ID: 1195961453

View in Genome Browser
Species Human (GRCh38)
Location X:110391344-110391366
Sequence TGTGGTGCCCCCAAGCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195961453_1195961455 -3 Left 1195961453 X:110391344-110391366 CCATCATGCTTGGGGGCACCACA 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1195961455 X:110391364-110391386 ACATCAGCCTACAGTGAACATGG 0: 1
1: 0
2: 4
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195961453 Original CRISPR TGTGGTGCCCCCAAGCATGA TGG (reversed) Intronic
901017326 1:6239392-6239414 TGTGTTGTCCCCAAGCATGGAGG - Intergenic
907500369 1:54875280-54875302 TGGGGGGCCTCCTAGCATGAGGG + Intronic
913240104 1:116822478-116822500 TGTGGAGCCACCAGGCATGGTGG - Intergenic
915028485 1:152855595-152855617 TATGGTCCTCCCAAGGATGATGG - Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
918448104 1:184634298-184634320 TGTGATGCCATCAAACATGAAGG + Intergenic
919355567 1:196517072-196517094 TGTGGAGACAGCAAGCATGAAGG - Intronic
921720266 1:218463505-218463527 TGTGGTGCCCAGAAGCATAAAGG - Intergenic
921837833 1:219795889-219795911 TGGGGTGCCCCTCAGCAGGAAGG + Intronic
1074810036 10:117095015-117095037 TGTGGTGTCTACAAGCAAGAAGG + Intronic
1076664177 10:132076796-132076818 TGCGGTGGCCCCAGGTATGATGG + Intergenic
1078180138 11:9004243-9004265 TGCGGGGCCCCCACGCAGGAGGG - Intergenic
1083782132 11:64924182-64924204 TGTGGTGCACCCAAGCCTGCTGG - Intronic
1084219766 11:67670800-67670822 TGTGCGGCCCCCCTGCATGAGGG + Intronic
1085416800 11:76323922-76323944 TTTGGTGGCCCCAAGAATAACGG - Intergenic
1089395550 11:118134517-118134539 AGTAGTGCCCCCACGCATGGGGG + Exonic
1092074509 12:5661937-5661959 TGTGTTGACACCATGCATGAGGG - Intronic
1092248435 12:6877151-6877173 GGTGGTGCCACCAATCAAGATGG + Intronic
1093057918 12:14573130-14573152 AGGGGTGCAGCCAAGCATGATGG - Intergenic
1094395212 12:29998309-29998331 TGTGTTGCCTTCAAGAATGATGG - Intergenic
1096028522 12:48389642-48389664 TATGCTGCCCCCAAGCTTCAGGG + Intergenic
1096560237 12:52430909-52430931 TGTGCTTTCCCCAGGCATGAGGG + Intronic
1103536873 12:121639222-121639244 TGTGGGGCCAGCAGGCATGATGG + Intronic
1105551954 13:21405885-21405907 GCTGGTGCACCCAAGCATTATGG - Intronic
1105564498 13:21530821-21530843 CGTGGTGCCCCCATGGACGACGG + Intronic
1109229596 13:59740867-59740889 GGTGTAGCCCCAAAGCATGAAGG + Intronic
1110928153 13:81181921-81181943 TATGCTGCCCCCAAATATGAAGG - Intergenic
1110968714 13:81733521-81733543 TGTGGGACTCCCAAGCAAGATGG - Intergenic
1112794759 13:103044642-103044664 GCTGGTGCACCCAAGCATTATGG - Exonic
1114304277 14:21407023-21407045 TGAGGCGTCCCTAAGCATGAAGG + Exonic
1117267636 14:54106496-54106518 TGTGATCCCTCAAAGCATGAAGG - Intergenic
1118850065 14:69576308-69576330 TGTGGTCACCCCAGGCAGGAAGG + Intergenic
1120669586 14:87348596-87348618 TGTGGTGAGCCCAGACATGAGGG - Intergenic
1121208916 14:92191787-92191809 TGTGGCGGTTCCAAGCATGAGGG - Intergenic
1122243151 14:100382394-100382416 TGTGTTGGCTCCAAGCATGAGGG + Intronic
1122806473 14:104262573-104262595 GGTGTTGGCCCCAAGCAGGATGG + Intergenic
1125296859 15:38212590-38212612 TGTATTGTCCCCAAGCCTGAAGG - Intergenic
1125908035 15:43411635-43411657 TGGGCTGCGCCCAAGGATGAAGG + Intronic
1130835424 15:87645473-87645495 TGTGGTGCACCGAAGGATGGAGG - Intergenic
1131811824 15:96180800-96180822 TGTGCTGCCCACAAGCGTGTTGG - Intergenic
1133279284 16:4655955-4655977 TGTAGTGCCTCCAACCATGCTGG + Intronic
1138426366 16:56935116-56935138 TGTGTTTCCCCCCAGCATCACGG - Intronic
1140450103 16:75063890-75063912 TCTAGTGCCACCTAGCATGAGGG - Intronic
1144259727 17:13506626-13506648 TCTGCTGCCCCCAAGCCTTAGGG - Intronic
1147213225 17:38884286-38884308 TGTAGTCCCACCAAGCAGGAAGG + Intronic
1148584270 17:48766242-48766264 TGAGGAGCCCCCAATCTTGAGGG + Intronic
1151157585 17:72137231-72137253 TGGGGTGGGCCCAAGCCTGAGGG - Intergenic
1152525392 17:80885393-80885415 TGTGTTGCTCCCAGGCAGGAAGG - Intronic
1157349065 18:46868862-46868884 TGTGGTGGCCTCAGGGATGAGGG + Intronic
1164921741 19:32093538-32093560 AGTGGTGCCCCCCACCAGGAAGG + Intergenic
1165467237 19:35982239-35982261 TGTGGTCCCACCCAGCATCATGG - Intergenic
1166688420 19:44809307-44809329 TGTGGGGACCCCAAGGAGGAGGG + Intronic
925234836 2:2268990-2269012 TATGGTGCACCCAAGCATTCGGG + Intronic
925448870 2:3951654-3951676 GATGGTACCCCCATGCATGATGG + Intergenic
925776267 2:7338951-7338973 TCTGGTCCCCCCAGGCACGAAGG + Intergenic
925960432 2:9009438-9009460 TGTGGTAACCCCAGACATGATGG - Intergenic
927058670 2:19392128-19392150 TTTGGTGATCCCATGCATGAAGG + Intergenic
946500098 2:220238152-220238174 GGTGGTGCCTCTAAGCATCATGG - Intergenic
947664236 2:231893349-231893371 TTTGCTTCCCCCAAGCATCATGG + Intergenic
948991020 2:241554063-241554085 TGTGGTGCCCCCCAGAAGCAGGG - Intergenic
1168954585 20:1826142-1826164 TGTGGTTCCCCCAGGCCTGAAGG - Intergenic
1175304720 20:57968042-57968064 TGTGAGACCCCAAAGCATGAGGG - Intergenic
1176407613 21:6430034-6430056 TGTGGTGCCTGCAGGGATGAAGG - Intergenic
1178781726 21:35609747-35609769 AGAGGTGCCCCCAAACTTGAAGG + Intronic
1179906024 21:44423798-44423820 TGTGGTGGCACCAAGAAGGAGGG + Intronic
1183439755 22:37816512-37816534 TGTTCTGCCCCCAAGCCTGTTGG + Intronic
1185275867 22:49950017-49950039 TGTGCTGCCCCCCAGCATGCTGG - Intergenic
950675539 3:14552116-14552138 TCTGGTGCCCCCAGGCATGGAGG + Intergenic
952620124 3:35328121-35328143 TGAGGTGCCTCCTAGTATGATGG + Intergenic
954992915 3:54856355-54856377 TCTGCTGCTCCCAAGCATGCTGG - Intronic
955029411 3:55201865-55201887 TGTGGTGCCCGGAAGGGTGAAGG + Intergenic
956374215 3:68596872-68596894 TGTGGTGCTCCTAAAGATGAGGG + Intergenic
958186272 3:90123600-90123622 TTTGCTGCCCACAAGCTTGATGG + Intergenic
963543815 3:146629516-146629538 TATGGTGCCCCTAATAATGATGG - Intergenic
964525368 3:157611254-157611276 GGTGGAGGCCCCAAGCATGAGGG + Intronic
965407903 3:168293513-168293535 CTTGGTGCCCCCAAGCATCTAGG + Intergenic
968575872 4:1365915-1365937 TGTGGTGCCCCCGAGGCTTAGGG - Intronic
970895412 4:21097607-21097629 TATGGTGCCCCAAACAATGATGG - Intronic
974467880 4:62280723-62280745 TGTGGTCCCCACCAGCAAGAAGG + Intergenic
976565007 4:86542957-86542979 CAAGGTGCCCCCCAGCATGATGG - Intronic
985959909 5:3293564-3293586 TTTGGCGCCCCCAAGAATGGGGG - Intergenic
987211536 5:15688712-15688734 TGTTGTGTCCCCAAGGCTGAAGG + Intronic
994990272 5:106987894-106987916 TATTGTGCCCCCAAAGATGAAGG + Intergenic
1005265434 6:24107547-24107569 TGTGGAGCCCCCACCCATGTGGG + Intergenic
1006141824 6:31933924-31933946 ATTGGTGGCCCCAAGCATGTGGG - Exonic
1007582448 6:42967533-42967555 TGTGGTGGCCACAACCATGAGGG + Exonic
1011722209 6:90169077-90169099 TGTGGTGCCCCAGAGCATCTTGG + Intronic
1012971946 6:105740707-105740729 TGTGATGGCTCCAAGCATCAAGG + Intergenic
1013204981 6:107936177-107936199 TGTGTGGCCCCCAAGAATAAGGG - Intronic
1013589783 6:111610223-111610245 TGTGCTCCACCCAAGCATGTAGG - Intergenic
1016064415 6:139664497-139664519 TGTGCTGCATCCAAACATGATGG + Intergenic
1023060655 7:36322811-36322833 TGTGGTGCCCTCACCCATCAGGG - Intergenic
1028045204 7:86108710-86108732 GGTGGTGCCTTCAACCATGATGG + Intergenic
1035421547 7:158733105-158733127 TGTGGCGCCCCCAACCCTGGTGG + Exonic
1035922011 8:3687281-3687303 TGTGGTTACCCCATGTATGATGG + Intronic
1040110372 8:43564556-43564578 TGGGGTGCCCCCATGCACCATGG + Intergenic
1042749088 8:72138533-72138555 TGTGGTCCCCCCAAATATGTGGG - Intergenic
1043737609 8:83767961-83767983 GGTGGTGCCCAGAAGCTTGAAGG + Intergenic
1049374245 8:142281474-142281496 TGTGCGGCCCCCAACCATGGTGG - Intronic
1050170474 9:2810584-2810606 TGTGGTCCCCCCAAGTATGATGG - Intronic
1061346262 9:130028055-130028077 AGTGATGCCCCCAGGCATGGTGG - Intronic
1061874689 9:133537744-133537766 CCTGGTGCCCTGAAGCATGAAGG - Intronic
1062167212 9:135113835-135113857 TGTGGTGCCCCCCAGGCTGTGGG - Intronic
1186863320 X:13694664-13694686 TGAGGTGCCCCAAAGCATCACGG - Intronic
1192295589 X:69844442-69844464 AGTTATGCCCCCAAGCATGATGG + Intronic
1195880852 X:109591238-109591260 TGTGATGCCCCCAAGAACCAAGG + Intergenic
1195961453 X:110391344-110391366 TGTGGTGCCCCCAAGCATGATGG - Intronic