ID: 1195966118

View in Genome Browser
Species Human (GRCh38)
Location X:110431788-110431810
Sequence ATTGCTGAAGACTCTAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195966114_1195966118 -9 Left 1195966114 X:110431774-110431796 CCCCTGGGGAAGTCATTGCTGAA No data
Right 1195966118 X:110431788-110431810 ATTGCTGAAGACTCTAGTGTGGG No data
1195966108_1195966118 23 Left 1195966108 X:110431742-110431764 CCCTTGACAGACCAGGACTCACT No data
Right 1195966118 X:110431788-110431810 ATTGCTGAAGACTCTAGTGTGGG No data
1195966115_1195966118 -10 Left 1195966115 X:110431775-110431797 CCCTGGGGAAGTCATTGCTGAAG No data
Right 1195966118 X:110431788-110431810 ATTGCTGAAGACTCTAGTGTGGG No data
1195966110_1195966118 12 Left 1195966110 X:110431753-110431775 CCAGGACTCACTGCTAGAAAACC No data
Right 1195966118 X:110431788-110431810 ATTGCTGAAGACTCTAGTGTGGG No data
1195966109_1195966118 22 Left 1195966109 X:110431743-110431765 CCTTGACAGACCAGGACTCACTG No data
Right 1195966118 X:110431788-110431810 ATTGCTGAAGACTCTAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195966118 Original CRISPR ATTGCTGAAGACTCTAGTGT GGG Intronic