ID: 1195990547 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:110678036-110678058 |
| Sequence | GGACCCTTATTAAGAGAAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195990547_1195990550 | 0 | Left | 1195990547 | X:110678036-110678058 | CCCACTTCTCTTAATAAGGGTCC | No data | ||
| Right | 1195990550 | X:110678059-110678081 | ACCTTTCACTCCACACAGCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195990547 | Original CRISPR | GGACCCTTATTAAGAGAAGT GGG (reversed) | Intronic | ||