ID: 1195991907

View in Genome Browser
Species Human (GRCh38)
Location X:110691255-110691277
Sequence CAGGCTGAGGGGCCTATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 113}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195991899_1195991907 5 Left 1195991899 X:110691227-110691249 CCCAAAAAAGGAGCAAGCATCTA 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1195991892_1195991907 19 Left 1195991892 X:110691213-110691235 CCTCCCCAGACCCACCCAAAAAA 0: 1
1: 2
2: 4
3: 116
4: 1052
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1195991898_1195991907 8 Left 1195991898 X:110691224-110691246 CCACCCAAAAAAGGAGCAAGCAT 0: 1
1: 1
2: 0
3: 20
4: 238
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1195991894_1195991907 16 Left 1195991894 X:110691216-110691238 CCCCAGACCCACCCAAAAAAGGA 0: 1
1: 0
2: 4
3: 38
4: 384
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1195991891_1195991907 20 Left 1195991891 X:110691212-110691234 CCCTCCCCAGACCCACCCAAAAA 0: 1
1: 0
2: 12
3: 84
4: 823
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1195991896_1195991907 14 Left 1195991896 X:110691218-110691240 CCAGACCCACCCAAAAAAGGAGC 0: 1
1: 0
2: 4
3: 10
4: 199
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1195991889_1195991907 27 Left 1195991889 X:110691205-110691227 CCCTGTTCCCTCCCCAGACCCAC 0: 1
1: 1
2: 6
3: 97
4: 724
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1195991890_1195991907 26 Left 1195991890 X:110691206-110691228 CCTGTTCCCTCCCCAGACCCACC 0: 1
1: 0
2: 9
3: 113
4: 791
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1195991895_1195991907 15 Left 1195991895 X:110691217-110691239 CCCAGACCCACCCAAAAAAGGAG 0: 1
1: 0
2: 1
3: 18
4: 230
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1195991900_1195991907 4 Left 1195991900 X:110691228-110691250 CCAAAAAAGGAGCAAGCATCTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1195991897_1195991907 9 Left 1195991897 X:110691223-110691245 CCCACCCAAAAAAGGAGCAAGCA 0: 1
1: 0
2: 1
3: 15
4: 271
Right 1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195991907 Original CRISPR CAGGCTGAGGGGCCTATAAA GGG Intronic
900760751 1:4468548-4468570 CAGGCTGTGGAGCCTATTATGGG + Intergenic
902343798 1:15801122-15801144 CAGGCTGAGGGACATGCAAAGGG + Intergenic
902601251 1:17541039-17541061 CAGCCTGAGGGCCCGATGAAGGG - Intronic
902693811 1:18126963-18126985 CAGGGTGAGGGGCATCTAATGGG - Intronic
905234937 1:36539713-36539735 CTGGCTGAGTGGCCTACAAAAGG + Intergenic
906726581 1:48048815-48048837 CAGCCAGAGCGGCCTGTAAAAGG - Intergenic
907688415 1:56637030-56637052 CAGACTTAGAGACCTATAAAAGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
912799926 1:112714395-112714417 CAGGCTGAAGGGCATCTAAATGG + Intronic
915266212 1:154719843-154719865 CAGGCAGAGAAGCCTGTAAAGGG - Intronic
918160670 1:181896031-181896053 CAGCCTATGGGGCATATAAATGG - Intergenic
920053371 1:203176323-203176345 GAGGCTGAGGGCCCTAGAGAGGG + Intergenic
922705078 1:227786442-227786464 CAGCCAGAGGGGCCTATGACAGG - Intergenic
924800056 1:247322859-247322881 CATGCTGAGAGGCCCATCAATGG + Intronic
1065820456 10:29520457-29520479 CAGGCTGAGGGGCATAGGGAAGG - Intronic
1077618050 11:3693250-3693272 CATGCTGAGCGCCCTAGAAATGG + Exonic
1082942126 11:58717142-58717164 AAGGATGGGGGGCATATAAAAGG - Intronic
1089454106 11:118615887-118615909 CAGGCTCAGGGGCCTAGTAGGGG + Intronic
1092106432 12:5924951-5924973 CAGGCTCAGGGCTCTAAAAAAGG + Intronic
1092720138 12:11433138-11433160 GGGGCTGAGGGTTCTATAAAAGG - Intronic
1092951032 12:13503385-13503407 GAGGCTGAGAGGACAATAAATGG - Intergenic
1093773073 12:23039687-23039709 CAGGCTGAAGGACTTAAAAAAGG + Intergenic
1094605250 12:31943907-31943929 CAGGCTGGGGAGCTTATAATGGG + Intergenic
1096228789 12:49886008-49886030 CAGGCTGAGGGGGCTGAAATGGG - Intronic
1097012894 12:55965935-55965957 CTGGCTGTGGGGGCTACAAAAGG - Exonic
1102992985 12:117327990-117328012 CAGACTGAGGGGCCATCAAAGGG + Intronic
1103741379 12:123093974-123093996 CAGCCTGAGGGGCCTCTCACTGG - Intronic
1110372906 13:74759313-74759335 AAAGCTGAGGGTCCTATGAAGGG - Intergenic
1110489559 13:76087228-76087250 CAGGCTGAGAGGCCTAGGAGGGG - Intergenic
1117479877 14:56132063-56132085 CAGTGTGAGAGGCTTATAAAGGG + Intronic
1120651612 14:87140574-87140596 CAGGCTGAAGGCCATAGAAAAGG - Intergenic
1121656513 14:95600591-95600613 CAAGCTGACGGGTCTATAATTGG - Intergenic
1121717846 14:96088904-96088926 GAGGCTGAGGGGCCTCCATAGGG - Exonic
1124095369 15:26644061-26644083 CAGGCTGAGGGGCCTACCAGCGG + Intronic
1125713249 15:41804210-41804232 CAGACTGAGCTGCCCATAAATGG - Intronic
1128074302 15:64816676-64816698 CAGGCTGCGGGCCCGAGAAAGGG + Exonic
1137003008 16:35247607-35247629 CCAGCTGACGGGCATATAAAAGG - Intergenic
1137016815 16:35385166-35385188 CCAGCTGAGGGACATATAAAAGG - Intergenic
1137485042 16:48883514-48883536 CAAGCTGATTGGCCTCTAAAGGG - Intergenic
1138117260 16:54370434-54370456 CAGGCGGCGGGGACTATTAACGG + Intergenic
1138856878 16:60704926-60704948 AATGCAGAGGGGCCTATTAAGGG - Intergenic
1141658331 16:85428210-85428232 CAGGCTGAGGGCCCGAGACAAGG + Intergenic
1141708144 16:85680971-85680993 CAGCCAGAGGGGCCTTTGAAAGG - Intronic
1141788139 16:86215339-86215361 CAGGCTGCGTGGCCTCTCAAAGG + Intergenic
1143019867 17:3911744-3911766 TAGGCTGAAGGGGCCATAAAAGG - Intronic
1143148047 17:4789355-4789377 CAGGCTGAGGGTCCGGCAAAGGG + Intronic
1143583154 17:7838177-7838199 TAGGCTGAGGGGTGTGTAAAAGG + Intergenic
1144535575 17:16086431-16086453 CAGGCTGAAGGACTTTTAAAAGG + Exonic
1147211319 17:38874083-38874105 CAGGCTGAGAGGCCTCTAACAGG + Intronic
1149576246 17:57715587-57715609 CAGGTAGAGGGGCAGATAAAAGG - Intergenic
1151858298 17:76738062-76738084 CAGGTTGAGGGGCCCACGAAGGG - Exonic
1155454710 18:25998742-25998764 CAGGCTGAGGTTCCTATTAGAGG - Intergenic
1159419044 18:68191828-68191850 CAGGCTGAGAGTCCAATCAAGGG - Intergenic
1163989001 19:20981008-20981030 CCAGCTGAGGGGCTTATAAAAGG - Intergenic
1164566134 19:29327373-29327395 GATGCTGAGGGGCCTTAAAAGGG - Intergenic
1168588476 19:57613993-57614015 CTGGTTGAGGGTCCTTTAAAAGG + Intergenic
926531638 2:14054254-14054276 CGAGCTGAGGGGCCAATGAAGGG - Intergenic
929555032 2:42920779-42920801 CAGGGTGAGGGGCCTTTGAAAGG - Intergenic
931244259 2:60479483-60479505 CAGCCTGAGGGGCTTGTTAAGGG - Intronic
942946248 2:181678036-181678058 CGGGCTGAGGGGTCCATCAAAGG + Exonic
943161783 2:184263132-184263154 CAGACTGAGTCGCTTATAAAAGG - Intergenic
946374472 2:219299774-219299796 CAGGCTCAGGGGCCTGGAGATGG + Exonic
948215661 2:236228305-236228327 CAGGCTGAGGGTTCTATGAAGGG + Intronic
1169134890 20:3191189-3191211 CTGGCTGAGGGGACTATAACAGG - Exonic
1170612908 20:17928968-17928990 CAGGATGAGGAGCCTATCCACGG + Intergenic
1173076988 20:39828679-39828701 CAGGCTGAGGGGGCCAGAATAGG + Intergenic
1174048825 20:47753182-47753204 CAATCTGAGGGGCCTCGAAAAGG + Intronic
1175347860 20:58295115-58295137 CAGGATAAGGGGGCTATAGATGG - Intergenic
949958196 3:9287585-9287607 TAGGCAGTGGAGCCTATAAAAGG + Intronic
954634086 3:52062266-52062288 CAGGCTGAGGTGCCCTTAAGTGG - Intergenic
959406560 3:105968215-105968237 CAGGCTGAGGGACATTGAAATGG - Intergenic
961442309 3:126960302-126960324 CAGGCTCAGGGGCATATGCAGGG - Exonic
968335860 3:197913022-197913044 AAGGCTGTGGGGCTTAAAAAGGG + Intronic
971904479 4:32709101-32709123 TAGGAAGAGGGTCCTATAAAAGG + Intergenic
972877396 4:43380263-43380285 CAAGCTGAGGAGCCAATGAACGG - Intergenic
975077940 4:70236293-70236315 CAGGCCTAGAGGCCTATATAGGG - Intergenic
976178082 4:82374143-82374165 CAGCCTTGGGGGCCTTTAAAAGG + Intronic
977061236 4:92259143-92259165 CAGCCTGATCTGCCTATAAAAGG + Intergenic
978472281 4:109082404-109082426 CATGCTGATGGGACTGTAAATGG - Intronic
979122353 4:116919928-116919950 CAGGCTCTGAGGCCTATAATAGG - Intergenic
980842314 4:138278704-138278726 CAGGAAGAGGGCCCTATACAAGG + Intergenic
982890231 4:160838709-160838731 AAGGCTGATGGGTCTAGAAATGG + Intergenic
983507781 4:168573667-168573689 CAGGCTGAGAGGGTTAGAAAAGG + Intronic
986644023 5:9898803-9898825 CAGGCAGAGGGGCCTGGACAGGG + Intergenic
988076763 5:26363854-26363876 CAGGCTGAGGTGCTCTTAAATGG + Intergenic
988494308 5:31732070-31732092 GAGGATGAGGGGCCTCTACAAGG - Intronic
988639942 5:33030696-33030718 CAAGCTGAAGAACCTATAAAGGG - Intergenic
990043187 5:51396821-51396843 CAGGCTGAGGAGTCTAAAAGGGG - Intergenic
990287053 5:54310669-54310691 TTGGCTGCGGCGCCTATAAAAGG + Intergenic
994710189 5:103256944-103256966 GTGGCTGAGGGGCATATAAGAGG - Intergenic
995256611 5:110053867-110053889 GGGGCTGAGGGAACTATAAAGGG - Intergenic
1006095125 6:31651592-31651614 CAGGCTAAGGGGCCTAAACGAGG + Intronic
1006104722 6:31709847-31709869 CAGGGTGAGAGGCCTGGAAAGGG + Intronic
1008506692 6:52237651-52237673 CAGGCAGAGGGGCCTATTAAAGG - Intronic
1009396541 6:63206298-63206320 CAGGCTGAGGTGGCCGTAAATGG + Intergenic
1009738173 6:67706480-67706502 CAGGCTGAGAAGACTATAGAGGG - Intergenic
1011701073 6:89955435-89955457 GAGGCTGAGGGGACTAGCAAGGG + Intronic
1014158141 6:118135895-118135917 CAGGCTGCTGGGCCTATGAGGGG - Intronic
1017489839 6:154935303-154935325 CAAGCTGAGCGGACTATAAATGG + Intronic
1017809242 6:157973064-157973086 GAGTCTGAGGGGCCTTTACAGGG + Intergenic
1018426306 6:163685817-163685839 CAGTCTGAGGGGCAGATTAACGG + Intergenic
1019214417 6:170434169-170434191 CAGGCTGAGTGGCTAAGAAACGG - Intergenic
1021820554 7:24494022-24494044 CAGGCTGAGTAGAATATAAATGG + Intergenic
1028983883 7:96995273-96995295 CAGGCTGGGGGGTCTAGAGAGGG + Intergenic
1033570261 7:142620716-142620738 CAGGCTAAGGGAACTATGAAAGG + Intergenic
1034087399 7:148332749-148332771 CAGCCTGAGAGGCAGATAAATGG - Intronic
1043107713 8:76135943-76135965 GAGGATGAGGGGCCTGTGAAGGG - Intergenic
1044212937 8:89572059-89572081 TAAGCTGAGGGGCTTATGAAGGG + Intergenic
1047759986 8:127947406-127947428 CAGGATGAGGGGACTTTCAACGG - Intergenic
1048293343 8:133196923-133196945 CAGGCTGAGGGGCAGACTAATGG + Intronic
1048497334 8:134946243-134946265 GAGGATGAGGGACCCATAAAGGG + Intergenic
1049479599 8:142815566-142815588 CAGGCTGATGGGGCTCTTAAAGG + Intergenic
1053351180 9:37414366-37414388 CAGACTGAGGGGCTGAGAAAGGG + Intergenic
1053510513 9:38683970-38683992 CAGGCTGAGAGGAGTAGAAATGG - Intergenic
1056218421 9:84427551-84427573 AAGGCTGAGGGGTCGATGAAGGG + Intergenic
1056797998 9:89672102-89672124 CAGACTGAGTGGCTTATACAGGG - Intergenic
1060445203 9:123681061-123681083 CAGAGTGAGGGGCCTAGTAAGGG + Intronic
1061580953 9:131535743-131535765 GAAGCTGAGTTGCCTATAAAGGG + Intergenic
1188834360 X:34938342-34938364 AAGTCTTTGGGGCCTATAAAAGG + Intergenic
1189041784 X:37549426-37549448 AAGTCTTTGGGGCCTATAAAAGG - Intronic
1189481349 X:41394477-41394499 CAGGGGGAGGGACCTACAAAGGG + Intergenic
1190113601 X:47611110-47611132 CAGGCTGAGGAGCCCATGTAGGG - Intronic
1195673000 X:107484701-107484723 AAGGCTGAGGTGCCTATCCATGG + Intergenic
1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG + Intronic