ID: 1195966109

View in Genome Browser
Species Human (GRCh38)
Location X:110431743-110431765
Sequence CAGTGAGTCCTGGTCTGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195966109_1195966118 22 Left 1195966109 X:110431743-110431765 CCTTGACAGACCAGGACTCACTG No data
Right 1195966118 X:110431788-110431810 ATTGCTGAAGACTCTAGTGTGGG No data
1195966109_1195966113 -6 Left 1195966109 X:110431743-110431765 CCTTGACAGACCAGGACTCACTG No data
Right 1195966113 X:110431760-110431782 TCACTGCTAGAAAACCCCTGGGG No data
1195966109_1195966112 -7 Left 1195966109 X:110431743-110431765 CCTTGACAGACCAGGACTCACTG No data
Right 1195966112 X:110431759-110431781 CTCACTGCTAGAAAACCCCTGGG No data
1195966109_1195966117 21 Left 1195966109 X:110431743-110431765 CCTTGACAGACCAGGACTCACTG No data
Right 1195966117 X:110431787-110431809 CATTGCTGAAGACTCTAGTGTGG No data
1195966109_1195966111 -8 Left 1195966109 X:110431743-110431765 CCTTGACAGACCAGGACTCACTG No data
Right 1195966111 X:110431758-110431780 ACTCACTGCTAGAAAACCCCTGG No data
1195966109_1195966119 23 Left 1195966109 X:110431743-110431765 CCTTGACAGACCAGGACTCACTG No data
Right 1195966119 X:110431789-110431811 TTGCTGAAGACTCTAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195966109 Original CRISPR CAGTGAGTCCTGGTCTGTCA AGG (reversed) Intronic