ID: 1195966115

View in Genome Browser
Species Human (GRCh38)
Location X:110431775-110431797
Sequence CTTCAGCAATGACTTCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195966115_1195966119 -9 Left 1195966115 X:110431775-110431797 CCCTGGGGAAGTCATTGCTGAAG No data
Right 1195966119 X:110431789-110431811 TTGCTGAAGACTCTAGTGTGGGG No data
1195966115_1195966121 7 Left 1195966115 X:110431775-110431797 CCCTGGGGAAGTCATTGCTGAAG No data
Right 1195966121 X:110431805-110431827 TGTGGGGCACATTAGGTTTGAGG No data
1195966115_1195966118 -10 Left 1195966115 X:110431775-110431797 CCCTGGGGAAGTCATTGCTGAAG No data
Right 1195966118 X:110431788-110431810 ATTGCTGAAGACTCTAGTGTGGG No data
1195966115_1195966120 0 Left 1195966115 X:110431775-110431797 CCCTGGGGAAGTCATTGCTGAAG No data
Right 1195966120 X:110431798-110431820 ACTCTAGTGTGGGGCACATTAGG No data
1195966115_1195966124 15 Left 1195966115 X:110431775-110431797 CCCTGGGGAAGTCATTGCTGAAG No data
Right 1195966124 X:110431813-110431835 ACATTAGGTTTGAGGAGCAGGGG No data
1195966115_1195966122 13 Left 1195966115 X:110431775-110431797 CCCTGGGGAAGTCATTGCTGAAG No data
Right 1195966122 X:110431811-110431833 GCACATTAGGTTTGAGGAGCAGG No data
1195966115_1195966125 26 Left 1195966115 X:110431775-110431797 CCCTGGGGAAGTCATTGCTGAAG No data
Right 1195966125 X:110431824-110431846 GAGGAGCAGGGGAAACATTCAGG No data
1195966115_1195966123 14 Left 1195966115 X:110431775-110431797 CCCTGGGGAAGTCATTGCTGAAG No data
Right 1195966123 X:110431812-110431834 CACATTAGGTTTGAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195966115 Original CRISPR CTTCAGCAATGACTTCCCCA GGG (reversed) Intronic