ID: 1195968075

View in Genome Browser
Species Human (GRCh38)
Location X:110447450-110447472
Sequence GTGTGGGGATGTAGGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 1, 1: 0, 2: 7, 3: 83, 4: 744}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195968066_1195968075 10 Left 1195968066 X:110447417-110447439 CCATTTGTAGTAAGAAAGTTTCC 0: 1
1: 0
2: 0
3: 20
4: 240
Right 1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG 0: 1
1: 0
2: 7
3: 83
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195968075 Original CRISPR GTGTGGGGATGTAGGGGAGA TGG Intronic
900160188 1:1219669-1219691 GTGTGGGGACCTCGGGGTGAGGG - Intronic
900320845 1:2082870-2082892 GTGTGAGGGTGCAAGGGAGAGGG + Intronic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
901010968 1:6201929-6201951 GTGTGGGGAGGTGGGGGTGAGGG - Intronic
901435143 1:9242972-9242994 GTGTGTGTATTTAGGGGTGAGGG + Intronic
902705951 1:18204578-18204600 GAGGGGAGATGAAGGGGAGAGGG + Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902789444 1:18756713-18756735 GTGTGGGGGTGAGGGGTAGATGG + Intergenic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
904049308 1:27628933-27628955 GTCAGGGGATGTAGGGCACAGGG + Intronic
905120587 1:35678830-35678852 GTGTGGGCCTGTAGGGGAGTGGG - Intergenic
905404834 1:37725710-37725732 GGGTGGAGATGAAGGGGGGAAGG + Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
905892580 1:41526566-41526588 GTGTGGGGGTGTATGTGTGAGGG - Intronic
906086005 1:43135331-43135353 GTGTGTGGTTGTAGGGCAGGAGG + Intergenic
906105204 1:43287390-43287412 GTTCAGGGATATAGGGGAGAAGG - Intergenic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906352184 1:45071250-45071272 GTGGGGGGATGTCAGGGAGGTGG - Intronic
906638168 1:47424357-47424379 GGGTGCGGGTGTAGGGGAGGAGG - Intergenic
907065853 1:51482292-51482314 GTATGGGGAAGATGGGGAGAGGG + Intronic
907311697 1:53542512-53542534 GTGTGGGGCGGGTGGGGAGATGG + Intronic
907358467 1:53895562-53895584 GAGTGGGCAAGTCGGGGAGAAGG - Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907680872 1:56562137-56562159 GAGTGGAGATGTCTGGGAGAAGG + Intronic
908242956 1:62203365-62203387 GTGGGTGGATGTAGGGAATAGGG - Intronic
908340985 1:63178948-63178970 GTTTGGGGACTTAGGGGAAAAGG + Intergenic
908856644 1:68437242-68437264 ATTTAGGGGTGTAGGGGAGATGG - Intronic
909395757 1:75169157-75169179 GAGTAGGGGAGTAGGGGAGAGGG - Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909736461 1:78968502-78968524 GTGGGGGGGTGGGGGGGAGACGG + Intronic
910269418 1:85377697-85377719 GTGGGGGGATGAGGGGGAGAAGG - Intronic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910644421 1:89498068-89498090 GTGTGGGGGTGTAGGGGTGGAGG + Intergenic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912852766 1:113141217-113141239 GTGTGAGGAGGTGGGGAAGAGGG - Intergenic
912879237 1:113391371-113391393 GTCTCGGGGTGTTGGGGAGAGGG + Intronic
913192612 1:116426294-116426316 ATGTGGGGAGGTAGGGGTGGTGG + Intergenic
915460895 1:156070086-156070108 GTATGGGGGGGTTGGGGAGAAGG + Intronic
915528200 1:156488931-156488953 GTGGAAGGGTGTAGGGGAGAAGG - Intronic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916382945 1:164233486-164233508 GTGGGGGGATGTGGGGGCAAGGG - Intergenic
917036315 1:170750806-170750828 GTGTTGGGTTGAAGTGGAGAAGG - Intergenic
917049320 1:170901034-170901056 GGGTGGGGGTGCAGGGGAGTGGG + Intergenic
917400384 1:174642743-174642765 GAGAGGGGAAGAAGGGGAGAGGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
918031307 1:180814894-180814916 GGGTGGGGATGGAGTGTAGAAGG + Intronic
918366911 1:183817758-183817780 GTGTGTGGTGGTAGAGGAGAAGG + Intronic
918435156 1:184503505-184503527 ATGCAGGGATGTAGAGGAGAGGG - Intronic
919502102 1:198349973-198349995 GAGTGGGGATGGAGGTGGGATGG + Intergenic
919540264 1:198836925-198836947 GGGTGGGGAGGTTGGGGACAGGG - Intergenic
919753482 1:201052738-201052760 TTTTGGGGAAGTAGGGGCGAAGG - Intronic
920010371 1:202862591-202862613 AAGTGGGGATGAAGAGGAGATGG - Intergenic
920500050 1:206480180-206480202 GAGTGGGCAGGAAGGGGAGATGG + Intronic
920545948 1:206818539-206818561 GAGTGGGGATGTGGGTGAGAGGG + Intronic
921310211 1:213834941-213834963 GTGCTGGGAGGTGGGGGAGAGGG + Intergenic
922152397 1:223017371-223017393 TTGTGAGAAAGTAGGGGAGAGGG - Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
923230693 1:231983587-231983609 GGGTGGGGCAGTAGGGGAGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923494136 1:234509815-234509837 GGGTGGGGCTGTTGGGGAGCTGG - Intergenic
924087829 1:240471710-240471732 GTGGGGGGTGGCAGGGGAGAGGG + Intronic
924262370 1:242245475-242245497 GTGTGGGGATGCAGCGGCGTAGG + Intronic
924486615 1:244490032-244490054 GTGTGAGGATGAACAGGAGAGGG + Intronic
1063342821 10:5284149-5284171 GTGTGGGGGTGTATGGAGGAAGG - Intergenic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064438141 10:15329090-15329112 ATGTGGTGATGTCGGGAAGAAGG + Intronic
1064906920 10:20357085-20357107 GTGTGGGGAGGTAGGGAGGCAGG - Intergenic
1067744736 10:48927227-48927249 GTGTGTGGAAGCAGGGGGGAGGG - Intronic
1067756931 10:49012284-49012306 GTGCCGGCATGCAGGGGAGATGG + Intergenic
1067917529 10:50417171-50417193 GTTTGGGGAAGTAGGGGACAGGG - Intronic
1068018307 10:51545875-51545897 GGGTGGGGGTGTAGGGGGAAGGG - Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069680636 10:70282976-70282998 GGGTGGGGTTGTTGGGGAGATGG - Intronic
1070161317 10:73868309-73868331 GTGTGGGGATGGAGGTGGGAAGG - Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072409200 10:95184398-95184420 GTGGGGGGATGGCGGGGAGCTGG + Intergenic
1072594256 10:96856443-96856465 GAGGGGGGAGGTAGGGTAGAAGG - Intronic
1072899286 10:99393219-99393241 GTGTGGGGAGGTGGGAGGGAGGG - Exonic
1073035804 10:100563433-100563455 GTGTGTGGATGTAGGGGTGAGGG - Intergenic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1073473632 10:103739145-103739167 GGGTGGGGAGGTAGATGAGAGGG + Intronic
1074310069 10:112314647-112314669 TTGTGGGGGAGTAGGAGAGAGGG + Intergenic
1075112188 10:119596524-119596546 GGGTGGGGAGGAAGGGGAGGGGG + Intronic
1075713223 10:124541852-124541874 CAGTGGGGAAGTAGGGGTGAAGG - Intronic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076108866 10:127845997-127846019 GTTTGGGTATGTTGGGGACATGG - Intergenic
1076129774 10:128005687-128005709 GTGATGGGATGTGGGGCAGAGGG + Intronic
1076290706 10:129343457-129343479 GTGTGGAGATAGAGGGGTGAGGG - Intergenic
1076638085 10:131895955-131895977 GTGTGGGGATTGACTGGAGAGGG - Intergenic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077113102 11:870534-870556 GGGTGGGGCTGTGGGGGAGCTGG - Intronic
1077287740 11:1775306-1775328 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287742 11:1775317-1775339 GAGGGGGGATGGAGAGGAGATGG + Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287881 11:1775740-1775762 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077306407 11:1870523-1870545 GTGTGGGGGTGTCAGGAAGAGGG + Intronic
1077365831 11:2161250-2161272 GGGTTGAGAGGTAGGGGAGATGG - Intronic
1077868618 11:6243013-6243035 GTGTGGGGAGGGTGGAGAGAGGG - Intronic
1078291370 11:10013373-10013395 AAGCTGGGATGTAGGGGAGAGGG + Intronic
1078399275 11:11009988-11010010 GTTTGGAGAGGGAGGGGAGAAGG + Intergenic
1079711289 11:23685411-23685433 AGGTGGGGAAGTAGGGGAAAGGG + Intergenic
1080550335 11:33369103-33369125 GGGAGGGGAGGTAGGGGAGAAGG - Intergenic
1081611799 11:44567383-44567405 GTGTGTGTATGTAGGGCAGGGGG + Intronic
1081663889 11:44905271-44905293 GTGGATGGATGTAGGGGAGATGG - Intronic
1081668433 11:44930035-44930057 GTGTGGGGAGGTAGGAGCGAGGG - Exonic
1081729457 11:45359532-45359554 GTGTTGGGATGGAGAGGTGATGG + Intergenic
1083493551 11:63030919-63030941 CTGGGGGGCTGTGGGGGAGACGG + Intergenic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1084006140 11:66324685-66324707 GTGTGGGCCTGTGGGGGTGAGGG + Intergenic
1084480040 11:69414864-69414886 CTGTGGAGCTGTTGGGGAGAAGG + Intergenic
1084609956 11:70195695-70195717 GTGTGAGGAAGAGGGGGAGAAGG - Intergenic
1085399805 11:76229070-76229092 GTTTGGGGAGGTGGGGGAGATGG + Intergenic
1085639009 11:78179567-78179589 GAGTGAGGATGTAGGGGTGCAGG - Intronic
1087681129 11:101219484-101219506 GTGAGGGGCTGTGGTGGAGAGGG + Intergenic
1088389158 11:109294684-109294706 GTGTGGGTATGTGTGTGAGAGGG + Intergenic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1089013330 11:115147643-115147665 GTGTGGGGGGGTTGGGGAGTGGG + Intergenic
1089184763 11:116607306-116607328 GTTTGGGGCTGTTGGGTAGAGGG - Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1090781176 11:130008000-130008022 GTTTGGGGTTGTCGGGGAGAAGG + Intergenic
1091207027 11:133828756-133828778 GAGTGGGGAGGCAGGGAAGAAGG + Intergenic
1091305078 11:134531525-134531547 GCCCGGGGATGTGGGGGAGAGGG - Intergenic
1091796682 12:3301248-3301270 GAGTGAGGATGAAGGGGAGCAGG + Intergenic
1092045339 12:5428484-5428506 GGGTGGGGATGGAGGGGGTAGGG + Intergenic
1092203713 12:6603169-6603191 GGGGGCGGGTGTAGGGGAGATGG - Intronic
1092230511 12:6773253-6773275 TTGTGGGGCTGCAGGGGAGCTGG - Exonic
1092276054 12:7061706-7061728 ATGTGGGGATGTTGGTGATATGG + Intronic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1094207175 12:27852964-27852986 GTGTGGGGGAGAAGGGGAGTAGG - Intergenic
1094207178 12:27852972-27852994 TTGTGGGAGTGTGGGGGAGAAGG - Intergenic
1095342418 12:41107163-41107185 GTGTTTGGGTGTTGGGGAGATGG - Intergenic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1096028679 12:48391496-48391518 GGGTAGGGATGTGGGGGACAGGG - Intergenic
1096538535 12:52290297-52290319 GTGTGGGAAGGTGGGGCAGATGG + Intronic
1096540244 12:52303067-52303089 GTGTGGGAAGGTGGGGCAGATGG - Intronic
1096876666 12:54634977-54634999 GTTTGGGGAAGAAGGGGAGGAGG - Intergenic
1097059278 12:56270342-56270364 GTGTAGGGAAGTGGGGTAGAAGG - Exonic
1097124548 12:56763471-56763493 GTGTGTGTGTGTAGGGGATATGG + Intronic
1097153572 12:56996488-56996510 TTGGGGGGATGTAGAGGGGAGGG + Exonic
1097167411 12:57093231-57093253 GGGTGGGGGAGTAGGGGAGGGGG + Intronic
1097173384 12:57129347-57129369 TTGTGAGGATGTAGGGGAGGCGG - Intronic
1097195151 12:57238984-57239006 GTGTGGGGAGCGAGGAGAGATGG - Intronic
1097410027 12:59240711-59240733 GTGTGAGAATTTGGGGGAGATGG - Intergenic
1097863915 12:64543482-64543504 GTGTGGGGGAGTGGGGGAGTGGG - Intergenic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1098091109 12:66902202-66902224 GTCTGGGGAGGTGGGAGAGAGGG - Intergenic
1098230313 12:68366442-68366464 TAGAGAGGATGTAGGGGAGATGG - Intergenic
1098807481 12:75037775-75037797 GTGTGGGGATGTGGGGATGTGGG + Intergenic
1098807487 12:75037783-75037805 ATGTGGGGATGTGGGGGGGTGGG + Intergenic
1099438161 12:82668317-82668339 GTGGGGGGAAGGAGGGGAGGAGG - Intergenic
1099978038 12:89566804-89566826 TTGTGGGGATGTGTGGGAGGTGG + Intergenic
1100220931 12:92504014-92504036 GCTGGGGGATGTAGGGGATATGG + Intergenic
1100264771 12:92965277-92965299 GTGTGGGGGTTAAGGGGAGGGGG - Intergenic
1100529621 12:95451558-95451580 GGATGGGGAGGTAGAGGAGAGGG + Intergenic
1100552061 12:95654935-95654957 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552124 12:95655191-95655213 ATGTGGGGATGTTGGGATGATGG + Intergenic
1101244234 12:102870147-102870169 GTGGGTGGGTTTAGGGGAGAGGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1102458799 12:113087492-113087514 GTGGGGGGAGGAGGGGGAGAAGG + Intronic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1102948516 12:117011383-117011405 GGGTGGGTATCTAGGGGTGAAGG - Intronic
1103120662 12:118376890-118376912 GGGTGGGGCTGTTCGGGAGAGGG + Intronic
1103130511 12:118464451-118464473 CTTTGGGGATGCAGGGGAAAGGG - Intergenic
1103443526 12:120979958-120979980 GGATGGGGGTGTGGGGGAGAAGG + Intronic
1104110676 12:125701092-125701114 CTGTGGGGTTGTGGGGGAGGTGG + Intergenic
1104636237 12:130439527-130439549 GTGTGGGTCTGTAGGGGTGTCGG + Intronic
1105326029 13:19371178-19371200 ACATGGGGATGTAGGGGAGGAGG + Intergenic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1106014595 13:25856747-25856769 GGCTGGGGAGGAAGGGGAGAAGG - Intronic
1106287039 13:28326947-28326969 GTGTCAGGAAGTAGGGGAAAGGG + Intronic
1106388924 13:29316488-29316510 GAGTCGGGGTGTTGGGGAGAGGG - Intronic
1106402530 13:29443872-29443894 GTGGGGGGACATGGGGGAGATGG + Intronic
1107119272 13:36779198-36779220 GTGTGGGGTTGTGGGGGAGCAGG + Intergenic
1107526581 13:41238473-41238495 GTGTGGGGTAGGAGGTGAGAAGG + Intronic
1108650329 13:52471967-52471989 ATTCAGGGATGTAGGGGAGAGGG - Intronic
1109444719 13:62419771-62419793 GGGTGGGGGTGTACGGGAAAAGG + Intergenic
1109536204 13:63722979-63723001 GTGAGAGGAAGGAGGGGAGATGG + Intergenic
1109539896 13:63763307-63763329 GTGAGAGGAAGGAGGGGAGATGG - Intergenic
1110303934 13:73962574-73962596 GTGTAGGGATGAGGGGTAGATGG + Intronic
1110456345 13:75694351-75694373 GTGTGAGAATGAAGGGGCGAAGG + Intronic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1113055168 13:106259847-106259869 GTGTGGGGGTGTGGGGGTGTGGG + Intergenic
1113239247 13:108318054-108318076 GAGCGTGGATGTAGGGAAGAGGG - Intergenic
1113775497 13:112942863-112942885 ATGTGGGGATGGTGCGGAGAAGG - Intronic
1113874146 13:113584308-113584330 GTGTGTGCATGTGGGGGAGCGGG - Intergenic
1113922534 13:113921518-113921540 GGATGTGGAAGTAGGGGAGATGG - Intergenic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114630276 14:24155127-24155149 GTGAGGGGTTGGAGGGGAGGGGG - Intronic
1114777341 14:25498677-25498699 GATGGGGGGTGTAGGGGAGAAGG + Intergenic
1114885284 14:26842391-26842413 GTGTGGGGTGGTAGGGGTGGAGG - Intergenic
1115755870 14:36525481-36525503 TGTTGGGGATGTGGGGGAGACGG - Intergenic
1116844727 14:49854620-49854642 GACTTGGGATGTAGGGGAAATGG + Intergenic
1117069945 14:52047404-52047426 GTGTGGGCATGTGGGAGGGATGG + Intronic
1117157515 14:52955424-52955446 GTGGGGGGAGGTGGGGGAAAAGG - Intergenic
1118178775 14:63470053-63470075 GTGTGGGGAGGTAGGAGATGAGG - Intronic
1118591199 14:67402560-67402582 GTGAGGGGCTGCCGGGGAGATGG - Intronic
1118834573 14:69467776-69467798 AGGTGGGGATTTGGGGGAGATGG + Intergenic
1119031639 14:71197325-71197347 CAGTGGGGAGGTAGGGGAGCTGG - Intergenic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1119744110 14:77032400-77032422 GTTTGGGGATGTGTGAGAGACGG + Intergenic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1120015707 14:79470986-79471008 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
1120711952 14:87801876-87801898 GTGTGTGGATGTAGGGGACAAGG - Intergenic
1120780660 14:88482801-88482823 GTGAGGGGATGTGGGGGTGCTGG + Intronic
1120900998 14:89575390-89575412 GGGTGGGGATGATAGGGAGAAGG + Intronic
1121101791 14:91254427-91254449 CTGTGAGGATGTGGGGCAGAGGG - Intergenic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1122348273 14:101073598-101073620 GTGTGGGGGTGGCGGGGAGGAGG + Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122780680 14:104142186-104142208 GTCTGGGGCCGTAGGGGAGGGGG + Intronic
1122893313 14:104742907-104742929 GTGTGGGGATGTCCGGGAGCTGG + Intronic
1123397746 15:19954207-19954229 GTGAGGGGGTGTGGGGGGGAGGG + Intergenic
1123696905 15:22884970-22884992 GGGTGGGGAGGTGGGGGAGGGGG + Intronic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124035828 15:26052936-26052958 GTGTGAGGATGTAGGGTGAAAGG - Intergenic
1124139363 15:27063875-27063897 GTGTGGGGAAGTGGGTGAGCAGG - Intronic
1124208999 15:27746793-27746815 GGATGGGGATGTGGGAGAGAGGG - Intergenic
1124474984 15:30025558-30025580 TTGTGGGTAGGTAGGGGAAAGGG - Intergenic
1124563879 15:30797901-30797923 GTGGGTGGATGGAAGGGAGAGGG + Intergenic
1125135961 15:36342887-36342909 GTCTGAGGATGGAGAGGAGAAGG + Intergenic
1125260352 15:37817021-37817043 GTGAGGGGATAAAGTGGAGATGG + Intergenic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125573503 15:40739129-40739151 GAGGGGGGATGTGGGGGAGAAGG - Intronic
1125591285 15:40856081-40856103 GGGTGGGCATGTATGGGGGAAGG + Intronic
1125873019 15:43119556-43119578 GTGAAGGGAAGAAGGGGAGAAGG + Intronic
1126336029 15:47587213-47587235 GTGGGGTGAGGTAGGGCAGAGGG - Intronic
1126634358 15:50766581-50766603 GTGTGGGAAAGTAGTGAAGATGG - Intergenic
1126905732 15:53362706-53362728 GTGTGTGGATGTGGGGGCGGGGG - Intergenic
1127251950 15:57247973-57247995 GGGTGGGGTGGTGGGGGAGAAGG - Intronic
1127281769 15:57499062-57499084 GTGTGGGGATGGATTGGAAAGGG + Intronic
1127365331 15:58284247-58284269 GTACGGGGATGGAGTGGAGAAGG + Intronic
1128278013 15:66370467-66370489 GTGGGGGGCTGGAGGGGAGGAGG + Intronic
1129220190 15:74127993-74128015 GTGTGTGGAAGTAGGGGTGGGGG - Exonic
1129330977 15:74826959-74826981 GTCTAGGAAAGTAGGGGAGAAGG - Intronic
1129535944 15:76313814-76313836 GGGTGGGGAGGTAGGGAAGGAGG - Intergenic
1131263071 15:90899414-90899436 GTGTGAAGATGGAGGGGAAAAGG + Intergenic
1131807974 15:96142732-96142754 ATATAGGGATCTAGGGGAGAAGG - Intergenic
1132023027 15:98381171-98381193 GTGTTGGGATGTAAGATAGAAGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132146383 15:99432250-99432272 GAATGGGGATGTAGTGGGGAGGG + Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132362726 15:101231067-101231089 GTATGGGGCTGTAGGGGTGGTGG + Intronic
1132675837 16:1120943-1120965 TTGAGGGGATGTCGGGGCGAGGG - Intergenic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1133031772 16:3014451-3014473 GGGTGGGGATGTTGGGGAGAGGG - Exonic
1133215630 16:4290602-4290624 GTGAGCTGATGGAGGGGAGACGG - Intergenic
1133357628 16:5148246-5148268 GTGTGGGGGTGCAGGGGTGCAGG - Intergenic
1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG + Intronic
1134213951 16:12301430-12301452 ATGTGGAGATTTGGGGGAGAGGG - Intronic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1135160273 16:20088329-20088351 GTGGGGGGTTGTTGGGGAGGTGG + Intergenic
1135194835 16:20386029-20386051 GTGTGGGGAGGGCGGGGATAGGG + Intronic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1135979774 16:27138826-27138848 GTGTGGTGATGTGGTGGTGATGG + Intergenic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1137024706 16:35460902-35460924 GTGTGTGTGTGTTGGGGAGAGGG + Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137818848 16:51424571-51424593 GTTTGGAGGTGTGGGGGAGACGG + Intergenic
1137895113 16:52203859-52203881 GTGGGGTGGTTTAGGGGAGATGG - Intergenic
1138448164 16:57077659-57077681 GTGCTGGGGTGTCGGGGAGAGGG + Intronic
1139099158 16:63744493-63744515 GTGTGGGGAAGGAGAGGTGATGG - Intergenic
1140194259 16:72843998-72844020 GTGTGCGGATGTAGGAGAGGGGG - Intronic
1140245290 16:73242839-73242861 GTGTGGAGGTGTGGGGTAGAGGG + Intergenic
1140732720 16:77871214-77871236 GTGGGAGGAGGTAGGGGAGGTGG - Intronic
1141007103 16:80362869-80362891 GTGTGTGTATGTGGGGGTGAGGG + Intergenic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141178284 16:81734900-81734922 GTGTGGTGGGGTGGGGGAGAGGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142024769 16:87806581-87806603 GCGTGGGGATGTAAGGCAGTGGG - Intergenic
1142249932 16:88986564-88986586 CTGTGGGGCTGTAGGGGGGCAGG - Intergenic
1142993220 17:3745866-3745888 ATGTGGGGAAGCAGAGGAGACGG - Exonic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143866480 17:9927276-9927298 GTGTGTGTATGTAGTAGAGATGG - Intronic
1145031460 17:19507792-19507814 GCGAGGGGACGCAGGGGAGAAGG - Intronic
1145063924 17:19749198-19749220 GTGGGTGGATGTAGGGGAAGGGG - Intergenic
1145398560 17:22514223-22514245 GGGTGGGGTGATAGGGGAGATGG - Intergenic
1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG + Intronic
1146351856 17:32101933-32101955 ATGTAGAGATGTAGGGGAGGAGG + Intergenic
1146419934 17:32674157-32674179 GTGTGGGGGTGGAGTGGAAACGG + Intronic
1146518073 17:33504913-33504935 GTGTGGGGCTATGGGGGTGAGGG + Intronic
1146675247 17:34768845-34768867 GTGTGGTGGTGCAGGTGAGAGGG - Intergenic
1146941591 17:36847350-36847372 GTGTGGGGAGGGAGGTGGGAGGG + Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1148243486 17:46014969-46014991 GTGAGGGGATGGTGGGGGGATGG + Intronic
1148331338 17:46815598-46815620 GGCTGGGGCTGTAGGGTAGATGG - Intronic
1148507070 17:48135897-48135919 ATGTGGGGATTTTGGGGAAATGG + Intronic
1148977535 17:51542803-51542825 GTGTGGGGAGACATGGGAGAAGG - Intergenic
1149085157 17:52708039-52708061 GTGTGGGGTTGGTGGGGAGGTGG + Intergenic
1149461622 17:56834014-56834036 GTGTGAGGTGGGAGGGGAGACGG - Intronic
1149660148 17:58330598-58330620 GTTTGGGTATGTAGGGGGGCAGG + Intergenic
1149869257 17:60168077-60168099 ATGTAGAGATGTAGGGGAGGAGG + Intronic
1149979353 17:61297284-61297306 GGCTGGGGATGGAGGAGAGAAGG + Intronic
1150561905 17:66302293-66302315 GAGTGGGGATGCGGGGGAGGAGG - Intergenic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1150810727 17:68354949-68354971 GTGTGTGCATGTAGGTGTGATGG + Intronic
1150990444 17:70251735-70251757 GTGTGGGCATGTGAGGGAGGGGG - Intergenic
1151438823 17:74115145-74115167 GTGTGGGGAGGTGGCGGTGATGG - Intergenic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151758171 17:76086519-76086541 ATGTTCGAATGTAGGGGAGAAGG - Intronic
1152049412 17:77960053-77960075 GTGCCGGGAGGTAGGGGAGGAGG + Intergenic
1152093717 17:78260717-78260739 GTGTGGGAAAGTGGGGGAGGAGG - Intergenic
1152301098 17:79495605-79495627 GGGTGGGGAGGTGGGGGAAAGGG + Intronic
1153765836 18:8374308-8374330 GTGTGGGGTTTTTGGGGAGTGGG - Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155534405 18:26802028-26802050 GTGTGGGGAGGAGGTGGAGATGG + Intergenic
1155569898 18:27181914-27181936 TTGTGGGGAGGTGGGGAAGATGG - Intronic
1155615980 18:27722142-27722164 GTGTGGGGGTGTAAGGTACAAGG - Intergenic
1155724486 18:29062639-29062661 AGGTGTGGAGGTAGGGGAGAGGG - Intergenic
1156006780 18:32451588-32451610 TTGTGGGAATGTAGTGGAGCAGG - Intronic
1156104865 18:33647860-33647882 GAGTGGGGGAGTAGGGGAGAGGG + Intronic
1156354788 18:36331786-36331808 GTGTGGCCATGCAGGGGAGTGGG + Intronic
1156525112 18:37759647-37759669 CTGTGGTGATGTGGGGTAGATGG - Intergenic
1157211560 18:45747084-45747106 GTGTGGGGATGTGGCAGACATGG - Intronic
1157841028 18:50958634-50958656 GTGTGGTGTTGCAGGGGATAAGG + Intergenic
1158391640 18:57049894-57049916 GGCAGGGGAGGTAGGGGAGATGG - Intergenic
1158830873 18:61277306-61277328 GTGAGGGGAAGTAGAGCAGAGGG + Intergenic
1159018331 18:63121406-63121428 TTCTGGGGATGGAGGAGAGAGGG - Intergenic
1159121844 18:64180036-64180058 GTGTGTGGGTCTAGGGGAGCTGG - Intergenic
1159438575 18:68448644-68448666 GGCTGGGGATGTGGAGGAGATGG - Intergenic
1160174230 18:76579700-76579722 GGGAGGGGATATAGGGCAGACGG + Intergenic
1160216999 18:76941043-76941065 GGTAGGGGATGTTGGGGAGATGG - Intronic
1161382015 19:3970657-3970679 GTTTTGGGGGGTAGGGGAGACGG - Intronic
1161849377 19:6730831-6730853 GAGAAGGGATGGAGGGGAGATGG - Intronic
1162125596 19:8498196-8498218 GTGTGGGGAGGAAGCGGAGGTGG - Intronic
1162335220 19:10055968-10055990 ATGTGGGGATGAAGAAGAGATGG - Intergenic
1162736533 19:12750087-12750109 GTGTGGGGATGCGGGTGAGCTGG + Intergenic
1162805719 19:13137115-13137137 GGGTAGAGATGTAGGGGAGAAGG + Intronic
1164452956 19:28382417-28382439 GTGTGGGGAAGGAAGGGAGGTGG - Intergenic
1164614929 19:29661634-29661656 GGGTAGAGATGTAGGGGAGGCGG - Intergenic
1165148838 19:33749441-33749463 GTGGGGGGATGGTGGGGAGATGG - Intronic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1166326466 19:42053936-42053958 GGGTGGGGAGGTGGGGCAGAGGG + Intronic
1166381903 19:42359083-42359105 GGGCGGGGCTGTTGGGGAGACGG - Exonic
1166577318 19:43854449-43854471 GTTTGTAGATGTAGGGGACAGGG + Intergenic
1166633049 19:44424856-44424878 GAGTGGGTTGGTAGGGGAGATGG - Intronic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1167003042 19:46757012-46757034 GTGGAGGGATGTCGCGGAGAGGG + Exonic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167284512 19:48591584-48591606 GTGTGCGGATGGTGAGGAGAGGG - Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168292872 19:55365636-55365658 GGGTGGGGACGGAGGGGAAAGGG - Exonic
1168333202 19:55581134-55581156 GTGTGTGCATGTTGGGGAGCCGG - Intergenic
925056349 2:860524-860546 GGGTGGGGGTCCAGGGGAGAGGG - Intergenic
925059194 2:878165-878187 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059207 2:878211-878233 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925293989 2:2765918-2765940 GTATGGGGAAGGAGGGGACAGGG - Intergenic
925878703 2:8332982-8333004 GTGTGGGGGTGTGGGGGCGAGGG - Intergenic
925989101 2:9239449-9239471 GTGTGGTGATGGAGGGGTGGTGG + Intronic
926096897 2:10087221-10087243 GTGTGTGTGTTTAGGGGAGAGGG - Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926224891 2:10960785-10960807 GTGAGGGGAGGTGGGGGAGCTGG + Intergenic
926337422 2:11875086-11875108 GTGAGGGGATGGGGGGGCGAGGG - Intergenic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
927245462 2:20953967-20953989 GTGTTGGGATGTAGGGTGTATGG + Intergenic
927428614 2:23007993-23008015 GGGTGGGGCTGAAGGGGAGAGGG + Intergenic
927646978 2:24884063-24884085 GTGAGAGGCTGTAGGGAAGAGGG - Intronic
927668655 2:25050434-25050456 GTGTGGGGGTGCAGGGGTAAGGG + Intronic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
929052450 2:37849646-37849668 GTGTGGGGATGGGGGTGAGGTGG - Intergenic
929087035 2:38178534-38178556 GAGCGGGGCTGTAGGAGAGAAGG + Intergenic
929694592 2:44103481-44103503 GTGTTGGGATGAAGCGGAGGAGG + Intergenic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930602297 2:53456596-53456618 GTGTAGGGTTGTAGGGCAGGTGG + Intergenic
930836357 2:55797962-55797984 CTTTGGGGATGTAGGGGAAAGGG + Intergenic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
931854620 2:66288965-66288987 TTGGGGGGATTGAGGGGAGATGG - Intergenic
932067461 2:68580821-68580843 GTGTGTGCATGTGGGGGAGGGGG + Intronic
932809301 2:74810843-74810865 GTGTGTGGGTGTTGGGGAGGGGG + Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933645826 2:84811963-84811985 GTGTGAGGAGGAGGGGGAGATGG - Intronic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
934106352 2:88698589-88698611 GGGTAGGGAGGTAGAGGAGAGGG + Intronic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
936267788 2:111023553-111023575 GTGTGGGGACGTGTGGGAGAAGG + Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937855125 2:126666690-126666712 GTGTAGGGAGGGAGGGGAGGGGG - Intronic
938980662 2:136523005-136523027 GTTTGGGGATGTCAGAGAGAAGG + Intergenic
939602918 2:144216040-144216062 GTCTGGGGAAGTTGGGGAAAAGG - Intronic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
940555451 2:155221155-155221177 GGGTGGGGAGGAAGTGGAGATGG + Intergenic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941867239 2:170347906-170347928 GTCAGGGGCTGGAGGGGAGAAGG - Intronic
941924878 2:170884765-170884787 GTGTGAGGCTGTAAGGGGGAAGG - Intergenic
943158030 2:184209895-184209917 GAGTGGGGATGTGGGGGTGTGGG + Intergenic
943702906 2:191005827-191005849 GTCTGGGGATGTCAGGGAAAGGG - Intronic
944580124 2:201125219-201125241 GTGTGGCTGTGTAGAGGAGATGG + Intronic
945490086 2:210444338-210444360 GCGTGTGGAAGTAGTGGAGAGGG - Intronic
946051919 2:216869931-216869953 CTGTGGGGCTCTAGGGGATAGGG + Intergenic
946519973 2:220453821-220453843 CTGTGCTGATGTAGGGGAAAGGG + Intergenic
946658805 2:221977488-221977510 ATGTGGGGATATTGGGGTGAAGG + Intergenic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948091784 2:235301725-235301747 GAGGGGGGATGAGGGGGAGAAGG - Intergenic
948172594 2:235917151-235917173 AGGGGGGGATGTAGAGGAGAAGG - Intronic
948470460 2:238174241-238174263 GTGAGGGGATATGGAGGAGATGG + Intronic
948610308 2:239162425-239162447 GCGTGGGGTTGCAGGGCAGAAGG - Intronic
948733158 2:239979966-239979988 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948733172 2:239980008-239980030 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
1169285159 20:4301636-4301658 GTGGGGAAATGTAGGGGAGTAGG - Intergenic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1170394906 20:15915674-15915696 GTGTGGGGGTGTAGGGAGGCAGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170894036 20:20398361-20398383 GTCTGGGGATGCACAGGAGAGGG - Intronic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171077688 20:22145623-22145645 GTGAGGGGATGGCGTGGAGAAGG + Intergenic
1171104909 20:22423558-22423580 GTGTGAGGATGAAGTGGAGTAGG - Intergenic
1171255976 20:23689227-23689249 GAGTGGGGAGGAGGGGGAGATGG - Intergenic
1171263324 20:23751124-23751146 GAGTGGGGAGGAGGGGGAGATGG - Intronic
1171448853 20:25222506-25222528 GAGGGGGAATGTAGGGCAGATGG + Intronic
1171486683 20:25490810-25490832 GTGTGGGGAGTTAGGAGAGGAGG + Intronic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1172104846 20:32510791-32510813 GTGTGGGAAGGCAGGCGAGAGGG + Intronic
1172285010 20:33734139-33734161 CTGTGGAGATCTAGGGGAGGAGG + Intronic
1172640569 20:36437912-36437934 TTGTGGGGATGTGGGGAACAGGG + Intronic
1172794417 20:37527336-37527358 GTGGGGGGACGTGGGGGTGAGGG - Intronic
1173134901 20:40431061-40431083 GTCTGGGGATCATGGGGAGATGG + Intergenic
1173186857 20:40846908-40846930 GTGTTGAAAAGTAGGGGAGAAGG - Intergenic
1173215915 20:41083299-41083321 ATGTGGGTATGTTTGGGAGAAGG - Intronic
1173598217 20:44273785-44273807 GAGTGAGGATGTGGGGGAGGTGG - Intronic
1173817711 20:46000438-46000460 GTGCTGGGATGCAGGGAAGATGG - Intergenic
1174137869 20:48393032-48393054 GCCTGGGGATAAAGGGGAGATGG + Intergenic
1174329226 20:49804604-49804626 GAGTTGGGATGCAGGGGAAAAGG + Intergenic
1175064008 20:56269950-56269972 GAGTGGAGATGTGAGGGAGAGGG - Intergenic
1175259912 20:57667801-57667823 GTGGGGGTAGGTAGGGGAGAGGG - Intronic
1175273824 20:57753947-57753969 GAGTGGGGATGAAGGAGAGGAGG + Intergenic
1175708804 20:61202739-61202761 GTGTGAGGCTGTGTGGGAGAAGG - Intergenic
1175792165 20:61746525-61746547 GTGTGGGGAAGGAGTGGAAAAGG + Intronic
1175934980 20:62510231-62510253 GTGGTGGGATGGAGGGGTGAAGG - Intergenic
1175935009 20:62510307-62510329 GTGGTGGGATGGAGGGGTGAAGG - Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1176365285 21:6029107-6029129 GTGTGAGGATGCAGGGCAGATGG + Intergenic
1177175030 21:17693923-17693945 ATGTGGGGAAGGATGGGAGAAGG + Intergenic
1177763202 21:25426080-25426102 CTTTGGGGACTTAGGGGAGAAGG - Intergenic
1177822719 21:26049172-26049194 GCCTGGGGGTGTGGGGGAGAGGG + Intronic
1178806701 21:35845464-35845486 GTAGGGGGAGGTGGGGGAGAAGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179586462 21:42376698-42376720 GTGAGGGGATGTGTGTGAGAAGG + Intronic
1179758233 21:43509438-43509460 GTGTGAGGATGCAGGGCAGATGG - Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181118719 22:20650840-20650862 GTGTGGGAATTGTGGGGAGAAGG - Intergenic
1181305761 22:21916467-21916489 GGGTGGGGATGGAGGTGAAAGGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1181568485 22:23753546-23753568 GGGCGGGGAAGTGGGGGAGAGGG - Intronic
1181751466 22:24991930-24991952 GTGTGGGGAGGTTGGGGACTGGG + Intronic
1182944862 22:34312349-34312371 GCCTGGAGATGAAGGGGAGAAGG - Intergenic
1182970728 22:34573618-34573640 CTATGGGGATTTAGGGGAAAAGG - Intergenic
1183281720 22:36935927-36935949 GTGTGGGGATGCCTGGGACAGGG + Intronic
1183661224 22:39222587-39222609 CACTGGGGATTTAGGGGAGAAGG + Intergenic
1183976546 22:41515583-41515605 TGGTGGGGATGAACGGGAGACGG + Intronic
1184104575 22:42360040-42360062 GTGTGGGGATGGATTGGGGAAGG - Intergenic
1184205269 22:42998382-42998404 GTCAGGGCATGTTGGGGAGATGG - Intronic
1184220094 22:43094504-43094526 GTGGTGGGAAGTGGGGGAGAAGG - Intergenic
1184386866 22:44181571-44181593 GTTTGGGGAAGGCGGGGAGAGGG + Intronic
1184420774 22:44381760-44381782 GTGTGGGGAGGAAGGGGAAGGGG + Intergenic
1185039201 22:48495814-48495836 GTGTGGTGAGCCAGGGGAGAGGG - Intronic
1185275972 22:49950369-49950391 GTGGGGGGATGTGGGGGACAGGG + Intergenic
949359997 3:3221570-3221592 TGATGGGGATGAAGGGGAGAAGG - Intergenic
949387647 3:3521203-3521225 GAGTGGGGAAGTGGGTGAGAAGG - Intergenic
950634783 3:14307234-14307256 GGGTGGGGATGCAGGGGAGGTGG + Intergenic
950729138 3:14941546-14941568 GTGGGGGGATGGAGGGGCAATGG + Intergenic
950774315 3:15336557-15336579 ATGAGGGGATGTGGGGCAGAGGG + Intronic
950813647 3:15674927-15674949 GTGTAGGGGTGAGGGGGAGAAGG + Intronic
952966507 3:38624198-38624220 GTGTGTGTGTGTAAGGGAGAAGG - Intronic
953134742 3:40172761-40172783 GTGGGGGAAGGAAGGGGAGAGGG - Intronic
953227694 3:41035441-41035463 GAGTGGGGAAGAAGGGGAGAAGG - Intergenic
953358624 3:42275741-42275763 GTGTGGGGGTCTAGGGGAATGGG + Intergenic
953669830 3:44952899-44952921 GTCTTGTGATGTAGGAGAGATGG - Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
955180518 3:56664715-56664737 TTATAGGGATGTAGGTGAGATGG - Intronic
955302011 3:57789264-57789286 GTGTGGGGATTGCGGGGCGAGGG + Intronic
955353341 3:58210030-58210052 GAGTGGGGAAGTAGAGGAGAGGG + Intronic
955588682 3:60510701-60510723 GTGGGGGGAGGTGGGGGAGCAGG - Intronic
955780886 3:62483296-62483318 GGGTGGGGAAGTGGGGGAGTAGG + Intronic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
956737833 3:72251987-72252009 GTGTTGGGGGCTAGGGGAGAGGG - Intergenic
957267392 3:77984541-77984563 GTGGGGGGTTGTGGTGGAGATGG - Intergenic
959476449 3:106818106-106818128 CTGTAGAGAAGTAGGGGAGAAGG + Intergenic
959886840 3:111512585-111512607 TTGTGGGGAGGTAAGTGAGAGGG + Intronic
960235509 3:115277561-115277583 GGGTGGGGAGGCAGTGGAGATGG - Intergenic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961511517 3:127406644-127406666 GTGGGGGAATGTTGGGCAGAGGG + Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961865860 3:129953061-129953083 GGGTGAGGATGGAGTGGAGAGGG - Intergenic
961951822 3:130757506-130757528 GTGTGTGTGTGTCGGGGAGAGGG - Intergenic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
962406042 3:135100944-135100966 GTGTGGTGAGGTCGGGGAGAGGG + Intronic
962621890 3:137188559-137188581 GCATGGGGATCTAGGGAAGAGGG - Intergenic
962679039 3:137779996-137780018 GTGGTGGGATGAAGGGGAAATGG + Intergenic
963612789 3:147493108-147493130 GTGTGGAGATGTTGGAGAGATGG + Intronic
964663837 3:159151014-159151036 GTGTGGGAATGCAGGTGGGAAGG + Intronic
966026301 3:175286989-175287011 GTGTGGGGATGGGGCGGAGGTGG + Intronic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
969539449 4:7777784-7777806 GTGTGGGGATTTACAGGTGATGG - Intronic
969599149 4:8165640-8165662 GTGTGGGCATGGAAGGGATAAGG + Intergenic
969860309 4:10030569-10030591 GTGTGTGGGTGTAGGGGGGCAGG + Intronic
970142333 4:12996168-12996190 CTGCAGGGATATAGGGGAGATGG - Intergenic
970641316 4:18069476-18069498 GTGGAGGGAGGTAGGGGAGGTGG - Intergenic
972410070 4:38784673-38784695 GTTTGGAGATGGAGGAGAGATGG - Intergenic
972904652 4:43729673-43729695 GGGTCGGGAGGGAGGGGAGAGGG + Intergenic
973561727 4:52143867-52143889 GAGTGGGGGTGTGGGTGAGAAGG - Intergenic
973743431 4:53940276-53940298 CTGTGGGGAGGTGGGGGATAGGG + Intronic
973970203 4:56205562-56205584 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
974394136 4:61313475-61313497 GTGTGCCCATGCAGGGGAGAAGG + Intronic
975162776 4:71143085-71143107 GTGGGGGGATGGGGGAGAGATGG - Intergenic
975222971 4:71835110-71835132 GTGTGGAGAAGTAGGAGAAAAGG - Intergenic
975530478 4:75394892-75394914 GTGGGGACATGTGGGGGAGAAGG - Intergenic
975541227 4:75514283-75514305 GTGAGGGGAGGTGGAGGAGATGG - Exonic
975997111 4:80328497-80328519 GTGTGGGTAGGTAGGGGTGGGGG + Intronic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
977090824 4:92673825-92673847 GGGTGGGGAGGAAGGGGGGAGGG + Intronic
978229440 4:106381012-106381034 GTTTGGAAAGGTAGGGGAGAGGG + Intergenic
978763909 4:112384760-112384782 GAATGGGGATATAGTGGAGAGGG + Intronic
979129260 4:117019975-117019997 TAGTGGGGCTGTAGGGGAGTGGG + Intergenic
979197322 4:117935978-117936000 CTGTTGGGATGTGGGGGTGAGGG - Intergenic
980096609 4:128497860-128497882 GTAGGGGGAAGTAGGGAAGAGGG - Intergenic
981010278 4:139918321-139918343 GTGTGGTGGTGAAGGGGAGAAGG - Intronic
981289414 4:143056778-143056800 GTGAGGGGATGCTGGGGGGAAGG + Intergenic
981550633 4:145937851-145937873 GTTTGGGGGTGTCGGGGAGAGGG - Intronic
981937255 4:150250894-150250916 GTGTGGGGATGTGGGGGGTGTGG - Intronic
982065722 4:151652816-151652838 GGGTGGGGAGGTGGGAGAGAAGG + Intronic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982807300 4:159782413-159782435 GTGTGGGGATAGAGGGCATATGG - Intergenic
983474288 4:168195692-168195714 GTATGGGCATGGAGTGGAGAGGG - Intergenic
983804183 4:171973075-171973097 GTGTGTGTATGTTGGGGAGGAGG - Intronic
984720791 4:182970844-182970866 GAGTGGGGATGTAGGGAGGAAGG + Intergenic
984814604 4:183825005-183825027 GTGTGAGGAGATAGGGGACATGG - Intergenic
984846180 4:184109976-184109998 GCGGGAGGATGTGGGGGAGATGG + Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985674121 5:1221541-1221563 GAGTTGGGAGGTAGGGGAAAGGG + Intronic
985812289 5:2098992-2099014 GTGTGGGGCTGCAGAGGAGTTGG - Intergenic
985904995 5:2827454-2827476 GGGTTGGGATGTGGGGGAGATGG + Intergenic
985998337 5:3610366-3610388 GGATGGGGATGTTGGGGAGGAGG + Intergenic
986502825 5:8418010-8418032 TTGTGGGGTTGCAGTGGAGAAGG - Intergenic
986669864 5:10133243-10133265 GTGTGGGGACAGAGGGGATAAGG - Intergenic
986755456 5:10831859-10831881 GTGGGGGGATAGAGGAGAGAGGG + Intergenic
987009911 5:13751856-13751878 GGGTGGGGCAGAAGGGGAGAGGG + Intronic
987032299 5:13987155-13987177 GTGTGGAGAAGCAGGGGAGGAGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987595155 5:19988369-19988391 GTGGGGGGTTGGGGGGGAGAAGG - Intronic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
988676585 5:33439633-33439655 GCGTGGGGATTTAGGGGAGTGGG + Intergenic
988735478 5:34016215-34016237 GTGCGGGGGTGGTGGGGAGAGGG + Intronic
989122749 5:38020656-38020678 ATGTGGGGATGGATGGGAGTAGG - Intergenic
989668337 5:43883257-43883279 GTATGCAGATGTAGGAGAGAGGG + Intergenic
989679211 5:44009282-44009304 CTCAGGGGAAGTAGGGGAGAGGG - Intergenic
990363328 5:55043733-55043755 GTGTTGGGGTGTGGGGGAGTGGG - Intergenic
990505257 5:56437670-56437692 CTTTGGGGATTTAGGGGAAAAGG + Intergenic
990719420 5:58676594-58676616 GTGCGGGGTGGTAGGGGAGGTGG + Intronic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991044804 5:62211428-62211450 GTGTGTGTTTGTATGGGAGAGGG - Intergenic
991601773 5:68358273-68358295 GTTTGGGCAGGTAGGGGAGCAGG - Intergenic
992293587 5:75305114-75305136 GTGTGAGGCTGTCTGGGAGAGGG + Intergenic
992334472 5:75751465-75751487 GGTTGGGGTTGGAGGGGAGAGGG + Intergenic
992605524 5:78452325-78452347 GTGGGGGGAGGGAGGGGGGAGGG - Intronic
993302706 5:86231721-86231743 GTGCGTGGCTGTAGGTGAGAGGG - Intergenic
993373674 5:87122475-87122497 GTGTGTGGATGTTGCAGAGAGGG - Intergenic
993890818 5:93469739-93469761 GAGTGTGGATGTAGGGAATAGGG - Intergenic
994328319 5:98475550-98475572 TTGTGGGGAGGTTGGGGAGGAGG - Intergenic
994497043 5:100526035-100526057 CTTTGGAGATGTAGGGGAAAGGG + Intergenic
994987664 5:106958559-106958581 GTGGAGGGATGAAGGGGAAAGGG - Intergenic
995495790 5:112741483-112741505 GTGTGAGAATAAAGGGGAGAAGG - Intronic
996698117 5:126421413-126421435 GGGTGGGGATCTAGAGGTGAAGG + Intronic
997085859 5:130797643-130797665 GTGTGGGTATGTATGGGTGTGGG - Intergenic
997235172 5:132268348-132268370 GAGTGGGGGTGTTGGGGAGGGGG + Intronic
997340494 5:133140980-133141002 TTGGGGGGATATAGGGTAGAGGG - Intergenic
998131890 5:139655544-139655566 GTGTGGGGAGGTAGGTCAGGAGG - Intronic
998326012 5:141280420-141280442 GGGTGGGGTGGTAGGGGAGAGGG - Intergenic
998391208 5:141788150-141788172 GTGTGGGGGTGTAGAGGGAAAGG - Intergenic
998458721 5:142293789-142293811 GCCTGGGGATGTGGGGGAGAGGG + Intergenic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999585834 5:153088640-153088662 GTGTGGAAATGAAGGGTAGATGG + Intergenic
999946362 5:156600305-156600327 GGGAGGGGATGGAGGAGAGAAGG - Intronic
1000143462 5:158429632-158429654 GTGTGTGTGTGTAGGGGAGGAGG - Intergenic
1000185277 5:158851967-158851989 GGGTGGGGAGGAGGGGGAGAAGG + Intronic
1001273240 5:170331589-170331611 GTGTGGGGAGGTGGGGAAGGAGG + Intergenic
1001295824 5:170498118-170498140 TCCTGGGGAGGTAGGGGAGAAGG + Intronic
1001297946 5:170511905-170511927 GTGCATGGATGTTGGGGAGAAGG + Intronic
1001332585 5:170772710-170772732 GTGTGGGGAAGGAGGGGTGGTGG + Intronic
1001791116 5:174458648-174458670 GTGTGGGGAGGTAGGGAGGTGGG - Intergenic
1001979800 5:176030802-176030824 GGGTGGGGGTGTGGGGGGGAGGG + Intronic
1002089740 5:176797562-176797584 GTGTGCGGGTGTAGGGGAACGGG - Intergenic
1002237501 5:177812657-177812679 GGGTGGGGGTGTGGGGGGGAGGG - Intergenic
1002237572 5:177812847-177812869 GGGTGGGGGTGTGGGGGGGAGGG - Intergenic
1002237623 5:177812973-177812995 GGGTGGGGGTGTGGGGGGGAGGG - Intergenic
1003118501 6:3299739-3299761 GAGTGTGGATGTATGGGAGTGGG + Intronic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003512601 6:6793889-6793911 GTGGGGAGAGGTATGGGAGAGGG - Intergenic
1004009058 6:11663909-11663931 GTGTGTGTGTGTAGGGGAGGCGG + Intergenic
1004024459 6:11805443-11805465 GTGTGGGGATATGGGGGCGGGGG + Intronic
1005840371 6:29741190-29741212 GTGGGGAGATGTGGGGGAGGTGG + Intergenic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006672459 6:35737948-35737970 GGGTTGGGAAGTAGGGGACAGGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007208614 6:40172974-40172996 GTGGGGGGATGGTGGTGAGAGGG - Intergenic
1007250969 6:40494658-40494680 GTGAGGGGATGTTGAAGAGAAGG - Intronic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007371356 6:41428444-41428466 GGGTGGGGGTGTGGGGTAGAGGG - Intergenic
1007574954 6:42919335-42919357 TTGTGAGGATGTAGGGGTAAAGG - Intronic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008191844 6:48468283-48468305 GTGTGGGGATGGAGGAGAAGTGG + Intergenic
1008691916 6:53988471-53988493 GGGTGGTGTTGTGGGGGAGAAGG + Intronic
1009035444 6:58112329-58112351 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1009211259 6:60865921-60865943 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1009477706 6:64114924-64114946 GTATGGGGCTGCAGGGGAGCTGG - Intronic
1010686527 6:78859937-78859959 GTGTGTGGAGGTAGGGAAGGCGG - Intergenic
1011125524 6:84003138-84003160 ATGGGGTGATGTGGGGGAGATGG + Intergenic
1011785783 6:90843112-90843134 GGGTGGGGGTGGAGTGGAGATGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1012945748 6:105463845-105463867 GTGGGGGGATGGGGGGGAGAGGG - Intergenic
1013429589 6:110043742-110043764 GTGTGGGGGAGAAGGGGAGCTGG - Intergenic
1014191834 6:118505044-118505066 GTGTGGGGATATGGAGGATATGG + Intronic
1014786710 6:125627727-125627749 GACAGGGGTTGTAGGGGAGATGG + Intergenic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1015106616 6:129544284-129544306 GGGTGAGGATGTGGAGGAGAGGG - Intergenic
1015224348 6:130839576-130839598 GTTTGAGGATGCTGGGGAGAGGG - Exonic
1015356870 6:132287607-132287629 GTGTATGGGGGTAGGGGAGAGGG + Intergenic
1015461463 6:133496476-133496498 GGGTGGTCATGTAGGGGAAATGG - Intronic
1015894135 6:137999982-138000004 GAGAGGGAGTGTAGGGGAGAGGG + Intergenic
1016269390 6:142271155-142271177 GTGTGGTGCTGGAGGGGGGAAGG - Intergenic
1016329699 6:142944410-142944432 GTGTGGGTGTGTGGGGGAGGGGG - Intronic
1017509759 6:155104041-155104063 GTGTGGGGGTGTGGGGGGGGGGG - Intronic
1017595267 6:156021636-156021658 GTGTGGGGAAGAATGGGAGCAGG + Intergenic
1017637362 6:156456196-156456218 GAGGGGGGAGGAAGGGGAGAGGG - Intergenic
1017637433 6:156456331-156456353 GGGAGGGGAGGAAGGGGAGAAGG - Intergenic
1017717318 6:157222078-157222100 GTGTGGGGATGTAGGTGTGTGGG + Intergenic
1017784315 6:157742229-157742251 GTGAGGGCATGTAAGGGTGATGG + Intronic
1017901386 6:158721050-158721072 GTGGTGGGGTGCAGGGGAGACGG + Intronic
1018709172 6:166485686-166485708 GTCTGGGGAGGTGGGGGAGGCGG - Intronic
1018839827 6:167508899-167508921 GGGAGGGGATGTGGAGGAGATGG - Intergenic
1019376226 7:693880-693902 TTGTGGGGGTGTGGGGGACATGG - Intronic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019732231 7:2634560-2634582 GCGGGGGGATGGAGGGGAGGTGG + Intronic
1019807201 7:3136714-3136736 GTGTGGGGATGAGGGAGGGAGGG - Intergenic
1020104392 7:5415135-5415157 GGGAGGGGATGTGGGGGAGGTGG - Intronic
1020283503 7:6663683-6663705 GGGAAGGGATGTGGGGGAGAGGG + Intergenic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020652705 7:10894596-10894618 GTGGCAGGATGTAGGGGAGAGGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021451011 7:20784249-20784271 GTGGGAGGAGGTCGGGGAGAGGG + Intronic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1022104897 7:27190519-27190541 ATGTGGTGAGCTAGGGGAGATGG + Intergenic
1022509352 7:30925359-30925381 GAGTTGTGATGGAGGGGAGAGGG + Exonic
1023346026 7:39271985-39272007 GTGTGTGGGGGTGGGGGAGAGGG + Intronic
1023517431 7:41015904-41015926 GTGTGTGGAAGTAGGAGTGAGGG + Intergenic
1023772026 7:43566536-43566558 GTGTGGGGAGGACTGGGAGAAGG + Intergenic
1023852979 7:44160464-44160486 GTGTGGGGAAGTAGGGGTGTTGG - Intronic
1024028133 7:45431654-45431676 GCTTGGGGATGGTGGGGAGAGGG + Intergenic
1024248814 7:47490946-47490968 GTGTCGGGAAGTAGAGGAAAGGG + Intronic
1024349495 7:48349334-48349356 TTGAGGGGATGAAGGGCAGAAGG + Intronic
1024594499 7:50920800-50920822 GTGGGGGGATGTGGGGGGAAGGG - Intergenic
1025120908 7:56301340-56301362 TTGTGGGGATGAAGGTGGGATGG - Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026737179 7:72956384-72956406 GTGTGGGGATATAGGATGGAGGG + Intergenic
1026787377 7:73310366-73310388 GTGTGGGGATATAGGATGGAGGG + Intergenic
1026930281 7:74219886-74219908 GTGGGGGGATGATGGGGTGAGGG + Intronic
1026968395 7:74454213-74454235 GGGTGGGGGAGAAGGGGAGAAGG - Intronic
1027106553 7:75408684-75408706 GTGTGGGGATATAGGATGGAGGG - Intronic
1027226727 7:76248304-76248326 GTGTGGGGATGAGGGAGAGGGGG + Intronic
1028168741 7:87569692-87569714 GTGGGGGGGTGTGGGGGACAGGG + Intronic
1028224194 7:88231006-88231028 GGGTGGGTATGTATGGGTGAAGG - Intergenic
1028365713 7:90028293-90028315 GTGGGGGGCTGCAGGGGAGGTGG + Intergenic
1028546401 7:92006761-92006783 GTGTTGGGATGCAAGGAAGAAGG + Intronic
1029146124 7:98447381-98447403 GTGGGAGGATGCAGGGAAGAGGG + Intergenic
1029454020 7:100658307-100658329 GTGGTGAGCTGTAGGGGAGAGGG + Intergenic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1032020811 7:128406282-128406304 GTGTGGGGGTGTGGGGGGGTGGG - Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033258572 7:139822694-139822716 GTGTGGGGATGAAGAAGAGGGGG - Intronic
1033438181 7:141353022-141353044 GTGTTTGAATGTAGGGGTGAGGG - Intronic
1033651461 7:143346673-143346695 GTTTGGGGATACAGGGGAAAGGG + Intronic
1034277166 7:149829047-149829069 GTGTGGGGTGGCAGGGGAGAAGG - Intergenic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035098715 7:156378757-156378779 GTCTGGGGGTGTAGGGGAGGAGG + Intergenic
1036646019 8:10611759-10611781 GTGTGGGGAGGTATGGGGGCCGG + Exonic
1036711653 8:11083302-11083324 GTATGGGGAGGTAGGGGAACAGG - Intronic
1036716941 8:11134184-11134206 GTTTGGGGACATAGAGGAGAAGG - Intronic
1036718684 8:11151748-11151770 GCGGGGGGATGTAAGGCAGAAGG - Intronic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037543902 8:19899142-19899164 GTATGAGGATGTAGGGGCCAAGG + Intergenic
1037901585 8:22692234-22692256 GTGTGGGGACGGCGGGGAGAAGG - Intronic
1037935923 8:22915065-22915087 CTGTGGGGATATTGGGGAGAGGG - Intronic
1038328862 8:26591906-26591928 GTGTTGAGTTGTAGGGGAAAGGG + Intronic
1038928293 8:32165012-32165034 GTGTTGGGGGGTGGGGGAGAGGG - Intronic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039622563 8:39011972-39011994 ATGTGGGGGAGTTGGGGAGAAGG + Intronic
1039750021 8:40470163-40470185 GTGTGGGGATTGCAGGGAGAAGG + Intergenic
1039857597 8:41429682-41429704 TAGTAGGGATGTAGGGGAAAGGG + Intergenic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040354832 8:46607682-46607704 GTGTGTGCATGTAGGGGGGTGGG + Intergenic
1040665900 8:49632700-49632722 AGGTGGGGAGGTGGGGGAGAGGG + Intergenic
1041023201 8:53658593-53658615 GTGTGGTGATGCAGGTGAGGGGG + Intergenic
1041100996 8:54396347-54396369 GTGTGGGCATTGCGGGGAGAAGG + Intergenic
1041330355 8:56717523-56717545 GTGTGTGTATTTAGGGGAGGGGG - Intergenic
1043045301 8:75315410-75315432 GTGTGGGGACCCTGGGGAGAGGG + Intergenic
1043386082 8:79749024-79749046 GGGTAGGGAAGTAGGGGAGTAGG - Intergenic
1043405344 8:79926679-79926701 GTTTGGGGATTTGGGGCAGAGGG + Intronic
1043428361 8:80171180-80171202 GTGTGCGTGTGTGGGGGAGAGGG - Intronic
1044511901 8:93091321-93091343 GTGTGTGGAAGTAGAGGTGAAGG - Intergenic
1044514142 8:93118989-93119011 GAGTGGAGATGTTGGGAAGATGG + Intergenic
1044601694 8:94011676-94011698 GAGTGGGGAGGTGGGGAAGAGGG + Intergenic
1046619207 8:116510150-116510172 GTGTGTGTATGTGGGAGAGAGGG - Intergenic
1046768735 8:118098000-118098022 GTGTGGGGAAAGCGGGGAGAAGG + Intronic
1046819908 8:118622609-118622631 GCATGGGGGTGTAGGGGAGGAGG + Intergenic
1046822362 8:118648401-118648423 GTGTGGGAGTGTAGGGGCTATGG + Intergenic
1047415798 8:124663546-124663568 GTGTGGGGAGAAAGGGGAGGTGG - Intronic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048340813 8:133537216-133537238 GTGGGGGGAGGTATGGGGGAAGG + Intronic
1048882789 8:138884089-138884111 GTGTGGGGATTTTAGGTAGAGGG - Intronic
1048964663 8:139606957-139606979 GCGGGGGGATGTGGGGGAGAAGG - Intronic
1049065991 8:140314596-140314618 GTCTGGGGATGGTTGGGAGAAGG - Intronic
1049272905 8:141705528-141705550 ATGTGGAGATGATGGGGAGATGG + Intergenic
1049577384 8:143396009-143396031 GTGTGGGGAGTTAGGGAGGAGGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050356714 9:4790922-4790944 GGGTGGGGATGTTGGGGGGCAGG + Intergenic
1050980665 9:12009813-12009835 GTGTGTGTATTTAGTGGAGACGG - Intergenic
1051120997 9:13752307-13752329 CCGTGGGGATGTATGGGTGAGGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051822669 9:21186093-21186115 ATGTGGGGAGGAAGTGGAGAGGG - Intergenic
1051827670 9:21238495-21238517 ATGTGGGGAGGAAGTGGAGAGGG - Intronic
1052197625 9:25736658-25736680 GTGGGGGGATGTAGAGGGGGAGG + Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052321338 9:27170682-27170704 GTGTGGGGAGGTAAGGGAGTGGG + Intronic
1052327552 9:27231894-27231916 ATGGGGGGATGTGGGGGAGGTGG + Intergenic
1052457454 9:28718524-28718546 ATGTTGTGATGAAGGGGAGAAGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1053345780 9:37377300-37377322 GTGTGTGTGTGTAGGAGAGAAGG + Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056175717 9:84033407-84033429 GTGGGGAGAGGTAGGGGAGGTGG - Intergenic
1057130530 9:92651389-92651411 GGGTGGGGATGGAGGAGAAAGGG + Intronic
1057173461 9:92977329-92977351 GTGCTGGGATCTTGGGGAGATGG + Intronic
1057730412 9:97603387-97603409 GTGTGAGTATGAAGGAGAGAGGG - Intronic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1058087299 9:100762171-100762193 GGGTGGGGGTGTTGGGGGGAAGG + Intergenic
1058758115 9:108102599-108102621 GTGTGTGTATGTTGGGGAGTAGG + Intergenic
1058866709 9:109167401-109167423 GTGGAGGGAAGTCGGGGAGATGG - Intergenic
1059541634 9:115136269-115136291 GTGTGTGTATGTTGGGGGGATGG + Intergenic
1059646038 9:116268843-116268865 GGGTGGGGGGGTAGGGGGGAAGG + Intronic
1059820377 9:117966240-117966262 GAAAGGGGATGTAGGGGAGGGGG - Intergenic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060229630 9:121817270-121817292 ATGTGGGAATGAAGGGGAGGTGG + Intergenic
1060294192 9:122332232-122332254 AGCTGGAGATGTAGGGGAGAGGG + Intergenic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1060383228 9:123197244-123197266 GGGTGGGGAAGAAGTGGAGATGG + Intronic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1061413482 9:130433208-130433230 GTGTGGGGCTCTGCGGGAGAAGG + Intronic
1061418195 9:130459430-130459452 GTGTGTGTGTGTGGGGGAGAGGG + Intronic
1061474561 9:130855640-130855662 GTGTGGTGTTGTAAGGGAGGTGG + Intronic
1061483410 9:130908489-130908511 GTGGGTGGAAGGAGGGGAGATGG - Intronic
1061565811 9:131439085-131439107 GTTTGGGGACGCTGGGGAGAGGG + Intronic
1061613904 9:131766668-131766690 CTGCAGGGATGTGGGGGAGAGGG + Intergenic
1061839191 9:133347881-133347903 GGGTGGGGATGGAGGGGGGGTGG - Intronic
1061889117 9:133608531-133608553 GAGTGGGGAAGTGGTGGAGATGG - Intergenic
1061942553 9:133891409-133891431 GAGGGGGGATGGAGGGGGGACGG + Intronic
1062194130 9:135263876-135263898 GAGAGGGGAAGGAGGGGAGAGGG - Intergenic
1062547924 9:137072077-137072099 GTGTGGGGATGGGGGGGCGGGGG - Intergenic
1062708775 9:137960320-137960342 GGGTGGCGAGGTAGGGGAGCGGG + Intronic
1185430774 X:10545-10567 CTGTGGGGATTTAGGGGACCAGG + Intergenic
1185440040 X:222942-222964 CTGTGGGGATTTAGGGGACCAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186358089 X:8808365-8808387 GTTTGAGTATGTAGGAGAGAGGG + Intergenic
1186416768 X:9390421-9390443 AAATGGGGATGTTGGGGAGAGGG + Intergenic
1186461942 X:9754764-9754786 CGGTGGGGATGTGGGGGAAAAGG - Intronic
1187977772 X:24720591-24720613 TTGTGGGGTTGTGGGGGAGTGGG - Intronic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1189180448 X:38999596-38999618 GTTTGTGGAAGTAGGGAAGAGGG - Intergenic
1189191731 X:39114848-39114870 GTGGAGGGAAGTAAGGGAGAAGG + Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189412856 X:40789449-40789471 GAGTGGGGAGGTAGGGGAAAGGG - Intergenic
1189608113 X:42701814-42701836 GTGAGGGGATGTAGGGAATTTGG - Intergenic
1190337297 X:49270127-49270149 GGATGGGGATGAAGGGGAGGAGG + Exonic
1190490516 X:50978346-50978368 AGGTGGGCATGTAAGGGAGAGGG + Intergenic
1194218301 X:91160290-91160312 GTGGGGGGCTGTGGGGGAGGTGG - Intergenic
1195272549 X:103246313-103246335 GTGTGAGGATGTAGGAAGGATGG - Intergenic
1195435245 X:104836271-104836293 GTGGGGGGCTGTGGAGGAGATGG + Intronic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196043941 X:111236453-111236475 GGGTGGGGAGGTCGGGGAAATGG - Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197175009 X:123476364-123476386 GTGTGTGTGTGTTGGGGAGAGGG + Intronic
1197590855 X:128408256-128408278 GTGTGTGGATGTATGGGTGTAGG + Intergenic
1197764816 X:130053288-130053310 GTGTGGGGTGGTGGGGGGGAGGG - Intronic
1198435912 X:136616788-136616810 GTGTGGGTATGTGAGGGAGTGGG - Intergenic
1198546966 X:137702399-137702421 GTGTGGGGAGCTAGAGAAGAGGG - Intergenic
1198934758 X:141894866-141894888 GAGTGGGGAGGTAGGCAAGAAGG + Intronic
1199448967 X:147958469-147958491 GTCTGGGGATGTGGGGGGCAGGG - Intergenic
1199571091 X:149267992-149268014 GTGTGTGTATGTATGGGTGAGGG + Intergenic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1199896088 X:152129273-152129295 TGTGGGGGATGTAGGGGAGATGG - Intergenic
1200554815 Y:4624078-4624100 GTGGGGGGCTGTGGGGGAGGTGG - Intergenic
1200562170 Y:4718525-4718547 TTGGGGGAATGTAGGGGAGGGGG - Intergenic
1200730194 Y:6727349-6727371 GTATGTAGATGTAGGGGAGGAGG + Intergenic
1200828095 Y:7663673-7663695 GAGTGGGGATGGAGTGGGGAGGG + Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic
1201427287 Y:13866415-13866437 GTGTGGGAATGAAGGAGACATGG + Intergenic