ID: 1195965648 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:110427889-110427911 |
| Sequence | CTGGGTGAAGGGAGGGAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5010 | |||
| Summary | {0: 1, 1: 3, 2: 33, 3: 503, 4: 4470} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195965648_1195965657 | 25 | Left | 1195965648 | X:110427889-110427911 | CCTTCCTCCCTCCCTTCACCCAG | 0: 1 1: 3 2: 33 3: 503 4: 4470 |
||
| Right | 1195965657 | X:110427937-110427959 | TAGCTCAGAAGACACCTCTAAGG | 0: 1 1: 0 2: 1 3: 11 4: 127 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195965648 | Original CRISPR | CTGGGTGAAGGGAGGGAGGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||