ID: 1195990542

View in Genome Browser
Species Human (GRCh38)
Location X:110677987-110678009
Sequence CTATATTAAATCAATGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195990542_1195990545 22 Left 1195990542 X:110677987-110678009 CCCGTCTCATTGATTTAATATAG 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1195990545 X:110678032-110678054 CTATCCCACTTCTCTTAATAAGG 0: 1
1: 0
2: 2
3: 7
4: 104
1195990542_1195990546 23 Left 1195990542 X:110677987-110678009 CCCGTCTCATTGATTTAATATAG 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1195990546 X:110678033-110678055 TATCCCACTTCTCTTAATAAGGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195990542 Original CRISPR CTATATTAAATCAATGAGAC GGG (reversed) Intronic
902730860 1:18368002-18368024 TTATATTAACCCAGTGAGACAGG + Intronic
904995489 1:34628256-34628278 CTATAAAGAATCACTGAGACTGG - Intergenic
905407935 1:37749222-37749244 CTACATTAATTCATTGAAACGGG - Intronic
906079469 1:43075018-43075040 CTATATTACATTAAGGAGAAAGG - Intergenic
907482890 1:54756912-54756934 CTTTATTAAATCAATAGAACGGG + Exonic
908443159 1:64175407-64175429 ATATATTAAATCAATTACAGTGG - Intronic
908936602 1:69383822-69383844 CTATATTTTAGCAAAGAGACTGG - Intergenic
909264997 1:73546556-73546578 GTATATTAAAACAATGGAACAGG + Intergenic
909633020 1:77786631-77786653 CTATATTTTAGCAAAGAGACTGG - Intronic
909886968 1:80953619-80953641 TTATAATAAATCACTGATACTGG - Intergenic
909913444 1:81289210-81289232 CTATATTATATCAGTAAAACAGG + Intergenic
910218872 1:84869530-84869552 GTATATTAAAGCAATGACATGGG - Intronic
910347027 1:86250704-86250726 CTTAATTAATTCTATGAGACCGG + Intergenic
910402253 1:86848871-86848893 CTATATTAAAACCATAAGAAAGG - Intergenic
911467327 1:98272206-98272228 CTTTATTTAATAAATGATACTGG + Intergenic
912112669 1:106362908-106362930 CTATGCTTTATCAATGAGACTGG + Intergenic
912204987 1:107499363-107499385 CTAAATTAAATCAGTCAGAATGG + Intergenic
912921753 1:113875077-113875099 CCATATCAAATCAATGACCCTGG - Intergenic
912967704 1:114250757-114250779 CATTATTAAATCAAAGAGAGAGG + Intergenic
913525052 1:119683320-119683342 TTCTATTAAAACAATGAGGCTGG + Intronic
914175148 1:145271586-145271608 CTATACGAAATAAATGAGTCAGG + Intergenic
914316423 1:146516528-146516550 TTATTTTTAATCAATGAGAAAGG - Intergenic
914497933 1:148216833-148216855 TTATTTTTAATCAATGAGAAAGG + Intergenic
915098588 1:153482299-153482321 ATATATTGAATCTATGAAACAGG - Intergenic
916480167 1:165207712-165207734 TTCTATTAAATCAATTAGCCTGG + Intronic
917895127 1:179479881-179479903 TTATATTTAAGCAAAGAGACTGG - Intronic
920762350 1:208797409-208797431 ATAAAATAAATCAGTGAGACTGG - Intergenic
920927484 1:210356522-210356544 CTATATAAAAACAAAGAAACAGG - Intronic
1065060391 10:21895019-21895041 CTATACAAAATAACTGAGACTGG - Intronic
1066224738 10:33371171-33371193 TTATCTTAAATCAAAGAGCCAGG + Intergenic
1068243482 10:54336031-54336053 CTATGTTTTATCAAAGAGACTGG + Intronic
1068430530 10:56926068-56926090 CTATTTTAAATAGAAGAGACAGG - Intergenic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1071692624 10:87838219-87838241 CTATATTTAATGAAAAAGACAGG + Intronic
1071873528 10:89819574-89819596 CTATGTTTTATCAAAGAGACTGG - Intergenic
1072513722 10:96154845-96154867 CTATAATAAATTAATCAGAAGGG - Intronic
1073514976 10:104068125-104068147 ATATATTAAATCAAAGAGTTGGG + Intronic
1073525342 10:104176251-104176273 GTATATTAAATAAAACAGACTGG + Intronic
1077598974 11:3559555-3559577 CTTTATTAAATCAATTAATCAGG + Intergenic
1078603510 11:12754860-12754882 CTATCCTAAATTATTGAGACAGG - Intronic
1079725473 11:23875467-23875489 TTATATTAACTCAATGACATTGG - Intergenic
1080153288 11:29078153-29078175 CTATGTTTTATCAAAGAGACTGG + Intergenic
1080979031 11:37377927-37377949 CTATATTTTAGCAAAGAGACTGG - Intergenic
1081349178 11:42027546-42027568 CTATGTTACATCAAAGTGACTGG - Intergenic
1081425444 11:42921606-42921628 CTATAAAGAATAAATGAGACTGG + Intergenic
1082630896 11:55540877-55540899 CTATGTTTTATCAAGGAGACTGG - Intergenic
1083043179 11:59707978-59708000 CTATAATAAATACCTGAGACTGG + Intergenic
1084993398 11:72951023-72951045 CTCAAATAAATCAATGACACAGG + Intronic
1087574880 11:99977136-99977158 CTATATTTTAGCAAGGAGACTGG - Intronic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1088408551 11:109507915-109507937 CTATATTAAAAAACTGAGACTGG + Intergenic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1094067455 12:26376627-26376649 AGATATTAAACCAAAGAGACAGG - Intronic
1094083431 12:26563017-26563039 CCAAATTAAATCAATGACAACGG + Intronic
1095685899 12:45033176-45033198 CAATATTAAATAAATGAATCAGG + Intronic
1095780633 12:46055193-46055215 CTCTATTAAATTAATGGTACTGG + Intergenic
1096308535 12:50500218-50500240 ATATATTAAGTTAATGTGACAGG - Intergenic
1096690205 12:53315839-53315861 GTATATTGAATGAATGAAACTGG - Intronic
1097124454 12:56762806-56762828 CTCTATTTAATTACTGAGACAGG - Intronic
1097152093 12:56986724-56986746 CTATAATAAATACCTGAGACTGG - Intergenic
1097324248 12:58257910-58257932 CTCTATTTAATAAATGATACTGG + Intergenic
1098672488 12:73248629-73248651 CTATATTTAAAAAAAGAGACTGG - Intergenic
1099139453 12:78953357-78953379 CTATAACAAATCAATGTGATGGG - Intronic
1099483769 12:83201443-83201465 CTATATTAAATCTACGAACCAGG - Intergenic
1099856914 12:88179732-88179754 CTGTATTAAATAAATGCGACCGG - Intronic
1100066400 12:90651312-90651334 TAATATTAACTCAGTGAGACTGG + Intergenic
1101893480 12:108735846-108735868 TATTATTAAATAAATGAGACTGG + Intergenic
1102278950 12:111603222-111603244 CTCTATTAACTGAACGAGACAGG - Intergenic
1104786589 12:131454143-131454165 CTAAATAAAATCAATTAAACTGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1109246048 13:59955874-59955896 CTATGTTTTATCAAAGAGACTGG + Intronic
1109325058 13:60857651-60857673 CTATATTAAACCAACCAGATAGG - Intergenic
1110629290 13:77688249-77688271 CTATCTTACATCAATCAGAATGG + Intergenic
1110970848 13:81759084-81759106 CTATATTTTAGCAAAGAGACTGG - Intergenic
1113362899 13:109647556-109647578 AGATTTTAAGTCAATGAGACCGG + Intergenic
1117256350 14:53981766-53981788 CAATATTGAATCAATGAGACTGG - Intergenic
1117564362 14:56978156-56978178 CTGTATTACATGAATGAGTCTGG - Intergenic
1120621853 14:86774745-86774767 TTATATTTAAGCAAAGAGACTGG + Intergenic
1120886577 14:89456455-89456477 CTAAAATAAATAAATGAGGCCGG + Intronic
1120947430 14:90011604-90011626 CTATGTTTTATCAAGGAGACTGG + Intronic
1124656403 15:31512517-31512539 GTATATTGAATAAAGGAGACAGG + Intronic
1125665124 15:41424388-41424410 ATATATAAAAGAAATGAGACAGG + Intronic
1125787284 15:42331298-42331320 CTTTGATAAATCAAAGAGACAGG - Intronic
1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG + Intergenic
1127728783 15:61778752-61778774 GTACATTGAATCAATGAAACAGG - Intergenic
1128470635 15:67949078-67949100 CTAAATCATATCAATGAGGCCGG - Intergenic
1128854793 15:71000748-71000770 CTAAATTAGATCACGGAGACAGG - Intronic
1129813948 15:78535458-78535480 CTCTATTAATTCTATGAGATAGG - Exonic
1129927612 15:79379158-79379180 CCATATTTAATCAATAAGAGTGG + Intronic
1131902980 15:97108970-97108992 AAATATTAGATCAATAAGACAGG + Intergenic
1133511120 16:6458409-6458431 TTCTAATAAATCAATGAGTCTGG - Intronic
1135914462 16:26592847-26592869 ATATATTAAAGCAGAGAGACTGG - Intergenic
1135926099 16:26695394-26695416 CTATATTTTAGCAAAGAGACTGG - Intergenic
1136748229 16:32611148-32611170 ATATTTTAAAACAATGAGGCTGG + Intergenic
1138601019 16:58054306-58054328 CTATATTAAATGAAAAAGGCAGG - Intergenic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1139030164 16:62870547-62870569 TTAAAATACATCAATGAGACTGG - Intergenic
1139077551 16:63471260-63471282 TTATATTAAAAGAATGAGATTGG + Intergenic
1139104974 16:63817711-63817733 CTTTCTCAAATCCATGAGACTGG + Intergenic
1139189812 16:64849081-64849103 TTATATTAAATCAGTGAGATAGG - Intergenic
1203050365 16_KI270728v1_random:870355-870377 ATATTTTAAAACAATGAGGCTGG + Intergenic
1144860104 17:18296283-18296305 CTATATAAAATCAATGCAGCTGG + Intronic
1146479161 17:33190296-33190318 TTATATTAAAACTATGAAACAGG + Intronic
1149578895 17:57734009-57734031 CTTTACAAAAGCAATGAGACAGG - Intergenic
1150252661 17:63716460-63716482 GTAAATCAAATCCATGAGACTGG - Intronic
1152050415 17:77970526-77970548 ATATGTTAAATGACTGAGACTGG + Intergenic
1155270209 18:24134186-24134208 CTATATTCAGTGAATGAGAAGGG + Intronic
1156808980 18:41224437-41224459 CTATGTTTTATCAAAGAGACTGG + Intergenic
1156892270 18:42204273-42204295 CTATATTTTAGCAAAGAGACTGG + Intergenic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
1159263129 18:66042444-66042466 CTACAACAAAACAATGAGACTGG + Intergenic
1159902802 18:74063853-74063875 ATGTCTTAAATCAATGAAACTGG - Intergenic
1160095586 18:75869498-75869520 CTATTTTAAAGAATTGAGACAGG - Intergenic
1168377141 19:55889846-55889868 CTATAGTATATCAGTGAGAATGG + Intergenic
928019498 2:27691401-27691423 CTATATTAGTTCAATTAGAAAGG - Intronic
928918147 2:36496437-36496459 CTATATTAGATGAAAGAAACAGG - Intronic
932361822 2:71115224-71115246 CTATAATCAATCAATCAGTCAGG + Intronic
933187641 2:79296299-79296321 CTATATGAAATAAAAGAGATTGG - Intronic
934098764 2:88631377-88631399 CTATAATAAAGAAATGATACTGG - Intergenic
935831204 2:107002278-107002300 CAAAATGAAATCAATGAAACAGG - Intergenic
936730390 2:115375310-115375332 CTATATTTTAGCAAAGAGACTGG - Intronic
936848746 2:116870869-116870891 CAATATTAGAACAATGAGACAGG - Intergenic
936932206 2:117801668-117801690 CGATATTAGATTAATGAGAAGGG - Intergenic
937695127 2:124800459-124800481 CTACAATAAATCAATCAAACAGG - Intronic
938865098 2:135410393-135410415 CTATATTCAATAAATGGTACTGG + Intronic
941368388 2:164634552-164634574 CTAAATAAAATCAATGAGATTGG - Intergenic
941405969 2:165089086-165089108 CTATGTTTAATGAATGATACAGG + Exonic
942725928 2:179007834-179007856 ATATATTAAATAATGGAGACAGG - Intronic
944095513 2:195962883-195962905 TTATATTAAATGAATAAGCCAGG - Intronic
944519633 2:200551780-200551802 GTATTGTAAATCAAGGAGACTGG + Intronic
945562353 2:211354423-211354445 TTATATAAAATCAAGGAGAAAGG - Intergenic
945759465 2:213895692-213895714 CTATATTTAATAAATGGTACTGG + Intronic
946270820 2:218592047-218592069 TTATAATAAATCAATGAGGTAGG - Intronic
1170102442 20:12717317-12717339 CAATAGTAAATCAATGAGTTGGG - Intergenic
1172369688 20:34379232-34379254 CTATATAAAATCAACCAGCCAGG - Intronic
1174084441 20:47995871-47995893 GCAAATTAAAACAATGAGACTGG - Intergenic
1174643112 20:52062345-52062367 CTATTTTAAATAAAGGAGTCAGG + Intronic
1174965179 20:55205371-55205393 CTATATTCAATAAATGATGCTGG - Intergenic
1177359474 21:20049617-20049639 CTATACTTTAGCAATGAGACTGG + Intergenic
1177669816 21:24210061-24210083 CTCCATTAAATAAATGAGAGAGG + Intergenic
1178196886 21:30355650-30355672 CTATATTAAAAAAATTGGACAGG - Intronic
1181846470 22:25713396-25713418 TTATAATAGATCAATGAGACTGG + Intronic
1183174356 22:36211965-36211987 ATATATTCAATCAATGATATAGG + Intergenic
949555014 3:5145344-5145366 ATATATTAAATCAAAAAGCCGGG - Intronic
952570043 3:34702747-34702769 CTATGTTTTATCAAAGAGACTGG - Intergenic
953005601 3:38976143-38976165 CAATATGAAAACAATGACACTGG - Intergenic
953362997 3:42316100-42316122 CCATCTTATATCAATGAGAATGG - Intergenic
953545366 3:43860394-43860416 CTATAAGAAATAAATGAAACTGG + Intergenic
954230349 3:49212191-49212213 TTCTATGAAATCAATGAAACTGG - Intronic
954534126 3:51345285-51345307 TTATATTAAAGCAAGGAGTCAGG + Intronic
955314988 3:57930928-57930950 CTATATTAAGTAAAAGAAACAGG + Intergenic
956098650 3:65744487-65744509 CTGTTTTAAATGAATGAGTCTGG + Intronic
956953442 3:74309359-74309381 TTAGATTAAATCAAGGAGAATGG - Intronic
958048033 3:88308802-88308824 TTTTATTAAATCAATAAAACAGG - Intergenic
958552692 3:95637243-95637265 CTCTATTAACTCTATGATACTGG + Intergenic
960197295 3:114784778-114784800 CTATTTTAAGAAAATGAGACTGG + Intronic
960657564 3:120022768-120022790 CTCTATTAAATAAAAGACACTGG + Intronic
960958717 3:123053892-123053914 CTTTATAAAATCTATGAGATGGG + Intergenic
961078793 3:124006603-124006625 CTATATTAAATGTATTAGAGTGG - Intergenic
964523542 3:157592730-157592752 CTATATTAAATCTGAGATACAGG - Intronic
965679689 3:171237030-171237052 GTCTATTAAGTGAATGAGACAGG - Intronic
965941051 3:174182188-174182210 CTATATTAAGGCAATGATAGTGG - Intronic
967501521 3:190203468-190203490 CTATATTTTAGCAAGGAGACTGG + Intergenic
968216583 3:196896796-196896818 CTATAAGAACTAAATGAGACAGG + Intronic
970767690 4:19570112-19570134 TTATATTAAACCGATCAGACAGG + Intergenic
971205687 4:24566198-24566220 ATATATTAAAAAAATGAGCCAGG - Intronic
971977632 4:33710831-33710853 CTATATTTTAGCAAAGAGACTGG - Intergenic
972189496 4:36573190-36573212 ATATATAAAATCAATGATTCTGG - Intergenic
972887580 4:43510897-43510919 CTATGTTATAGCAAAGAGACTGG - Intergenic
974447720 4:62007795-62007817 TTATTTTAAACCCATGAGACTGG + Intronic
974571107 4:63649926-63649948 CTATAGTAAATATCTGAGACAGG + Intergenic
974748076 4:66102316-66102338 CTATATTTTAGCAAAGAGACTGG + Intergenic
975426019 4:74228786-74228808 CTATATAAAATAAACAAGACAGG + Intronic
975924325 4:79430905-79430927 GAATATTAAAGCAATGAGAAAGG + Intergenic
976003523 4:80400966-80400988 CTATGTTTCATCAAAGAGACTGG + Intronic
976036783 4:80833383-80833405 CTATAAAGTATCAATGAGACAGG - Intronic
976875687 4:89850919-89850941 TTATATTTTATCAAAGAGACTGG - Intergenic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
978722558 4:111928750-111928772 CTATATTCAATAAATGGGGCTGG - Intergenic
978921705 4:114191649-114191671 CTATTTTAAGTAAATAAGACAGG - Intergenic
979594372 4:122517848-122517870 ATATTTTAAATCAATGAAAAAGG - Intergenic
980386958 4:132099335-132099357 GCATATTAAATCAATGGGAATGG - Intergenic
980499902 4:133636121-133636143 CTCTATTCAATAAATGACACTGG + Intergenic
980726371 4:136766752-136766774 GTATGATAAATCAATGAGGCTGG + Intergenic
981175576 4:141678894-141678916 TTATTTAAAATCAATGAGGCCGG - Intronic
981588627 4:146331844-146331866 CAATATTTAATGAGTGAGACTGG + Intronic
982113042 4:152073453-152073475 CTTTTTTTAATCAGTGAGACTGG + Intergenic
983296880 4:165877535-165877557 CTATAGTACAACAATGAAACAGG - Intronic
983337584 4:166416407-166416429 CTATATTTTAGCAAAGAGACTGG - Intergenic
983853174 4:172608363-172608385 CTCTATTCAATAAATGATACGGG - Intronic
984219542 4:176956017-176956039 CTATATTTTAGCAAAGAGACTGG - Intergenic
984324823 4:178239095-178239117 CAATATTCAATAAATGATACTGG + Intergenic
984681965 4:182621260-182621282 ATATTTTAAAACAATGAGGCAGG - Intronic
986046437 5:4042766-4042788 TTATAATCATTCAATGAGACCGG - Intergenic
986911686 5:12565494-12565516 TTATGTTATAGCAATGAGACTGG - Intergenic
986979628 5:13432255-13432277 CTATATTCAATAAATGATGCTGG + Intergenic
987797818 5:22652872-22652894 CTATGTGAAAGCATTGAGACTGG + Intronic
988234895 5:28529210-28529232 CTCTTTTAAATAAATGACACTGG - Intergenic
989189515 5:38656552-38656574 CTATATAAAGTCAAAGTGACGGG - Intergenic
989254500 5:39351641-39351663 CTATATTTTATCAAAGAGACTGG - Intronic
989447739 5:41550504-41550526 CTATATTCAATAAATGTTACTGG + Intergenic
990965018 5:61436816-61436838 CAATATGAAAACAATGAAACTGG + Intronic
991190443 5:63866843-63866865 TTAAATTAAATCAAAGAGAAAGG - Intergenic
992030690 5:72718555-72718577 CTTTATTATATCACTTAGACTGG + Intergenic
992318243 5:75581972-75581994 CTATATGAAATTTATGAGTCGGG - Intronic
993207539 5:84902154-84902176 CTTTATTAAATAAATGGCACTGG + Intergenic
993890054 5:93462751-93462773 CTATATTTTAGCAAAGAGACTGG + Intergenic
994937636 5:106275499-106275521 TTTTATTAAATAAATGAGATTGG + Intergenic
995451746 5:112309796-112309818 CTATATTCAAACCATGAGAAGGG + Intronic
995824316 5:116276732-116276754 TTATATTAAATGAATGAAACTGG + Intronic
996255805 5:121402075-121402097 CTATATTTTAACAAAGAGACTGG + Intergenic
996485209 5:124025692-124025714 TTAAATGAAATCACTGAGACTGG - Intergenic
996878945 5:128271555-128271577 CTTTATTAAATCTATGTGACAGG + Intronic
999264456 5:150257165-150257187 CTATTTTTTATCGATGAGACTGG + Intronic
999767423 5:154752110-154752132 CTACATTAAAATAATGAAACTGG - Intronic
999983259 5:156977986-156978008 ATGTATTAAATCAATGTCACTGG + Intergenic
1000229179 5:159298991-159299013 TTATATTATAGCAAAGAGACTGG - Intergenic
1000246612 5:159453553-159453575 CAATATTGAATTAATAAGACTGG + Intergenic
1000823234 5:166011387-166011409 CTCTATAAAATGAATGAGATAGG - Intergenic
1002984291 6:2173621-2173643 CTATTCTACATCAATGATACAGG + Intronic
1003287683 6:4748918-4748940 CTATAATAGAACAGTGAGACTGG + Intronic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1004636019 6:17468524-17468546 ATGTAATAAATCAATGAGAAAGG - Intronic
1005074325 6:21891606-21891628 CTATATTAAATCACTCAGTGAGG - Intergenic
1005377973 6:25203492-25203514 ATATATTTATTCATTGAGACAGG - Intergenic
1005698477 6:28374881-28374903 CAATTTTAAATCAATAAAACAGG - Intergenic
1007329419 6:41093371-41093393 CAATATTAAAGCAGTGAAACAGG - Intronic
1008585631 6:52946107-52946129 CTATATCAAATAAATGAAATAGG + Intergenic
1008885383 6:56426805-56426827 CTATATTATATCAGTCAGAATGG + Intergenic
1009034034 6:58094666-58094688 TTATACTAAGTAAATGAGACAGG - Intergenic
1009209644 6:60846369-60846391 TTATACTAAGTAAATGAGACAGG - Intergenic
1009639544 6:66315311-66315333 ATATATCAAATAAATGGGACTGG - Intergenic
1010426693 6:75735597-75735619 CTATCTTAGATCAATGAGGCAGG - Intergenic
1010804817 6:80223109-80223131 CTATATTAAATGAATATGAATGG - Intronic
1011383586 6:86769237-86769259 ATATAAAAAATCAATGAAACTGG + Intergenic
1011440045 6:87378185-87378207 CTTTTTAAAATCTATGAGACTGG + Intronic
1012070301 6:94605287-94605309 CTATATTTTAGCAAAGAGACTGG - Intergenic
1012662174 6:101914261-101914283 CTATATTCAACCAATGTGGCAGG - Intronic
1012733334 6:102909192-102909214 TTATGTTAAATGAATAAGACAGG - Intergenic
1013134212 6:107264080-107264102 CTATTTTAAATGCATAAGACAGG + Intronic
1016371046 6:143374476-143374498 CTATTTTAAATTAATAAGCCTGG + Intergenic
1016694026 6:146972209-146972231 CTAGATTCAACCAATAAGACAGG + Intergenic
1018407510 6:163503351-163503373 CTATATTCAATCAATGGTGCTGG - Intronic
1023193347 7:37607354-37607376 TTATATTAATTCAATGAGTTAGG - Intergenic
1024814783 7:53256266-53256288 CTATATTTTAGCAAAGAGACTGG + Intergenic
1027404245 7:77842892-77842914 CTATATAAAATTAATGAGCATGG + Intronic
1027785502 7:82574597-82574619 CTATGTTTTATCAAAGAGACTGG - Intergenic
1027799572 7:82734591-82734613 CTATATTGGATCAATGCAACAGG + Intergenic
1028253028 7:88558388-88558410 TTATGTTTAAGCAATGAGACTGG + Intergenic
1028255250 7:88587767-88587789 CTTTTTTAAATAAATGAGAAGGG + Intergenic
1028746505 7:94333350-94333372 CTATATTCAATCTAAGAGAGAGG - Intergenic
1029917798 7:104230493-104230515 CTAGATTAAACCAGGGAGACTGG + Intergenic
1030766770 7:113420034-113420056 CTATCTTAAATCTATGACAAAGG + Intergenic
1030970014 7:116045279-116045301 TTATATTTTAGCAATGAGACTGG + Intronic
1031724463 7:125220545-125220567 CTATATTACACCAATCAGAAAGG + Intergenic
1033931155 7:146523837-146523859 AAATATGAAATCAATTAGACTGG - Intronic
1034199180 7:149271236-149271258 CAATATAAAATCAAAGAGCCAGG - Intronic
1035165843 7:156989267-156989289 CTATAGAAAATCACTGAGAATGG + Intergenic
1035194669 7:157206751-157206773 ATATATTAAATTAATTAGCCAGG - Intronic
1035832359 8:2710669-2710691 TTATTTTAAATCAGTGAGAATGG - Intergenic
1037202672 8:16276744-16276766 CTATAGTAAATCAAGAAGAGAGG - Intronic
1037269211 8:17107625-17107647 GTATATTAAATGAATGAGAATGG - Intronic
1039572689 8:38600294-38600316 TTAAATTAAATCAATAAGATGGG + Intergenic
1040392950 8:46965090-46965112 AAATATTAACTCAGTGAGACTGG - Intergenic
1040889961 8:52306762-52306784 CTATATTATATCAATAAACCAGG - Intronic
1041490476 8:58427079-58427101 CTATATAAAATTAATGAGGATGG + Intronic
1044212780 8:89569789-89569811 CTAAATTAAATCACTCTGACTGG + Intergenic
1044273892 8:90277849-90277871 CTAAATAAAATCAATTAAACTGG - Intergenic
1044295401 8:90521162-90521184 CTATATTTAATAATTAAGACAGG - Intergenic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1045541825 8:103093871-103093893 CTATGCTAAATCAAAGAGCCAGG - Intergenic
1046988810 8:120425216-120425238 CTATATTAAAATAATGAGAAGGG + Intronic
1047561291 8:125990343-125990365 ATATATTAAATCAAAGAGCTGGG + Intergenic
1048226861 8:132596099-132596121 CTATTTTAAATTATTGAGGCTGG + Intronic
1048560255 8:135528645-135528667 CTATAGCAAAACACTGAGACTGG + Intronic
1048602635 8:135934348-135934370 CAATATGAAATAAATGAGATGGG + Intergenic
1050851980 9:10299910-10299932 CTATATGAGAGCAATGACACTGG - Intronic
1050897360 9:10900103-10900125 CTATATTTTAGCAAAGAGACTGG - Intergenic
1051178894 9:14389849-14389871 CTATATCAACTCAATGTGTCTGG - Intronic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1051542035 9:18230555-18230577 ATAAATTATATCAATGAGACTGG + Intergenic
1051720025 9:20027688-20027710 ATATATGAATTCAATTAGACAGG + Intergenic
1052633987 9:31076736-31076758 CTTTATTATATCATTGAGACTGG - Intergenic
1052969505 9:34368574-34368596 CTATATTTTAGCAAAGAGACTGG - Exonic
1058109463 9:101016474-101016496 ATATATTAATCCAATGAGATGGG + Intergenic
1059544074 9:115158773-115158795 ATATATAAAAACAATGAGCCAGG - Intronic
1185876689 X:3707582-3707604 TTATTTTAAATAAAAGAGACAGG - Intronic
1186818760 X:13264761-13264783 CTATATGAGATACATGAGACTGG - Intergenic
1187313311 X:18167567-18167589 CTATTTTATTTCATTGAGACAGG + Intronic
1187583352 X:20633151-20633173 CCATATTAAATAAATTGGACTGG + Intergenic
1187958552 X:24544999-24545021 ATATCTCTAATCAATGAGACAGG - Intergenic
1190117223 X:47633787-47633809 CAATATTGACTGAATGAGACAGG - Intergenic
1191154570 X:57258238-57258260 CTATATGAAAAAAATGAAACTGG + Intergenic
1193805439 X:85988070-85988092 CAATATTCAATCAAGGATACTGG - Intronic
1195990542 X:110677987-110678009 CTATATTAAATCAATGAGACGGG - Intronic
1196314171 X:114203012-114203034 CTATATTAAATTTATGACGCAGG + Intergenic
1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG + Intergenic
1196680682 X:118466687-118466709 TTCTATTAAATCAATAACACCGG + Intergenic
1196725209 X:118889255-118889277 ATATATTAAATCAAAAAGCCAGG + Intergenic
1196922459 X:120598789-120598811 CTAAATTCACTCTATGAGACTGG + Intronic
1197867947 X:131038460-131038482 CAATCTTAAAACAATAAGACAGG - Intergenic
1199318379 X:146408526-146408548 CTATAGAAAATACATGAGACTGG - Intergenic
1200788672 Y:7280821-7280843 TTATTTTAAATAAAAGAGACAGG + Intergenic
1202175161 Y:22092105-22092127 GTATTTTAATTCATTGAGACAGG + Intronic
1202216201 Y:22494278-22494300 GTATTTTAATTCATTGAGACAGG - Intronic
1202326985 Y:23701786-23701808 GTATTTTAATTCATTGAGACAGG + Intergenic
1202543784 Y:25968266-25968288 GTATTTTAATTCATTGAGACAGG - Intergenic