ID: 1195969622

View in Genome Browser
Species Human (GRCh38)
Location X:110459057-110459079
Sequence CAGAATCACTTGAACCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195969622_1195969627 11 Left 1195969622 X:110459057-110459079 CCTTGTGGGTTCAAGTGATTCTG No data
Right 1195969627 X:110459091-110459113 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
1195969622_1195969630 30 Left 1195969622 X:110459057-110459079 CCTTGTGGGTTCAAGTGATTCTG No data
Right 1195969630 X:110459110-110459132 CAGGTGCCTGCCACCTTGCCTGG 0: 19
1: 2909
2: 14459
3: 40997
4: 91606
1195969622_1195969624 2 Left 1195969622 X:110459057-110459079 CCTTGTGGGTTCAAGTGATTCTG No data
Right 1195969624 X:110459082-110459104 GCCTCAGCTTCCCGAGTAGCTGG 0: 3119
1: 106508
2: 267490
3: 216129
4: 132032
1195969622_1195969626 3 Left 1195969622 X:110459057-110459079 CCTTGTGGGTTCAAGTGATTCTG No data
Right 1195969626 X:110459083-110459105 CCTCAGCTTCCCGAGTAGCTGGG 0: 3428
1: 113806
2: 295317
3: 221296
4: 121327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195969622 Original CRISPR CAGAATCACTTGAACCCACA AGG (reversed) Intergenic
No off target data available for this crispr