ID: 1195968651

View in Genome Browser
Species Human (GRCh38)
Location X:110451676-110451698
Sequence TGGGCATCACTCCAGAGGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195968651_1195968656 -1 Left 1195968651 X:110451676-110451698 CCTACCCTCTGGAGTGATGCCCA 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1195968656 X:110451698-110451720 ACCCAAACGATGCCAGCCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 99
1195968651_1195968666 21 Left 1195968651 X:110451676-110451698 CCTACCCTCTGGAGTGATGCCCA 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1195968666 X:110451720-110451742 GCTCTGGGGCGATGTCCCCATGG 0: 1
1: 0
2: 0
3: 11
4: 162
1195968651_1195968661 7 Left 1195968651 X:110451676-110451698 CCTACCCTCTGGAGTGATGCCCA 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1195968661 X:110451706-110451728 GATGCCAGCCCCAGGCTCTGGGG 0: 1
1: 0
2: 5
3: 41
4: 453
1195968651_1195968659 5 Left 1195968651 X:110451676-110451698 CCTACCCTCTGGAGTGATGCCCA 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1195968659 X:110451704-110451726 ACGATGCCAGCCCCAGGCTCTGG 0: 1
1: 0
2: 2
3: 11
4: 231
1195968651_1195968660 6 Left 1195968651 X:110451676-110451698 CCTACCCTCTGGAGTGATGCCCA 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1195968660 X:110451705-110451727 CGATGCCAGCCCCAGGCTCTGGG 0: 1
1: 0
2: 2
3: 68
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195968651 Original CRISPR TGGGCATCACTCCAGAGGGT AGG (reversed) Exonic
900981692 1:6049505-6049527 TGGGCATGGCTCCCGGGGGTGGG - Intronic
901796550 1:11682713-11682735 TGGGAATCACCACAGAGGTTTGG + Intronic
902034085 1:13443868-13443890 AAGGCCCCACTCCAGAGGGTGGG + Intergenic
902186156 1:14726945-14726967 TTGGCATCACCACAGAGGGATGG - Intronic
902702732 1:18183716-18183738 TGGGCTTGGCTCCAGATGGTGGG + Intronic
904258350 1:29271874-29271896 AGGGCAGCATTCCAGGGGGTGGG + Intronic
904377971 1:30093752-30093774 TGGGCATTTCTGCAGAGGGACGG + Intergenic
904878078 1:33671800-33671822 TGGGCAGCACTTGAGAGGGACGG - Intronic
907952665 1:59198660-59198682 TGGGCTCCACTCCGGAGGGGCGG - Intergenic
912687288 1:111777476-111777498 TGGCCATCAGTTCAAAGGGTAGG + Intronic
920404871 1:205701560-205701582 CGGGCACCCCTCAAGAGGGTTGG + Intergenic
921781576 1:219171769-219171791 TGGGCTTGACTCCAGAGCATAGG - Intergenic
923021241 1:230165768-230165790 AGGGCAGCACTCGAGAGGGAGGG + Intronic
923554122 1:234987305-234987327 GGGGCATCACGACACAGGGTAGG - Intergenic
1063977591 10:11429729-11429751 TGGGCAGCAGGTCAGAGGGTGGG + Intergenic
1066348940 10:34618793-34618815 TGTGCATGACTCCAGCAGGTTGG - Intronic
1066699766 10:38114783-38114805 TGGGCTTCACTCAAGAGGAGTGG + Exonic
1066991953 10:42523688-42523710 TGGGCTTCACTCAAGAGGAGTGG - Intergenic
1070767756 10:79066556-79066578 TGAGCATCCCTGGAGAGGGTGGG - Intergenic
1071059798 10:81555700-81555722 TGCCCATCCCTCCAGAGTGTTGG - Intergenic
1073173497 10:101534095-101534117 TGGGCTTCACAGCAGAGTGTGGG - Intronic
1074107621 10:110400290-110400312 TGGGCACCTGTCCAGAGGATGGG - Intergenic
1076176227 10:128369942-128369964 GGGGCAGCACTGCAGAGAGTGGG + Intergenic
1077515397 11:2998704-2998726 TGGCCATTTCTCCAGGGGGTGGG + Intergenic
1083331603 11:61900933-61900955 TGGGCACAAATCCACAGGGTAGG + Intronic
1084494076 11:69494075-69494097 GCGGCATGACTCCAGGGGGTGGG + Intergenic
1084693033 11:70737960-70737982 TGGGCATCACACCAGAATCTGGG + Intronic
1089536578 11:119164027-119164049 TTGGCATCACTCCAGGGAGAAGG - Intergenic
1089610141 11:119664410-119664432 TGGGCATCCCTCCAGGGTTTGGG - Exonic
1092373051 12:7933078-7933100 TGAGCAGCACCTCAGAGGGTGGG + Exonic
1105025715 12:132847535-132847557 TGGGCATCAAAGCAGAGTGTGGG + Intronic
1106285574 13:28315840-28315862 GGGACATCAGTCCAGAGGCTTGG + Intronic
1106891256 13:34248056-34248078 TGGGCATCATTCCAGAGTCCAGG - Intergenic
1108775548 13:53761273-53761295 GGGGCAGAACTCCAGTGGGTGGG + Intergenic
1113988815 13:114341937-114341959 TGGGCAAAACTCTAGAGGATAGG + Intergenic
1120177539 14:81311016-81311038 TAGGCATCAGTGCACAGGGTAGG + Intronic
1120503659 14:85327225-85327247 TGGGCAGTTCTCCAGAGGTTGGG + Intergenic
1122871383 14:104640594-104640616 TGGGCATCACTAGAGGGGGTTGG - Intergenic
1125542183 15:40476060-40476082 AGGGCTTGGCTCCAGAGGGTAGG - Intergenic
1127492644 15:59479639-59479661 GGGGGATCACTCCAGAGCGAGGG + Intronic
1130017332 15:80197674-80197696 TGGGCACCTCTCCACAGGCTGGG + Intergenic
1132599058 16:765826-765848 TGGGCAGCACCCCTGGGGGTGGG + Intronic
1133421886 16:5653294-5653316 TGGGCTTCAGTGCAGAAGGTGGG + Intergenic
1133522362 16:6571333-6571355 TGGGCATCCTTCCAGAGAGAAGG + Intronic
1141293234 16:82740589-82740611 TGGGCTTGACTCCAGACTGTGGG + Intronic
1144354201 17:14428621-14428643 TGGGCATCACTCTTGGGGGAGGG - Intergenic
1145035872 17:19540213-19540235 TGGGCAGCACTCCAAAGGCCGGG + Intronic
1146550105 17:33773254-33773276 TGGGCTACACTCTAGAGGATGGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1148479364 17:47949979-47950001 TGAGCATCACTCGAGGGGGCTGG - Intergenic
1149666212 17:58366423-58366445 GGGGCATGCCTCCAGAGGGTAGG - Intronic
1151164506 17:72192319-72192341 TTGGAATCCCTCCAGAGAGTGGG + Intergenic
1157796144 18:50577442-50577464 TGGGTCTCACTCCAGAGACTAGG + Intronic
1166161916 19:40960512-40960534 TTGTCATTATTCCAGAGGGTGGG + Intergenic
1167049874 19:47071865-47071887 GGGGCATCATTCCAGAATGTGGG + Exonic
928646250 2:33355804-33355826 TAGGCCTCACTGCAGAGGGATGG - Intronic
929045274 2:37783173-37783195 TGTACAACACTGCAGAGGGTGGG + Intergenic
931633591 2:64322623-64322645 TGGGCATAACCCCAGTCGGTGGG + Intergenic
932075915 2:68662844-68662866 TGGGCATCACCCCCAAGGATGGG - Intergenic
932388336 2:71359466-71359488 CGGGCATCACGCCATAGGCTGGG - Intronic
934713796 2:96531736-96531758 TCGGCACCTCTCCAGAGGTTTGG + Intergenic
937099992 2:119261257-119261279 TTGGCATCAATCCAGAGCCTCGG - Intronic
937283967 2:120738098-120738120 TGGGCCTGACTCCACAGGGACGG + Intronic
938134919 2:128748888-128748910 TGGGAAAGACCCCAGAGGGTGGG + Intergenic
938240702 2:129740650-129740672 TGGGCATGAGGCCAGAGTGTGGG + Intergenic
939809970 2:146819119-146819141 TGGGCATAATTACAGAGGGAAGG - Intergenic
939986027 2:148830642-148830664 TGAGCATCAGACCAGTGGGTGGG + Intergenic
943243227 2:185413968-185413990 TGGGCATAACACCTGAGGTTAGG + Intergenic
945959190 2:216114570-216114592 TGCTCATCACTTCAGAGGGACGG - Intronic
947622901 2:231602429-231602451 TGTGCAGGACTCCACAGGGTGGG - Intergenic
948214443 2:236218194-236218216 TCTGCAGCCCTCCAGAGGGTGGG - Intronic
948226240 2:236311295-236311317 TGGTGCTCACTCCACAGGGTTGG + Intergenic
948536528 2:238651316-238651338 GGGGCATCACCCCAGAGGTGAGG - Intergenic
948577864 2:238965746-238965768 TGGGCTTTACTCCAGGGGCTTGG - Intergenic
1168980135 20:1996905-1996927 TGGGCAGCAGTCCCGGGGGTGGG + Intergenic
1169082376 20:2805275-2805297 TGGTCATCTCTCCAGAAGGAAGG + Intergenic
1173291332 20:41717614-41717636 TGGGCATCATTGCTGAGGGAAGG - Intergenic
1173599968 20:44287596-44287618 TGGGCAGCATTCCTGAGGCTTGG + Intergenic
1175178863 20:57130835-57130857 TGAGGACCACTCCAGAGGGAAGG + Intergenic
1175184999 20:57174055-57174077 TGGTCATCAGTCCTGAGGGCAGG + Intronic
1175531869 20:59679046-59679068 TGGAGATCACGGCAGAGGGTTGG + Intronic
1176219484 20:63963267-63963289 TGGGGGTCAGGCCAGAGGGTGGG + Intronic
1176722220 21:10402118-10402140 TGGGAATGGCTCCAGAGGGGAGG - Intergenic
1178109975 21:29360440-29360462 TGGGAATGAGGCCAGAGGGTTGG - Intronic
1180070660 21:45434475-45434497 TGAGCATCAGGCCAGAGGCTGGG + Intronic
1180303405 22:11054880-11054902 TGGGAATGGCTCCAGAGGGGAGG - Intergenic
1181910507 22:26234622-26234644 TGGGCATCTCAGCAGAAGGTGGG + Intronic
1184210993 22:43035489-43035511 TGGGAATGGCTCCAGAGGGGAGG + Intergenic
950011206 3:9725155-9725177 TCTGCCTCACTCCAGAGGGCTGG + Intronic
956645099 3:71447445-71447467 AGGGCATCACTCCAGCTGGAAGG + Intronic
958841043 3:99205631-99205653 GGGGCTTTACTCAAGAGGGTAGG - Intergenic
960043681 3:113175672-113175694 TGGGCAGGACTTCAGGGGGTGGG + Intergenic
960056843 3:113282074-113282096 TGGACATAGCTCCAGATGGTTGG + Intronic
960696602 3:120402586-120402608 TGAAAATCACTCCAGAGGCTTGG - Intronic
961016444 3:123471879-123471901 TGGGGATCACTAGAGAGGGGAGG - Intergenic
961096240 3:124159044-124159066 TGGGTTTCACTGCAGAGGGCAGG - Intronic
962879335 3:139561314-139561336 TGCGCATCCTTCCAGAGGTTGGG + Exonic
963537356 3:146544758-146544780 GGGGCCTCACACCAGGGGGTGGG - Exonic
964188446 3:153975405-153975427 TGGGGATCACTCAAGAGCATGGG - Intergenic
965872521 3:173278752-173278774 TAGGCAACAACCCAGAGGGTGGG - Intergenic
967865287 3:194185210-194185232 TGTGTATGACTCCAGAGGGTAGG - Intergenic
968374447 4:27352-27374 TGGGCAAAACTCTAGAGGATAGG - Intergenic
970438244 4:16056422-16056444 TGGGCACCACTCCAGATTCTGGG + Intronic
978945029 4:114485232-114485254 TAGGCATAACTAGAGAGGGTAGG - Intergenic
987331748 5:16863286-16863308 TGGGCTTCTCCCCAGTGGGTGGG - Intronic
988709211 5:33756608-33756630 TAGGCATCACAGCAGAGGGTAGG - Intronic
990187248 5:53221941-53221963 TGGGTGTTACTCCAGAGGTTAGG + Intergenic
990528389 5:56650776-56650798 TAGGCATAACTCCAGAGCTTGGG + Intergenic
990601632 5:57364699-57364721 TGGGCAGCAGGCCAGAGGGTGGG + Intergenic
991485191 5:67128257-67128279 TGGGAATCACTCAAAATGGTGGG + Intronic
997348351 5:133210364-133210386 TGGGCATCACTCCTGGGCGAGGG + Intronic
997979024 5:138457666-138457688 TGGGAAGCACTTCAGGGGGTGGG + Intergenic
1001274739 5:170342375-170342397 TGAGCATTACACCAGAGTGTGGG + Intergenic
1002755433 6:155401-155423 TGGGCAAAACTCTAGAGGATAGG - Intergenic
1002765177 6:233135-233157 TGGGCCTCACTCCGTAGGGCTGG + Intergenic
1005257065 6:24014580-24014602 GGGACCTCACTCCAGATGGTGGG + Intergenic
1005476767 6:26215609-26215631 TGGGCAACACTGGAAAGGGTAGG - Intergenic
1006943508 6:37768605-37768627 TGGGCAGCACTGCAGGGAGTGGG + Intergenic
1007636955 6:43305432-43305454 TGGGCATGAGACCAGTGGGTTGG - Exonic
1013330412 6:109094902-109094924 TGGGGATCAGCCCAGAGGGCGGG + Intergenic
1018492068 6:164303880-164303902 TGAGCAACACTGCAGAGGGAGGG + Intergenic
1019504422 7:1383734-1383756 TGGGCATCACCCTGGAGGGCAGG + Intergenic
1021489783 7:21207048-21207070 TGGGCATTGCTCCAGAGGCCAGG - Intergenic
1024019048 7:45348682-45348704 AGAGCATCATTCTAGAGGGTGGG + Intergenic
1024207065 7:47172936-47172958 TGGCCTCCACTCCAGGGGGTAGG + Intergenic
1024207097 7:47173148-47173170 TGGCCTCCACTCCAGGGGGTAGG + Intergenic
1026877161 7:73886458-73886480 TGGGCAGGACCCCAGAGGTTAGG + Intergenic
1028414887 7:90569122-90569144 TGGGTAGCACTCCTGAGGGTAGG + Intronic
1029126348 7:98297425-98297447 TGGCCCTCACTGCAGAGGGCAGG + Intronic
1035315902 7:157997522-157997544 TGGGCCTCACTCAAGAGGGAAGG + Intronic
1040548641 8:48421658-48421680 TGGGCATTACTAGAGAGGCTAGG + Intergenic
1041552058 8:59113972-59113994 TGGGCTCCATTCAAGAGGGTTGG - Intronic
1041829974 8:62143278-62143300 AGGGCATCAGTCCGGAGGGGTGG + Intergenic
1049698052 8:143993255-143993277 AGGGCAGCACTCCAGGGGGGTGG - Exonic
1060730504 9:126034002-126034024 TGGGTGTCACTGCAGAGGGCTGG + Intergenic
1062029413 9:134355513-134355535 TGGGCTTCACTTCTCAGGGTGGG + Intronic
1062518239 9:136946602-136946624 TGGACATCAGCCCAGAGAGTGGG - Intronic
1062526369 9:136979544-136979566 TGGGGAAAACTCCAGAGGGCAGG - Intronic
1203574776 Un_KI270744v1:166799-166821 TGGGCAAAACTCTAGAGGATAGG + Intergenic
1186367785 X:8913370-8913392 TGGGTATCACTGCACATGGTGGG + Intergenic
1186942131 X:14521297-14521319 TGGGCACCATTCCATAGGCTGGG + Intergenic
1190742007 X:53295187-53295209 TGGCCATCACTGCTGAGGATGGG - Intronic
1195968651 X:110451676-110451698 TGGGCATCACTCCAGAGGGTAGG - Exonic
1195968695 X:110451949-110451971 TGGACATCACTCCAGAGCTTGGG - Exonic
1195968805 X:110452861-110452883 TGGACATCACATCAGAGGTTGGG - Exonic
1201349428 Y:13023521-13023543 TATGCATCCCTCCACAGGGTTGG - Intergenic