ID: 1195965648

View in Genome Browser
Species Human (GRCh38)
Location X:110427889-110427911
Sequence CTGGGTGAAGGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5010
Summary {0: 1, 1: 3, 2: 33, 3: 503, 4: 4470}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195965648_1195965657 25 Left 1195965648 X:110427889-110427911 CCTTCCTCCCTCCCTTCACCCAG 0: 1
1: 3
2: 33
3: 503
4: 4470
Right 1195965657 X:110427937-110427959 TAGCTCAGAAGACACCTCTAAGG 0: 1
1: 0
2: 1
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195965648 Original CRISPR CTGGGTGAAGGGAGGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr