ID: 1195976740

View in Genome Browser
Species Human (GRCh38)
Location X:110535243-110535265
Sequence CTCAGGTAATTTCCCTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195976732_1195976740 16 Left 1195976732 X:110535204-110535226 CCCCTCAGCTCTCTCTCCTACTT No data
Right 1195976740 X:110535243-110535265 CTCAGGTAATTTCCCTGTCTAGG No data
1195976734_1195976740 14 Left 1195976734 X:110535206-110535228 CCTCAGCTCTCTCTCCTACTTCC No data
Right 1195976740 X:110535243-110535265 CTCAGGTAATTTCCCTGTCTAGG No data
1195976738_1195976740 -7 Left 1195976738 X:110535227-110535249 CCTATGGCTGCACCTGCTCAGGT No data
Right 1195976740 X:110535243-110535265 CTCAGGTAATTTCCCTGTCTAGG No data
1195976733_1195976740 15 Left 1195976733 X:110535205-110535227 CCCTCAGCTCTCTCTCCTACTTC No data
Right 1195976740 X:110535243-110535265 CTCAGGTAATTTCCCTGTCTAGG No data
1195976731_1195976740 30 Left 1195976731 X:110535190-110535212 CCTGGGACACTGTACCCCTCAGC No data
Right 1195976740 X:110535243-110535265 CTCAGGTAATTTCCCTGTCTAGG No data
1195976736_1195976740 0 Left 1195976736 X:110535220-110535242 CCTACTTCCTATGGCTGCACCTG No data
Right 1195976740 X:110535243-110535265 CTCAGGTAATTTCCCTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195976740 Original CRISPR CTCAGGTAATTTCCCTGTCT AGG Intergenic
No off target data available for this crispr