ID: 1195968586

View in Genome Browser
Species Human (GRCh38)
Location X:110451131-110451153
Sequence GTACACACCACTCCAGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195968586_1195968589 6 Left 1195968586 X:110451131-110451153 CCATCCTCTGGAGTGGTGTGTAC 0: 1
1: 1
2: 0
3: 8
4: 117
Right 1195968589 X:110451160-110451182 AATGAGCACTTCATCCTCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195968586 Original CRISPR GTACACACCACTCCAGAGGA TGG (reversed) Exonic
903607712 1:24587151-24587173 GGACACATGACTCCAGAGGGGGG - Intronic
904366543 1:30014451-30014473 CTTAACACAACTCCAGAGGAGGG + Intergenic
905233599 1:36530454-36530476 GTACACAGCAGGGCAGAGGAGGG - Intergenic
906919069 1:50044125-50044147 CTACACAGCACTCCACAGGGAGG + Intergenic
910428609 1:87139603-87139625 GTCCACTCCACTTCAGTGGAGGG - Intronic
915340120 1:155172883-155172905 GTACCCACCACTGGAGGGGATGG + Exonic
916528522 1:165633644-165633666 GTACCAACCACCCCAAAGGAAGG - Intronic
921480646 1:215661215-215661237 GTACAGACCAAGCCAGAGAAGGG - Intronic
922589807 1:226766312-226766334 GTACACACCAGTCCCATGGAGGG - Intergenic
923061892 1:230483426-230483448 GGACACACTACTCCAAAGTACGG + Intergenic
923311620 1:232741114-232741136 CTACACAGCACTCCTGAGCAGGG - Intergenic
1069503305 10:68974067-68974089 GTGCAGTCCACTCAAGAGGAAGG - Intronic
1071953571 10:90732445-90732467 GTACACATCACTCCTGAGTGGGG - Intergenic
1072100760 10:92227092-92227114 ACACACAGCACTCTAGAGGAGGG - Intronic
1072220685 10:93325271-93325293 GGACATTCCACTCCAGAAGATGG - Intronic
1072295092 10:94001095-94001117 GTACTCACTGCTTCAGAGGAGGG - Intronic
1074912932 10:117927939-117927961 GTACACACCCCTGCAGGGCAAGG + Intergenic
1077390695 11:2299490-2299512 GGACACAGCTTTCCAGAGGAGGG + Exonic
1083093934 11:60230012-60230034 GAACAGACCACTCCAGGGGCTGG - Exonic
1085532205 11:77198528-77198550 GTACACACCCGTCCAGTTGACGG - Exonic
1086202690 11:84223007-84223029 GTACTCACCACACTGGAGGAAGG - Intronic
1088368557 11:109064299-109064321 GTAAACACCATTAAAGAGGAAGG - Intergenic
1089021909 11:115224633-115224655 ATTCACCCCAGTCCAGAGGAAGG + Intronic
1090163242 11:124517573-124517595 GTTCCCACCTCTCCAGAGAAGGG - Intergenic
1092796942 12:12121120-12121142 GTACAGACTCCTCCTGAGGAGGG - Exonic
1092913767 12:13171527-13171549 GGACACCCCAGTCCACAGGAGGG - Intergenic
1095792013 12:46177997-46178019 GCAAGCACCACTCCAAAGGAAGG + Intergenic
1097175860 12:57142568-57142590 ACACACACCACACGAGAGGAAGG - Intronic
1097269829 12:57767156-57767178 GCACAGACCACTCAGGAGGAGGG - Exonic
1097472724 12:60015361-60015383 GTGAACACCATTCCACAGGAAGG + Intergenic
1097975576 12:65683060-65683082 GTACATATCACTCCTGAGTAGGG - Intergenic
1099748937 12:86745964-86745986 GCAAACACCACTTCAGAGAATGG - Intronic
1101193671 12:102360934-102360956 AGAGAGACCACTCCAGAGGAAGG + Intergenic
1107763146 13:43703264-43703286 GTACACACTGCACCTGAGGAAGG - Intronic
1109483735 13:62991778-62991800 CTACAAAACACTGCAGAGGAAGG - Intergenic
1110425612 13:75363171-75363193 TGACACACCACTCTAGAGGATGG + Intronic
1113138390 13:107118709-107118731 GTAAACAGCACTCTAGGGGAAGG + Intergenic
1113757697 13:112825040-112825062 CTACCCACCACTGTAGAGGAAGG - Intronic
1121926445 14:97931500-97931522 GGAGACACCACTCAAGAGGAAGG + Intronic
1123061242 14:105595553-105595575 GTCCAAACAACACCAGAGGAGGG - Intergenic
1124176318 15:27427829-27427851 TAACAAGCCACTCCAGAGGATGG - Intronic
1125998090 15:44183395-44183417 GGGCCCACCACTCCACAGGAAGG + Intronic
1127149276 15:56056844-56056866 GTCCCCACGACTCCAGAGGCAGG + Intergenic
1129258211 15:74346474-74346496 GTACACACCAGTCAAAATGAAGG - Intronic
1129767443 15:78179230-78179252 GCACACCCCACTCCAAAAGAGGG + Intronic
1130832448 15:87615470-87615492 GTACACCCTACACCAGAGAAAGG + Intergenic
1132237468 15:100232885-100232907 TCACACTCCACCCCAGAGGAGGG + Intronic
1136065299 16:27754436-27754458 GGCCACCTCACTCCAGAGGAGGG + Intronic
1136341283 16:29645241-29645263 CAACACACCACTCCTGAGAAAGG - Intergenic
1138156459 16:54709435-54709457 GTAGACTCCTCTCCAGAGCAAGG + Intergenic
1139472535 16:67185832-67185854 GAACATACCACCCAAGAGGAAGG + Intronic
1141053590 16:80795469-80795491 GGTCACACCACTCCAGTGAAAGG - Intronic
1144581728 17:16463076-16463098 GGACACACCACCCCAGAATATGG + Intronic
1147118493 17:38320822-38320844 ATACCCAGCACTCCAGAGGGAGG - Intronic
1148279744 17:46338667-46338689 CTACTCCCCACGCCAGAGGATGG + Intronic
1148301962 17:46556523-46556545 CTACTCCCCACGCCAGAGGATGG + Exonic
1150592967 17:66579289-66579311 TTACACATCACACCACAGGAAGG - Intronic
1155844958 18:30694840-30694862 GGTCACAACACTCCAGTGGATGG + Intergenic
1161583364 19:5092497-5092519 GGACACATCTCCCCAGAGGAGGG + Intronic
925992725 2:9266595-9266617 GTTCACACCTCTGCAGAGGAAGG - Intronic
928302014 2:30133499-30133521 GTACACAGTAGTCAAGAGGATGG + Intergenic
932422730 2:71611265-71611287 CTACCCACCACCCCAGAGGGAGG + Exonic
933781198 2:85802586-85802608 GAGCACACCACTCAAGAAGAGGG + Intergenic
935000384 2:99008812-99008834 GTGCACACTACTCCAGTGTATGG - Intronic
935706290 2:105860421-105860443 ATACACACTACACCAGAGCAGGG - Intronic
935936302 2:108187265-108187287 ATACACAGCAATCCAGAAGATGG + Intergenic
938406901 2:131037758-131037780 GTCCACACCACTCTGGAGCAAGG + Intronic
939614191 2:144344396-144344418 ATACACATCACGCCAGAGAAAGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1177802502 21:25841653-25841675 CTGCACATCACTCCAGTGGAAGG - Intergenic
1179995617 21:44972720-44972742 GTACACACCACTTCCCAGGAAGG - Intronic
949754334 3:7392089-7392111 GTTCAAACCACACCAAAGGAGGG - Intronic
950001874 3:9663007-9663029 GTACACATCAGGGCAGAGGATGG + Intronic
953517611 3:43611158-43611180 GTACTCACAACTCCAGATCAAGG + Intronic
953558855 3:43968874-43968896 GTAAACACCACTATAGAGAAAGG + Intergenic
955926773 3:64014436-64014458 GTCCACCCCAATCCAGTGGAGGG - Intronic
959564783 3:107823386-107823408 GTACACACTACTCCAAAATATGG + Intergenic
960268354 3:115647289-115647311 TTTCTCACCATTCCAGAGGATGG - Intronic
961026741 3:123564983-123565005 GTGCACACCAGTCCTCAGGATGG + Intronic
962926879 3:140002145-140002167 GTACATCCCACTACAGAGAACGG - Intronic
964773634 3:160252243-160252265 GTAGACTCAACTCCAAAGGAAGG + Intronic
965727499 3:171734382-171734404 GGACAGAAAACTCCAGAGGAGGG - Intronic
968225081 3:196968396-196968418 GTAAACTCCACTCCAGGGCACGG - Intronic
971376017 4:26056355-26056377 GTTCAGACCACTGAAGAGGAGGG - Intergenic
971921032 4:32939426-32939448 ACACACACCCCTCCAGATGAGGG + Intergenic
975311162 4:72905255-72905277 GTTTACTCCACCCCAGAGGATGG - Intergenic
978828090 4:113048694-113048716 GTATACACCCCTTGAGAGGAGGG + Intronic
979345829 4:119585715-119585737 CTACACCCGACTCAAGAGGAAGG - Intronic
986331619 5:6720442-6720464 GTAACCACCAAGCCAGAGGACGG - Intronic
992269464 5:75051122-75051144 GCACACACCATTCCCGGGGATGG + Intergenic
992360264 5:76030810-76030832 CTACTCTCCACTCCAGAGGGAGG - Intergenic
993670154 5:90750683-90750705 TTACATACCACTCCTGAGGTAGG - Exonic
997824013 5:137090467-137090489 GTGAGCACCACTCCAGTGGAAGG - Intronic
998544961 5:143019653-143019675 GAACACACCAGTCCAGTGCAAGG + Intronic
1003149752 6:3538552-3538574 ACACACACCACTCCAAAGCAGGG + Intergenic
1005872288 6:29983555-29983577 GAACATACCAGTACAGAGGAGGG + Intergenic
1005965740 6:30725176-30725198 GTATACACCACTCCAGAGTCAGG - Exonic
1006393634 6:33773197-33773219 CTCCACAGCACTCCAGGGGATGG + Intronic
1007263221 6:40578153-40578175 CTACACAGCACCCCAGAGGATGG - Intronic
1008353454 6:50521150-50521172 ATTCACAGCACTCCAGAGGTGGG - Intergenic
1008884254 6:56414763-56414785 GTGCAAACCAATACAGAGGAAGG + Intergenic
1011599793 6:89049331-89049353 GTAAACACCACTTCCCAGGAGGG + Intergenic
1012324670 6:97901318-97901340 GTACTAACCACCCCAAAGGAAGG - Intergenic
1018860768 6:167709333-167709355 GGACACTCCACTCCACATGATGG + Intergenic
1020003809 7:4771119-4771141 GCACGCACGACACCAGAGGAAGG + Exonic
1020068619 7:5210368-5210390 GTGCCCAGCACTGCAGAGGAGGG - Intronic
1024273196 7:47657722-47657744 GTACACAGGCCTCCAGAGGAGGG - Intronic
1025171293 7:56759459-56759481 GTACACAGAACTCCAGAGATAGG - Intergenic
1025700574 7:63816028-63816050 GTACACAGAACTCCAGAGATAGG + Intergenic
1025832224 7:65062299-65062321 GTACACAGAACTCCAGAGATAGG + Intergenic
1026540730 7:71277724-71277746 GTAGACAGCTGTCCAGAGGAGGG + Intronic
1027198235 7:76046208-76046230 GAACATTCAACTCCAGAGGAGGG - Intronic
1027255326 7:76427181-76427203 GGAAACACCACACCAGAGGAAGG - Intronic
1032108731 7:129056706-129056728 GGAAACACCACTCATGAGGAAGG - Intergenic
1038676089 8:29624188-29624210 GTAGATACCACTCCCAAGGATGG + Intergenic
1039870201 8:41539578-41539600 TTACACAACCCTCCCGAGGAAGG - Intronic
1042730809 8:71932087-71932109 CTACACACCAATAAAGAGGATGG - Intronic
1044087487 8:87958322-87958344 GTACACACCACTCCAGAGAAAGG - Intergenic
1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG + Exonic
1061559390 9:131393457-131393479 ACACACAACACTCAAGAGGAGGG + Intergenic
1062595373 9:137296751-137296773 GGACACAGCAGGCCAGAGGAGGG - Intergenic
1188905584 X:35787246-35787268 GGACACAAGACTCCAGAGGGGGG + Intergenic
1189960818 X:46323387-46323409 GGACACACTACTCCAAAAGATGG - Intergenic
1190428217 X:50352493-50352515 GTACACATCACCCCAAAGGTAGG - Intergenic
1195968586 X:110451131-110451153 GTACACACCACTCCAGAGGATGG - Exonic
1197892289 X:131279263-131279285 GTACTCACCACAGCAGAGAAGGG + Exonic
1198794805 X:140383700-140383722 GTACACAGCAGTCCACAGGTTGG - Intergenic