ID: 1195990547

View in Genome Browser
Species Human (GRCh38)
Location X:110678036-110678058
Sequence GGACCCTTATTAAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195990547_1195990550 0 Left 1195990547 X:110678036-110678058 CCCACTTCTCTTAATAAGGGTCC No data
Right 1195990550 X:110678059-110678081 ACCTTTCACTCCACACAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195990547 Original CRISPR GGACCCTTATTAAGAGAAGT GGG (reversed) Intronic