGG - Intergenic
1172369442 20:34376828-34376850 CAGTGGGAATGAAAATAAAGGGG + Intronic
1172590781 20:36116457-36116479 CAGGAGGAAAGGAAGGAAATGGG - Intronic
1172600271 20:36178352-36178374 CAATGGGACTGGCAGGAAGAAGG - Intronic
1172944681 20:38677997-38678019 CAGTGGAAATGGAAGAAAAGAGG + Intergenic
1172970609 20:38870644-38870666 CAGTGGGAAGGGAAGGGACAGGG + Intronic
1173857164 20:46257892-46257914 CAGAGAGAAGGGGAGGAAAAGGG + Intronic
1174088321 20:48026374-48026396 CAAAGGGAAGGGAAGGAAAGGGG - Intergenic
1174383202 20:50170905-50170927 CAGAGGGAACGAAAGGAAGAGGG + Intergenic
1174506709 20:51022243-51022265 CCGGAGGTATGGAAGGAAAAGGG - Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174760913 20:53206673-53206695 CAGTGTGAAAGGTAGAAAAATGG - Intronic
1175153585 20:56954448-56954470 CAGTGAGAATGGAAGTGAAGTGG - Intergenic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1175727699 20:61331160-61331182 CACTGGGCATGGAAGGAGATGGG - Intronic
1176793556 21:13349995-13350017 CAATGGTAATGGAAGATAAAAGG - Intergenic
1176817735 21:13621734-13621756 CAGTGTGAATCAAAGCAAAATGG + Intronic
1177010681 21:15727641-15727663 GAGAGGGAAGGAAAGGAAAAGGG + Intergenic
1177927899 21:27241890-27241912 GATTGGGAATTAAAGGAAAAAGG + Intergenic
1178357879 21:31923593-31923615 GGGAGGGAAGGGAAGGAAAAGGG + Intronic
1178689322 21:34738265-34738287 AAGTGGGAAAGGCAGGAAGAAGG - Intergenic
1179172864 21:38986251-38986273 CAAGGAGAATGGAAGGCAAAAGG + Intergenic
1179215880 21:39366851-39366873 AAGGGGGAAGGGAAGGAAAAAGG - Intergenic
1179370770 21:40804394-40804416 CAATGGCAATGGAAAGAACAAGG - Intronic
1179382651 21:40913866-40913888 GAGTGGGAATGAGAGGAGAAAGG - Intergenic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1181380319 22:22497160-22497182 TAGGAGGAAGGGAAGGAAAAGGG - Intronic
1182126097 22:27816878-27816900 GGGAGGGAAGGGAAGGAAAAGGG - Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184144353 22:42600183-42600205 CAGTGAAAATGACAGGAAAATGG + Intronic
949203020 3:1403358-1403380 CAATGACAATGGAAAGAAAATGG - Exonic
949310665 3:2694216-2694238 AAGTGGGAATGGTAGGAGCAAGG - Intronic
949456947 3:4249006-4249028 CAGTGAGAAGTGAAGGAGAAGGG - Intronic
949701013 3:6757907-6757929 CAATGTGAATGGAATGACAACGG + Intergenic
949789740 3:7779939-7779961 TGGTGAGAATGGAAGGAAAAAGG - Intergenic
949903280 3:8837646-8837668 CAGAGGGAGTGAGAGGAAAATGG + Intronic
949926428 3:9045957-9045979 CAGTGAGAATGGAGGAGAAAGGG - Intronic
950175659 3:10872390-10872412 AAATGGGGATGGAAGGAAGACGG - Intronic
950237876 3:11339507-11339529 CAGTGGGAATTCAATGAGAAAGG + Intronic
950448665 3:13053517-13053539 GAGACGGAATGGGAGGAAAAGGG + Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
951426582 3:22553076-22553098 CTGTGGGAAGGGAAGGCAAGGGG + Intergenic
952038250 3:29230667-29230689 GAGAGGAAAGGGAAGGAAAAAGG - Intergenic
952127696 3:30321128-30321150 AAGAGGCAATGGAAGGAAAATGG + Intergenic
952489265 3:33850893-33850915 AAGGGGGAAGGGAAGGAGAAAGG - Intronic
952506573 3:34011999-34012021 AACTGGAAATGGAAGGAATAAGG - Intergenic
953241009 3:41149538-41149560 CAGTGGGAATGAAAAGATAGGGG + Intergenic
953352333 3:42224667-42224689 CAATAGGACTGAAAGGAAAAAGG + Exonic
953397811 3:42586991-42587013 AAGTGGGGAGGGAAAGAAAAGGG - Intronic
953446463 3:42972976-42972998 CAGGGGGAAGGGGAGTAAAAAGG + Intronic
953569416 3:44059231-44059253 CAGTGAGATTGGAAGGAGAAGGG + Intergenic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954407407 3:50353115-50353137 CAGTGGGGAGAGAAAGAAAAAGG + Intronic
954849519 3:53588517-53588539 CAGAGGTTATGGAAGGAAATTGG + Intronic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
955789537 3:62574078-62574100 CAGTGGGGATGGAATGAGATGGG - Intronic
955907844 3:63826367-63826389 CAGTGGGAATGGGGAGATAAAGG + Intronic
955924087 3:63988941-63988963 CAGAGGGAAGGGAAAGAGAAAGG + Intronic
956267089 3:67408873-67408895 CAGAGGGAGTGGAACGAACATGG - Intronic
956443752 3:69305985-69306007 CAGTGGGAAAGTAATCAAAAGGG + Intronic
956890468 3:73608123-73608145 CAGTGGGAAGAGAAAGCAAAGGG + Intronic
957021715 3:75135577-75135599 CAGTGGGCATGGAAAGAACGTGG - Intergenic
957677616 3:83390482-83390504 CATTGGAATTGGAAAGAAAAGGG - Intergenic
958150425 3:89686106-89686128 AAATGTGCATGGAAGGAAAATGG - Intergenic
959107148 3:102077436-102077458 CAGTGGTCATGGAAAGAAATGGG + Intergenic
959492750 3:107011224-107011246 CAGTGAGAATGTATAGAAAATGG + Intergenic
959932934 3:112002615-112002637 CAGTGTGAATGGAAGGGACCCGG + Intronic
960444303 3:117729255-117729277 GAGTGTGAAAGGGAGGAAAAGGG - Intergenic
960737716 3:120798907-120798929 CAGAGGGAATGTGGGGAAAAGGG - Intergenic
960975474 3:123169742-123169764 CAGTGAGAGTGGAAGACAAAGGG + Intronic
961319489 3:126063111-126063133 CAGTGGGAATGGAGGGTCACAGG - Intronic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
961681740 3:128604162-128604184 CACTGGGAAAGGAAGGACAGAGG + Intergenic
961713359 3:128843439-128843461 CAGTGGGAACCCCAGGAAAAAGG + Intergenic
961977066 3:131036871-131036893 CAGTGTGAATGGCACTAAAATGG + Intronic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962462780 3:135630072-135630094 GAGTGGGAATGGAAGCAGATGGG - Intergenic
963117174 3:141739971-141739993 CAGTGGCAGTGGCAGGAACAAGG - Intronic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963512501 3:146266009-146266031 CTGTGTGAATATAAGGAAAATGG + Intergenic
963928394 3:150976250-150976272 CAGAGAGACTGCAAGGAAAATGG - Intergenic
964024705 3:152058324-152058346 CAGTGGGAACAGAAGGGCAAGGG - Intergenic
964252559 3:154735471-154735493 CATTAGAAATGGAAGGAATAAGG + Intergenic
964455791 3:156864531-156864553 CAGTAAGAATGGCAAGAAAAGGG - Intronic
964886763 3:161492438-161492460 CAGTGGGACAGGGAGGAAAAGGG - Intergenic
964939798 3:162143901-162143923 AAGTGGGAGAGGAAGGCAAATGG - Intergenic
965327730 3:167328629-167328651 CAGGGTGAATGAAAGGAGAATGG - Intronic
965422395 3:168478023-168478045 TAGTGATAATGGAAGGAACATGG + Intergenic
965703338 3:171480932-171480954 CATCAGGAAGGGAAGGAAAAGGG - Intergenic
965920386 3:173906278-173906300 CAGTGGGACAGGGAGGAGAAAGG - Intronic
966403040 3:179565978-179566000 CAGTGGCAATGGTATTAAAAAGG + Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966569147 3:181421640-181421662 TAGAGGGAATGGAATAAAAATGG - Intergenic
966951970 3:184828598-184828620 CAGTTTCAATGGAAGGAAATAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967595761 3:191325447-191325469 CAGTAGGAAAAGAAGGGAAAGGG + Intronic
967652573 3:192004658-192004680 CAATGAGAATGCAAAGAAAATGG - Intergenic
968298145 3:197593055-197593077 CAGAGGGCAGGGAAGGAGAAGGG + Intergenic
968819362 4:2837922-2837944 CAGTGAGAATGGCTGGAAGATGG - Exonic
968963335 4:3756730-3756752 CACTGGGGATGGCAGGGAAAAGG + Intergenic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
969360496 4:6660360-6660382 CACTGGGACTGGGAGGAAGAAGG + Intergenic
969449152 4:7263268-7263290 CTGGTGTAATGGAAGGAAAATGG + Intronic
970718529 4:18957782-18957804 TAGTGGGCCTGGAAGGAAAATGG - Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
970851782 4:20612431-20612453 CAGTGGGACTGGGATGAAAGTGG - Intronic
971168041 4:24204476-24204498 GAGGAGGAAAGGAAGGAAAAGGG + Intergenic
971455265 4:26838118-26838140 CAGAGGAAATGGATGGGAAAGGG - Intergenic
972054746 4:34785464-34785486 CATTAGGAATGAAAGTAAAATGG + Intergenic
972130557 4:35827907-35827929 CAATGGGACTGGAAAGAGAAAGG - Intergenic
972638291 4:40903579-40903601 CAGGGGGAATTAAAGGAGAAGGG + Intronic
972703865 4:41521069-41521091 AGGTGGGAATAAAAGGAAAATGG - Intronic
972969333 4:44553110-44553132 GAGTGGGAATTGTAGCAAAAAGG - Intergenic
973029939 4:45324997-45325019 CACTCAGGATGGAAGGAAAAGGG - Intergenic
973835547 4:54805914-54805936 CAGGGGGAATGGCTGGGAAAGGG + Intergenic
974191770 4:58513755-58513777 TACTGGGGATGGAAGGAAAGAGG - Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974566570 4:63584364-63584386 CAGTAATAATGGAAGGCAAAGGG - Intergenic
974882410 4:67775894-67775916 GAGTGGGAAGAAAAGGAAAAGGG - Intergenic
976593192 4:86869816-86869838 CAGCAAGAATGGAGGGAAAAAGG - Intergenic
976744745 4:88391940-88391962 GAGTGGGGAGGGGAGGAAAAGGG - Intronic
977320425 4:95507973-95507995 CAAGAGGAATGGAAAGAAAAGGG - Intronic
977356195 4:95950338-95950360 CAGTGGAAATGGAAAGATACGGG + Intergenic
978136331 4:105265814-105265836 CAGAGAGAAAGGAAGTAAAAAGG + Intronic
978490186 4:109303338-109303360 CAGTGGGAAGAGAAGGGAAGTGG - Intergenic
978711947 4:111793594-111793616 CTGTGGGAATGGAAGAACAGAGG - Intergenic
978714152 4:111821793-111821815 GTGTGGGAGTGAAAGGAAAAGGG - Intergenic
978978790 4:114915841-114915863 GAGAGGGAAGGGAAGGAAGAGGG + Intronic
979744136 4:124188755-124188777 CTGTGGAATTGAAAGGAAAATGG - Intergenic
979894055 4:126135504-126135526 CAGTTATAATGGAAGGCAAAGGG - Intergenic
980167440 4:129246247-129246269 CAGAGGGAATGACAAGAAAAAGG - Intergenic
981027182 4:140088461-140088483 CAGTGGGAATGGAAAGGAAGAGG - Intronic
981086482 4:140689496-140689518 AAGGGGGAAGGGAAGGAAAGGGG - Intronic
981086491 4:140689515-140689537 AAGGGGGAATGGAAGGGAAAAGG - Intronic
981218094 4:142195714-142195736 CAATAAGAAGGGAAGGAAAAGGG + Intronic
981247624 4:142558335-142558357 CAATGGGAATGTAAGGAATTGGG - Intronic
982104123 4:151997100-151997122 CATTGGGAATGGAAAGAGGAAGG + Intergenic
982233900 4:153234277-153234299 CAGTGTGACTGCAAGGATAAAGG - Intronic
982364628 4:154562151-154562173 TTGTGGGAAATGAAGGAAAATGG + Intergenic
983077151 4:163340071-163340093 AAGTGGAAATGAAAGGGAAACGG - Intronic
983101423 4:163630875-163630897 CAGAAGAAATGCAAGGAAAAAGG + Intronic
983539332 4:168891608-168891630 AAGTGGGAAAGAAAGGAAGAAGG + Intronic
984230791 4:177096352-177096374 CAGTGAGAATGCAAGGACAATGG + Intergenic
984531727 4:180924243-180924265 CACTGGGAAAGGAAGGAGAGAGG - Intergenic
984646273 4:182223948-182223970 CAGAGGCAATGGAAGAAAGATGG + Intronic
984911389 4:184676816-184676838 AAGGGGGAAGGGAAGGGAAAAGG - Intronic
985168536 4:187123844-187123866 GAGTGACAAGGGAAGGAAAAAGG - Intergenic
985208959 4:187571776-187571798 CAATGGTAATGGAAAGAAAGAGG + Intergenic
985323597 4:188741796-188741818 CAGTGGTAATGGAATTGAAAAGG - Intergenic
986251483 5:6062186-6062208 AGGTGGGCATGGAAGGAAAGGGG - Intergenic
986405451 5:7420454-7420476 CACTGGGAAAATAAGGAAAATGG + Intronic
986419763 5:7567419-7567441 CATTGGTAATTAAAGGAAAAAGG - Intronic
986621384 5:9679199-9679221 CAGGGGGAAAGGAAGGATAATGG + Intronic
986765279 5:10920138-10920160 CAGGGAGAATGGAAGAAAAGTGG + Intergenic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987012309 5:13780030-13780052 AAGTGGGAATGGAAGAGAAATGG - Intronic
988561252 5:32283607-32283629 AAGAAGGAATGAAAGGAAAAAGG + Intronic
990660920 5:58014346-58014368 GAGTGAGAATGTAATGAAAAGGG - Intergenic
990952585 5:61312727-61312749 CAGTGTAAATGCAAGGACAAGGG - Intergenic
991126475 5:63075436-63075458 CAGTGGGAAGGGAAGTAGAGGGG - Intergenic
991145123 5:63292983-63293005 CAGTTGGAATGGAAGGTTGAGGG - Intergenic
991311176 5:65244227-65244249 TATTGGGAATGGTTGGAAAAAGG + Intronic
991648269 5:68823472-68823494 GAGTGAGACTGGAAGCAAAATGG - Intergenic
992175612 5:74146299-74146321 CAGTCAGAAGGGAAGGAAGATGG - Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992579085 5:78152058-78152080 GAGAGGGAAGGGAAGGAAAAGGG - Intronic
992630274 5:78673300-78673322 CAGTGGGAAGGGCTTGAAAAAGG - Intronic
992981783 5:82182713-82182735 GAGTGTGAATGGGAGGGAAATGG + Intronic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
993602242 5:89941520-89941542 CAGTGGTAAAGGAAGGGAGAGGG + Intergenic
993621457 5:90173112-90173134 CAGTGGAAATGGAAGGAACCAGG - Intergenic
993724975 5:91356450-91356472 CAATGGTAATGGAGGGAAACGGG + Intergenic
994553891 5:101272057-101272079 CAGGTGGAAAGGAAGGAGAAAGG + Intergenic
994723167 5:103403717-103403739 CAATGGGTATGAAAGGCAAAGGG + Intergenic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
995813425 5:116136155-116136177 GAGAGGGAATGCAAGGAACAAGG - Intronic
996119084 5:119650971-119650993 CAGTGTGAATGGAAGTCAGATGG + Intergenic
996173488 5:120325335-120325357 GACTGGGAAGGGAAGGAAAGAGG + Intergenic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996302972 5:122009976-122009998 TAGTGGGAAGGGAAGGTTAAAGG - Intronic
996652200 5:125892629-125892651 CTATGGGAAGGAAAGGAAAAAGG + Intergenic
997032139 5:130142802-130142824 CAGTGGGACTGGAAGGGCCAAGG + Intronic
997049412 5:130362177-130362199 CAGAGGTAATGGAAGTTAAAAGG - Intergenic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998482038 5:142470600-142470622 CTGTGGGAATTGACGGGAAAGGG + Intergenic
998681265 5:144470243-144470265 CAGTGGGACTGCAAGGTCAAAGG + Intronic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
999247207 5:150161548-150161570 CAGAGGCCAGGGAAGGAAAAAGG - Intergenic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
999504570 5:152181399-152181421 CAGTGGGAATTGAAGCTCAAAGG - Intergenic
999624676 5:153507620-153507642 CAGTGGGAAAAGAAGAAAATGGG - Intronic
999800747 5:155031789-155031811 CAGAGGGAAAGGATGGAAACGGG - Intergenic
999901923 5:156094416-156094438 CAGTTGGGATGGGAGGATAAGGG - Intronic
1000429708 5:161136580-161136602 TGCTGGGAAAGGAAGGAAAAAGG - Intergenic
1001702572 5:173718012-173718034 CTGTGGGAATGGAACTGAAATGG - Intergenic
1001744800 5:174084120-174084142 TGGAGGAAATGGAAGGAAAAAGG - Intronic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1001939902 5:175733042-175733064 CAGCGGGACTGGACAGAAAAGGG + Intergenic
1001939975 5:175733509-175733531 CACTGGGAAAGGAAGGGCAATGG - Intergenic
1002737831 5:181409576-181409598 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1002811908 6:639261-639283 CAGTGGCAAGGGCAGGAGAAGGG - Intronic
1003498985 6:6688517-6688539 GAAAGGGAAAGGAAGGAAAAAGG - Intergenic
1003662278 6:8073894-8073916 CAATGAGAAAAGAAGGAAAAGGG - Intronic
1003763814 6:9213597-9213619 CATTGGGATTGGATGGAAAGTGG + Intergenic
1004055673 6:12135952-12135974 CAGTGGGAATGGAAAGGGTATGG - Intronic
1004100580 6:12606160-12606182 CAATGGGAATGGCAGGACATGGG + Intergenic
1005020459 6:21413054-21413076 GAGAGGGAAAGAAAGGAAAAGGG + Intergenic
1005147499 6:22708170-22708192 CAGAGGGAATGGAAGCAGAAAGG - Intergenic
1005529706 6:26690473-26690495 GAGTGGAGATGGAAAGAAAAGGG + Intergenic
1005541090 6:26811174-26811196 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1005646797 6:27847039-27847061 CACTGGCAATGGAAAGTAAAGGG - Intronic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005774062 6:29110059-29110081 AAGTGGGAGGGGCAGGAAAATGG - Intergenic
1006237061 6:32642816-32642838 CAGTATGAAAGGAAGGAAAGTGG + Intronic
1007734653 6:43972987-43973009 CAGTGGAAATGGAAAGGGAAAGG + Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008627148 6:53327827-53327849 GAGAGGAAATGGAAGGTAAAAGG - Intronic
1009011903 6:57853262-57853284 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1009959338 6:70500076-70500098 CAGGGAGAATGGAACCAAAATGG - Intronic
1010388885 6:75313446-75313468 CAGTGTGAATGGAAGAAGAATGG - Exonic
1010690398 6:78904331-78904353 CAGTGGCAATAGGAGGTAAAGGG - Intronic
1010977674 6:82334548-82334570 ATGTGGAAATGAAAGGAAAAGGG - Intergenic
1011081171 6:83491478-83491500 GAGAGGGAGAGGAAGGAAAATGG + Intergenic
1011101572 6:83728169-83728191 CCCTGGGAAGGGAAGGAAAGAGG + Intergenic
1011746085 6:90409157-90409179 CAGTGGGACTGCCATGAAAAAGG - Intergenic
1011957682 6:93043663-93043685 CAATTGGACTTGAAGGAAAATGG - Intergenic
1011993241 6:93550557-93550579 CAGGGGAAATGGGAGGTAAAGGG + Intergenic
1012396604 6:98805142-98805164 CACGGGGAAAGGAAGGAAAGTGG - Intergenic
1012604066 6:101134867-101134889 TAGTAGGAATGGTAGGAATAAGG - Intergenic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1013434688 6:110091310-110091332 CAATTGGAAAGGAGGGAAAAAGG - Intergenic
1013525364 6:110969066-110969088 CAGTGGAAATGGAAGACAGAAGG - Intergenic
1013566925 6:111374502-111374524 CAGTGGGTAGGGAAGCAGAAAGG + Exonic
1014078924 6:117266639-117266661 CTGAGGAAATGGAAGGAAAATGG - Intronic
1014332254 6:120083988-120084010 CAGGGTAAATGGAAGTAAAATGG + Intergenic
1014431687 6:121378422-121378444 CAGTAGGAAAGGAAGGAATAGGG - Intergenic
1014480684 6:121932753-121932775 CAGAGGGACTGGAAGGTCAAGGG + Intergenic
1014789469 6:125655912-125655934 AAGATGGGATGGAAGGAAAAGGG + Intergenic
1015058270 6:128930246-128930268 CAGTAGGAATGAAAAGAAATAGG - Intronic
1015385909 6:132623132-132623154 AAATGGGATTGTAAGGAAAAAGG + Intronic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1017312256 6:152987572-152987594 CAGTGGTAATGGAATTGAAAAGG + Exonic
1017673572 6:156791631-156791653 CAGAGGTAATGCAAGGAAATTGG + Intronic
1018098393 6:160413939-160413961 AAGTTGGAATGAAATGAAAAAGG - Intronic
1018304352 6:162439303-162439325 AAGGGGGAAGGGAAGGGAAAAGG - Intronic
1018419564 6:163630353-163630375 CAGTGGGCACTGAAGGAGAAAGG + Intergenic
1018606369 6:165602058-165602080 CAGTGGGACAGGGAAGAAAAGGG - Intronic
1018752091 6:166815699-166815721 CAGTGGCAATGGAATTAAAGAGG + Intronic
1018923958 6:168193979-168194001 CCGTGGGGACTGAAGGAAAATGG - Intergenic
1019004630 6:168785975-168785997 AAGGGGGAAGGGAAGGAACATGG + Intergenic
1019165692 6:170096268-170096290 CACTGGGAATGGTCTGAAAAAGG - Intergenic
1019242930 6:170685134-170685156 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1020040937 7:5000422-5000444 CAGAGAGAATGGAAGGAGAGAGG + Intronic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1020852292 7:13369882-13369904 CAGTAGTTATTGAAGGAAAAAGG + Intergenic
1021056768 7:16058778-16058800 CATTGGGAATGGCAAGAAACTGG + Intergenic
1021972370 7:25978084-25978106 AAGTGGGCAGGGAAAGAAAAAGG + Intergenic
1022162998 7:27730859-27730881 CAGTGTGAAGGGATGGTAAAGGG + Intergenic
1023109377 7:36794233-36794255 CATCCAGAATGGAAGGAAAAGGG - Intergenic
1023227653 7:37987905-37987927 CAGTGGGAAGGGAAATGAAATGG - Intronic
1023307019 7:38841382-38841404 CATAGGGAATGAAAGGAAATAGG - Intronic
1023473642 7:40552688-40552710 CCATAGGCATGGAAGGAAAAGGG + Intronic
1023689539 7:42772193-42772215 CAGTGGGAATGGAGGCAGCAAGG - Intergenic
1023714881 7:43033757-43033779 CAGTGAGAATGTAAAGAAATTGG + Intergenic
1024737791 7:52323656-52323678 AAGGGGGAAGGGAAGGGAAAGGG - Intergenic
1024883100 7:54111807-54111829 CAGGGAAAAGGGAAGGAAAAGGG + Intergenic
1025088725 7:56044788-56044810 CAGTGAGACTGGAAAAAAAAAGG + Intronic
1025775697 7:64558932-64558954 AAGTGGGAGGGGAAGAAAAAAGG + Intronic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026164285 7:67896250-67896272 CAGGGGGACAGGAAGGGAAAGGG - Intergenic
1026337126 7:69404145-69404167 CAGGGGGAAAGGATGGGAAAGGG + Intergenic
1027240782 7:76326675-76326697 AAGTTGGATTGGCAGGAAAAAGG - Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1028800236 7:94955472-94955494 CAGTGGGAATAAAAAGAAATAGG - Intronic
1028947651 7:96599070-96599092 AAGAAGGAAGGGAAGGAAAAAGG + Intronic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1030019131 7:105255471-105255493 CAGATGGAAAAGAAGGAAAAGGG + Intronic
1030337635 7:108343223-108343245 CAGTAGAATTAGAAGGAAAAAGG + Intronic
1030524586 7:110637680-110637702 CAGTAGGCAGGGAAGGAAAAGGG + Intergenic
1031394828 7:121260869-121260891 CAGGAGGAAAGAAAGGAAAAAGG + Intronic
1031649624 7:124271853-124271875 GAGTGAGAGAGGAAGGAAAAGGG - Intergenic
1031915906 7:127562901-127562923 GAGTGAGAATGGAAATAAAAAGG - Intergenic
1032299741 7:130675715-130675737 CAGTAGGAATGAAAGCTAAAAGG - Intronic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032409912 7:131687332-131687354 CAGAGGCAATGGAAGGGAAGGGG - Intergenic
1032653160 7:133900674-133900696 CAGGGGACAGGGAAGGAAAATGG + Intronic
1033092207 7:138396309-138396331 AAGTGCAAAGGGAAGGAAAATGG - Intergenic
1033192433 7:139294055-139294077 CAATGTGAATGGAATGACAAAGG + Intronic
1034709253 7:153176444-153176466 CAGTGGTAATGAATGCAAAATGG + Intergenic
1034782986 7:153898670-153898692 CACTGGACATGGGAGGAAAATGG + Intronic
1035161151 7:156950608-156950630 CAGGGGGAAGAAAAGGAAAAGGG + Exonic
1035505191 8:123028-123050 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
1035947103 8:3977303-3977325 CATTGGGAAAGGAATGAAATGGG - Intronic
1036414503 8:8534687-8534709 CAGTGAAAATGAAAGGAAATGGG - Intergenic
1036635527 8:10547654-10547676 GAGTGGGAAGGGAAGGGAAAAGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1038046430 8:23769106-23769128 CAGGGGGAATGGCAGGTACAGGG - Intergenic
1038156667 8:24998052-24998074 CAGTGGGCAGGCCAGGAAAATGG - Intergenic
1038392310 8:27213729-27213751 GAGAGGGAAAGGAAGGAAAAAGG + Intergenic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038881853 8:31623316-31623338 AAGTGGGAATGAAAGGATGAAGG + Intergenic
1039037682 8:33377518-33377540 GAGTGGGAAGGCAAGGAAATAGG - Intronic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1040100366 8:43495608-43495630 CAGTTGGAATGGAATGAGTAGGG + Intergenic
1040408364 8:47131708-47131730 CAGTGTGAATCAAAGCAAAATGG - Intergenic
1044255899 8:90060747-90060769 TAGTGGGAAATGAAGTAAAATGG + Intronic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044624528 8:94223787-94223809 GAGGGGGGATGGAGGGAAAATGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045495570 8:102705306-102705328 AGGGAGGAATGGAAGGAAAAAGG - Intergenic
1045983594 8:108221084-108221106 AACTGGGAATGAAAAGAAAAGGG + Intronic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1046310990 8:112438124-112438146 CAAGGTGAATGGAATGAAAAAGG - Intronic
1046331680 8:112724271-112724293 GAGTGAGAATGAAAGAAAAATGG + Intronic
1046806301 8:118482373-118482395 CAAATGGAAAGGAAGGAAAATGG + Intronic
1046854793 8:119018934-119018956 AAATGGGAATGGAAGAAAGAGGG - Intronic
1047078254 8:121429947-121429969 CAGTGGGAATGGGAAGTGAAGGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047987349 8:130248633-130248655 TGGTGGAAATGGAAGGTAAAGGG + Intronic
1048879763 8:138862533-138862555 CAGTGGGAGGGTAAGAAAAAAGG - Intronic
1051257223 9:15226861-15226883 GAGTGGAAATGGAAGGAGATTGG - Intronic
1051311531 9:15779075-15779097 AAGTGTGAATGAAATGAAAAAGG + Exonic
1051385096 9:16499469-16499491 CAGTGCAAATGGAAAGATAAGGG - Intronic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1053463581 9:38289152-38289174 CAGTGGGAATGGGAGAATCAAGG - Intergenic
1053621078 9:39818174-39818196 CAATGGTAATGGAAGATAAAAGG + Intergenic
1053884024 9:42626160-42626182 CAGTGGTAATGGAAGATAAAAGG - Intergenic
1053888644 9:42668134-42668156 CAGTGGTAATGGAAGATAAAAGG + Intergenic
1053915096 9:42939883-42939905 CGGTTGGGGTGGAAGGAAAAGGG + Intergenic
1054223044 9:62433606-62433628 CAGTGGTAATGGAAGATAAAAGG - Intergenic
1054227666 9:62475581-62475603 CAGTGGTAATGGAAGATAAAAGG + Intergenic
1054263084 9:62889263-62889285 CAATGGTAATGGAAGATAAAAGG - Intergenic
1054376664 9:64454866-64454888 GGGTTGGAGTGGAAGGAAAAGGG + Intergenic
1054998017 9:71414403-71414425 CTTTGTGAAAGGAAGGAAAAAGG - Intronic
1055343336 9:75308702-75308724 CAGTGGGGAGGGATGGAACAGGG + Intergenic
1055379274 9:75688615-75688637 CAGATGCAATGTAAGGAAAAGGG + Intergenic
1055954445 9:81761040-81761062 CAGTGGGAAAGGAAGTGCAAAGG - Intergenic
1056364192 9:85886566-85886588 CATAGTGAGTGGAAGGAAAATGG - Intergenic
1056905194 9:90641380-90641402 CACAGGGAAAGGAAGGAGAAAGG - Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057925347 9:99142077-99142099 CAGTGGGAATGGAAGAGTATGGG - Intronic
1058696339 9:107562299-107562321 TAATGGAAATGCAAGGAAAAGGG - Intergenic
1059053605 9:110955006-110955028 CAGTAAGAAAGAAAGGAAAAAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059326348 9:113506186-113506208 CAGGGAGAAGGGAAGGCAAAGGG + Intronic
1059542397 9:115144015-115144037 AAGGGGGAAGGGAAGGACAAAGG - Intronic
1060038509 9:120279990-120280012 CACTGGGAATGGAATAAACAAGG - Intergenic
1060351561 9:122865730-122865752 CAATGGGAATAGATTGAAAAAGG + Intronic
1060702114 9:125764160-125764182 CAGGGGGAGGGGCAGGAAAAAGG - Intronic
1061995383 9:134180457-134180479 CAGAGGGAAGGAAAGGTAAAAGG - Intergenic
1203529625 Un_GL000213v1:127767-127789 CAGTGTGAATCAAAGCAAAATGG - Intergenic
1203603121 Un_KI270748v1:34358-34380 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1185689395 X:2140706-2140728 CAGTGGGAGAGGCTGGAAAAAGG + Intergenic
1186093659 X:6077049-6077071 ATGTAGGAATGAAAGGAAAAAGG - Intronic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1186833554 X:13415329-13415351 CAAAGGGAAGGCAAGGAAAAAGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187507410 X:19888172-19888194 CTGTTGGAGGGGAAGGAAAAGGG + Intergenic
1187963612 X:24589183-24589205 CAGTGAGAATAAAAAGAAAAAGG - Intronic
1188343434 X:29033861-29033883 CAATGAGAATGAAAAGAAAAGGG + Intronic
1188575602 X:31646206-31646228 CAGTGGGAAAGGAAAGCCAAAGG - Intronic
1188629256 X:32331209-32331231 AAAAGGGAATGGAAGGAATATGG + Intronic
1188997151 X:36899448-36899470 AACTGGGAATGGATGGATAACGG + Intergenic
1189357623 X:40323440-40323462 GAGGAGGAATGGAAGGATAAGGG - Intergenic
1190259802 X:48790729-48790751 GAGAGAGAATGGAAGGAAGAAGG + Intronic
1190787939 X:53671123-53671145 CAGGGGGAAAGGATGGGAAAGGG + Intronic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1192261096 X:69506198-69506220 CAGTGGGACCGGGAGAAAAAAGG + Intronic
1192261357 X:69507328-69507350 CAGAGGGTTGGGAAGGAAAAGGG + Intronic
1192365167 X:70466052-70466074 CAGTGGAAATGGAAGCTAATTGG - Intronic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1193214664 X:78849529-78849551 GAGTTGGAATGGAGAGAAAATGG + Intergenic
1194597692 X:95879016-95879038 AAGTGGAACTGGAAGGTAAAAGG + Intergenic
1195021963 X:100837746-100837768 AAGTAGAAAGGGAAGGAAAAAGG - Intronic
1195384517 X:104301553-104301575 TAGTGGAAGTGGAAGGGAAAAGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196218340 X:113081845-113081867 CAGTGGGAAAGGGTGGGAAAAGG - Intergenic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197321242 X:125033570-125033592 CAGGAGGAAGGGAAGGACAAAGG + Intergenic
1198089043 X:133309554-133309576 CATTGGGAATGGAATGCAGAAGG - Intronic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1199924484 X:152448581-152448603 CAGTGGGACTGGGTGGAAAGGGG - Intronic
1201417381 Y:13760984-13761006 CAGAGAGAATGAAAAGAAAATGG + Intergenic