ID: 1195978522

View in Genome Browser
Species Human (GRCh38)
Location X:110553788-110553810
Sequence CAGGGGATGAAACGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195978520_1195978522 -9 Left 1195978520 X:110553774-110553796 CCAAACACTATGTCCAGGGGATG No data
Right 1195978522 X:110553788-110553810 CAGGGGATGAAACGAGTGTCTGG No data
1195978513_1195978522 -2 Left 1195978513 X:110553767-110553789 CCCCCAACCAAACACTATGTCCA No data
Right 1195978522 X:110553788-110553810 CAGGGGATGAAACGAGTGTCTGG No data
1195978515_1195978522 -4 Left 1195978515 X:110553769-110553791 CCCAACCAAACACTATGTCCAGG No data
Right 1195978522 X:110553788-110553810 CAGGGGATGAAACGAGTGTCTGG No data
1195978512_1195978522 1 Left 1195978512 X:110553764-110553786 CCACCCCCAACCAAACACTATGT No data
Right 1195978522 X:110553788-110553810 CAGGGGATGAAACGAGTGTCTGG No data
1195978514_1195978522 -3 Left 1195978514 X:110553768-110553790 CCCCAACCAAACACTATGTCCAG No data
Right 1195978522 X:110553788-110553810 CAGGGGATGAAACGAGTGTCTGG No data
1195978517_1195978522 -5 Left 1195978517 X:110553770-110553792 CCAACCAAACACTATGTCCAGGG No data
Right 1195978522 X:110553788-110553810 CAGGGGATGAAACGAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195978522 Original CRISPR CAGGGGATGAAACGAGTGTC TGG Intergenic
No off target data available for this crispr