ID: 1195966110

View in Genome Browser
Species Human (GRCh38)
Location X:110431753-110431775
Sequence GGTTTTCTAGCAGTGAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195966110_1195966121 29 Left 1195966110 X:110431753-110431775 CCAGGACTCACTGCTAGAAAACC No data
Right 1195966121 X:110431805-110431827 TGTGGGGCACATTAGGTTTGAGG No data
1195966110_1195966118 12 Left 1195966110 X:110431753-110431775 CCAGGACTCACTGCTAGAAAACC No data
Right 1195966118 X:110431788-110431810 ATTGCTGAAGACTCTAGTGTGGG No data
1195966110_1195966117 11 Left 1195966110 X:110431753-110431775 CCAGGACTCACTGCTAGAAAACC No data
Right 1195966117 X:110431787-110431809 CATTGCTGAAGACTCTAGTGTGG No data
1195966110_1195966120 22 Left 1195966110 X:110431753-110431775 CCAGGACTCACTGCTAGAAAACC No data
Right 1195966120 X:110431798-110431820 ACTCTAGTGTGGGGCACATTAGG No data
1195966110_1195966119 13 Left 1195966110 X:110431753-110431775 CCAGGACTCACTGCTAGAAAACC No data
Right 1195966119 X:110431789-110431811 TTGCTGAAGACTCTAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195966110 Original CRISPR GGTTTTCTAGCAGTGAGTCC TGG (reversed) Intronic