ID: 1195976736

View in Genome Browser
Species Human (GRCh38)
Location X:110535220-110535242
Sequence CAGGTGCAGCCATAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195976736_1195976740 0 Left 1195976736 X:110535220-110535242 CCTACTTCCTATGGCTGCACCTG No data
Right 1195976740 X:110535243-110535265 CTCAGGTAATTTCCCTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195976736 Original CRISPR CAGGTGCAGCCATAGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr