ID: 1195976758

View in Genome Browser
Species Human (GRCh38)
Location X:110535353-110535375
Sequence ATCTGAGTAAGTAGGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195976754_1195976758 13 Left 1195976754 X:110535317-110535339 CCTGTGATTGGGACAGAAAGAGA No data
Right 1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG No data
1195976752_1195976758 15 Left 1195976752 X:110535315-110535337 CCCCTGTGATTGGGACAGAAAGA No data
Right 1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG No data
1195976746_1195976758 28 Left 1195976746 X:110535302-110535324 CCTCCCCTGTCAGCCCCTGTGAT No data
Right 1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG No data
1195976749_1195976758 24 Left 1195976749 X:110535306-110535328 CCCTGTCAGCCCCTGTGATTGGG No data
Right 1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG No data
1195976747_1195976758 25 Left 1195976747 X:110535305-110535327 CCCCTGTCAGCCCCTGTGATTGG No data
Right 1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG No data
1195976753_1195976758 14 Left 1195976753 X:110535316-110535338 CCCTGTGATTGGGACAGAAAGAG No data
Right 1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG No data
1195976751_1195976758 23 Left 1195976751 X:110535307-110535329 CCTGTCAGCCCCTGTGATTGGGA No data
Right 1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195976758 Original CRISPR ATCTGAGTAAGTAGGGAAGT TGG Intergenic
No off target data available for this crispr