ID: 1195993091

View in Genome Browser
Species Human (GRCh38)
Location X:110702663-110702685
Sequence TGTCAAATGATGGAACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195993087_1195993091 8 Left 1195993087 X:110702632-110702654 CCTGATACATAGTAGTCGCTCAA 0: 1
1: 1
2: 37
3: 268
4: 1778
Right 1195993091 X:110702663-110702685 TGTCAAATGATGGAACTGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 208
1195993086_1195993091 26 Left 1195993086 X:110702614-110702636 CCATCATCTATAACAGTGCCTGA 0: 1
1: 1
2: 3
3: 88
4: 495
Right 1195993091 X:110702663-110702685 TGTCAAATGATGGAACTGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195993091 Original CRISPR TGTCAAATGATGGAACTGGG AGG Intronic
904269358 1:29339368-29339390 TGTCAATAGATGGCACTGGCAGG - Intergenic
906498141 1:46320130-46320152 TGTCAAAGGAGGGACCTGGTGGG + Intergenic
906635697 1:47408961-47408983 TATCACATGAGGTAACTGGGAGG - Intergenic
910706458 1:90134722-90134744 TTTCAAGTGCTGGGACTGGGGGG + Intergenic
913157377 1:116113158-116113180 TGTCAAATGTTAGAACTTGAAGG + Intronic
913270015 1:117084063-117084085 TTTCCAATGATGGATCAGGGAGG - Exonic
916262572 1:162857046-162857068 TGTCAAATCTGGTAACTGGGTGG - Intronic
916287543 1:163126911-163126933 TGTCAGATGCTGGAAGAGGGTGG + Intronic
918140610 1:181716542-181716564 TTTCACATGATGGAAGTAGGTGG - Intronic
919393933 1:197021802-197021824 TGTCAAAGGAGGGACCTGGTGGG + Intergenic
921045078 1:211470417-211470439 TGCCAAGTGGTAGAACTGGGAGG - Intergenic
923855306 1:237839221-237839243 TGGCAGATGATGAAGCTGGGAGG - Intergenic
924563697 1:245178570-245178592 TTTGAGATGATGGAAGTGGGTGG - Intronic
1064028072 10:11865169-11865191 AATCAAAGGATGGATCTGGGAGG - Intronic
1064513806 10:16124440-16124462 TGTGAAATGATGGTAATGGCTGG - Intergenic
1065678875 10:28208651-28208673 TGTCAGATGAGGGCACTGGATGG - Intronic
1068610408 10:59053813-59053835 TGTCATATGAGGGACCTGGTGGG - Intergenic
1071990453 10:91096509-91096531 TGTCAACGGAGGGAACTGGTGGG - Intergenic
1075292587 10:121243022-121243044 TTTCAGGAGATGGAACTGGGAGG + Intergenic
1076169216 10:128305968-128305990 TGTGTAATGATGGATATGGGTGG + Intergenic
1076375187 10:129979003-129979025 TGTCAAGTGCTGGGAGTGGGAGG - Intergenic
1077556785 11:3229865-3229887 TGTCTGATGATGGGGCTGGGAGG + Intronic
1078342212 11:10505877-10505899 TGTCAAATGCTGGACCTAGTTGG - Exonic
1078448581 11:11423823-11423845 TGTCACCTGATGTAACAGGGAGG - Intronic
1078586633 11:12596866-12596888 TGTCAAAGGAGGGACCTGGTGGG + Intergenic
1080943545 11:36946266-36946288 TGGTAAATAGTGGAACTGGGTGG + Intergenic
1083603432 11:63962547-63962569 TGTCCAAATATGGAACTGCGAGG - Intergenic
1085448631 11:76617433-76617455 GGTGAAATGAGGGCACTGGGGGG + Intergenic
1086172046 11:83847687-83847709 TGTGAAATGCTAGAACTGGAAGG - Intronic
1087517922 11:99189128-99189150 TGTAACATGGTTGAACTGGGAGG - Intronic
1090113117 11:123937829-123937851 TGTAAAATGAGGGACCTGGTGGG - Intergenic
1091254956 11:134175238-134175260 TTTCAGATGATGCACCTGGGAGG - Intronic
1092147855 12:6227149-6227171 GGTAAGAGGATGGAACTGGGAGG + Intronic
1095427851 12:42096588-42096610 TGTCAAATGATGTATGTGGAAGG + Intronic
1096426068 12:51504236-51504258 TTTCACAGGATGGAACTGGGAGG - Intronic
1100244549 12:92743897-92743919 TGAGAAATGTTGGAACTAGGAGG - Intronic
1102860689 12:116333723-116333745 TGCCAGATGATGGGATTGGGAGG + Intergenic
1102996373 12:117354290-117354312 TATAAAATAATGGGACTGGGTGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1108332369 13:49401729-49401751 TGTCAACTGATTAAACTGGCTGG + Intronic
1111000775 13:82177656-82177678 TTTCAAAAGATGGAAATGGAGGG + Intergenic
1111560571 13:89939636-89939658 TGTCTAATGAGGGATCTGGTGGG + Intergenic
1111909366 13:94293282-94293304 TGTCAAGGGAGGGAACTGGTAGG + Intronic
1112770182 13:102786817-102786839 TGTAAAATGAATAAACTGGGGGG - Intronic
1112967364 13:105213003-105213025 TGTCAAGGGAGGGAACTGGTGGG + Intergenic
1114917657 14:27288236-27288258 TGTCATATGAGGGACCTGGTGGG - Intergenic
1115065825 14:29258271-29258293 TGTCAAGGGAAGGAACTGGTGGG - Intergenic
1116210412 14:41933510-41933532 TTTCAAATGATGGAACAAGATGG + Intergenic
1116511020 14:45746836-45746858 TGTCAAAAGAGGGACCTGGTAGG - Intergenic
1117654184 14:57937717-57937739 TGGTAAATGAAGGAACTTGGAGG + Intronic
1117766556 14:59089327-59089349 TGTGAAACAATGGAAATGGGAGG + Intergenic
1118329040 14:64801562-64801584 TGGCATATGAGGGAAGTGGGCGG + Intronic
1119539089 14:75427486-75427508 TGTCCAAGGATGAAACTGTGCGG + Intergenic
1119948717 14:78722300-78722322 TGTCAAATGCAGGGACTCGGTGG + Intronic
1120966754 14:90174419-90174441 TGTCAAAGGAGGGACCTGGTGGG - Intronic
1121046634 14:90792992-90793014 TGTCAAAGGAGGGACCTGGTAGG + Intronic
1121663657 14:95654958-95654980 TGTCAAGGGATGGACCTGGTAGG + Intergenic
1121914262 14:97821432-97821454 TGTCAAAGGAGGGACCTGGTGGG + Intergenic
1122766343 14:104073699-104073721 TGGGAGATGATGGAACTGGGTGG + Intergenic
1123408400 15:20038492-20038514 TGTCAAGGGATGGACCTGGTGGG + Intergenic
1123453943 15:20399559-20399581 TGTCAGAGGATGGGGCTGGGAGG - Intergenic
1123517724 15:21045133-21045155 TGTCAAGGGATGGACCTGGTGGG + Intergenic
1126365336 15:47888235-47888257 TGTCAAAGGAGGGACCTGGTGGG - Intergenic
1126404211 15:48305924-48305946 AATCAAATCATGGAAATGGGAGG - Intergenic
1126495883 15:49290183-49290205 TTTCAGATGAAGGAAATGGGTGG - Intronic
1127137431 15:55939206-55939228 TGTCAAGGGAGGGAACTGGTGGG + Intronic
1127743988 15:61944973-61944995 TGTCAAGGGAGGGAACTGGTAGG + Intronic
1130182999 15:81651024-81651046 TGTGAAATGATGGCAGTGGTGGG + Intergenic
1131077900 15:89509695-89509717 TTGCCACTGATGGAACTGGGAGG + Intergenic
1131726036 15:95226274-95226296 TGTCAAATAATTGAGATGGGTGG + Intergenic
1132489895 16:222013-222035 TGTCAAATGGAGGAACTGAGTGG - Intronic
1133895632 16:9925998-9926020 TGGCAAATGATGGAGCCGGATGG - Intronic
1137453230 16:48596953-48596975 AGTCAGATTATGGGACTGGGTGG - Intronic
1137643617 16:50055540-50055562 TCTTTAATGAAGGAACTGGGAGG + Intergenic
1139101109 16:63768048-63768070 TTTCAAATGAAGGAACTGCATGG - Intergenic
1139696890 16:68681490-68681512 TGTCTAAAGATGGAAGGGGGAGG - Intronic
1140247739 16:73266663-73266685 TGTCATAGGAGGGAACTGGTGGG + Intergenic
1141162831 16:81640385-81640407 TGTGAAATGATGGGGCTGGACGG + Intronic
1142359873 16:89620983-89621005 TCTCAGAGGATGGAACCGGGTGG + Intronic
1143424690 17:6825628-6825650 TGTGGAATGATAGAACTGGAAGG - Intronic
1143914729 17:10281562-10281584 TGTCAAAGGAGGGACCTGGTGGG - Intergenic
1143961587 17:10725639-10725661 TGACAGATGGTGGAACTGAGAGG + Intronic
1146360665 17:32174082-32174104 TGTCAGATGGAGGCACTGGGTGG - Intronic
1148058260 17:44815116-44815138 TGTCAAGTGGTGGAGATGGGTGG + Intronic
1148260531 17:46179156-46179178 TGTCAAATATGGGAGCTGGGGGG + Intronic
1148683950 17:49490372-49490394 TGTCCAATGAGGGAACAGGGTGG - Intergenic
1148934556 17:51154467-51154489 TGTAAAATGAGGGATCTGGACGG + Intronic
1152929964 17:83104403-83104425 TGTCAAATGCTGGTGCTGGCAGG - Intergenic
1153244079 18:3056540-3056562 TGTCAAAAGATGAAGCTGGCCGG - Intergenic
1163195629 19:15717642-15717664 TGTCAAAACATGGACCTGGGAGG + Intergenic
1164398615 19:27887724-27887746 TGTCAAAGGAGGGACCTGGTGGG - Intergenic
1164493111 19:28732300-28732322 TGTCAAGAGAGGGAACTGGTGGG - Intergenic
926481338 2:13399671-13399693 TGTCAGAGGATGGGGCTGGGAGG + Intergenic
926631080 2:15136731-15136753 TGTCAAAGGAGGGACCTGGTGGG + Intergenic
926803169 2:16680297-16680319 TTTCAAATGATGTATTTGGGAGG + Intergenic
927462981 2:23315258-23315280 TGTCCCATCATGGAAGTGGGAGG - Intergenic
927637745 2:24828345-24828367 TGTCAAATGAGGCAACGGCGAGG - Intronic
929571242 2:43024434-43024456 TGTCCACTGATAGAACAGGGTGG + Intergenic
930535057 2:52635740-52635762 TGTCAAAGGAGGGAATTGGTAGG + Intergenic
932055082 2:68435104-68435126 GGTCAAATGATGGAACCAGTAGG - Intergenic
933366030 2:81355246-81355268 TTTTAAATGCTGGACCTGGGAGG - Intergenic
933747568 2:85582200-85582222 TGACAATGAATGGAACTGGGAGG - Intergenic
935920899 2:108013028-108013050 TGTCATATAATGCAACAGGGAGG + Exonic
937491525 2:122372960-122372982 TGTCAAGGGAAGGAACTGGTGGG - Intergenic
939159351 2:138567965-138567987 TGCCAGATCATGGAAGTGGGAGG + Intronic
939197619 2:138991908-138991930 TGTCAAGGGATGGACCTGGAGGG - Intergenic
940143872 2:150524424-150524446 TGTCACATGAGGGAACTGGTGGG + Intronic
940929489 2:159410369-159410391 TGTCAAAGGAGGGACCTGGTGGG + Intronic
943507549 2:188780484-188780506 TGTCAAATAATGCATCTGTGTGG + Intronic
946577005 2:221086665-221086687 TGTCAAAGGAGGGACCTGGTAGG - Intergenic
947481082 2:230500630-230500652 TGTCTTTTGATGGAACTGTGGGG + Intronic
947797417 2:232903471-232903493 TGTCTGACGAGGGAACTGGGTGG + Intronic
947799460 2:232919391-232919413 ACACAAATGATGGAACTGGGTGG + Intronic
948669998 2:239562119-239562141 GGTTAAATGAGGTAACTGGGTGG - Intergenic
1173176995 20:40771952-40771974 TGGCCAGAGATGGAACTGGGAGG + Intergenic
1173240004 20:41286788-41286810 TGTCAAAGGAGGGACCTGGTGGG + Intronic
1175685727 20:61027028-61027050 TGTTTAATGATGGAAGTGGTTGG - Intergenic
1177660360 21:24074679-24074701 TGTCATATGAGGGAACCGGTGGG + Intergenic
1180705545 22:17807804-17807826 TGTGAAATGGACGAACTGGGAGG - Intronic
1183002104 22:34869217-34869239 TCTCAGAGGCTGGAACTGGGTGG + Intergenic
1185202445 22:49516549-49516571 TGTAAAATGAAGGAACTGGATGG - Intronic
949544145 3:5058037-5058059 TGTCAAAAGTATGAACTGGGCGG + Intergenic
950766950 3:15280090-15280112 TGTGAAAGGATGGAAGTGTGGGG - Intronic
953201608 3:40782858-40782880 TTTAAAATGATGAAACTGGCAGG - Intergenic
956359747 3:68435098-68435120 TGTTAAATGATGGAAGCAGGAGG + Intronic
956601022 3:71022726-71022748 TTTCAAATGAGGGAATTGGAGGG - Intronic
957767779 3:84648411-84648433 TGTCAAATGAGGGACCTGGTGGG - Intergenic
958088437 3:88843839-88843861 TGTCAAAGGAGGGACCTGGTGGG - Intergenic
961194558 3:124990691-124990713 TGTGAACTGAGGGAAGTGGGAGG + Intronic
962250975 3:133836005-133836027 TGTGAATTGCAGGAACTGGGTGG + Intronic
962287914 3:134103842-134103864 TTTGAAAAGATGGAGCTGGGAGG - Intronic
962777477 3:138676373-138676395 TGTAAAATGATGCAGCTGTGTGG + Intronic
962830586 3:139135790-139135812 GGTCAAATGATGCAACTGGCAGG - Intronic
969630998 4:8336544-8336566 TGACACATCAAGGAACTGGGAGG - Intergenic
971358423 4:25914838-25914860 TTACAAATGAGGGAACTGAGAGG + Intronic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972698724 4:41473103-41473125 TGTCATTTTATGGCACTGGGAGG - Intronic
973136658 4:46716495-46716517 TGTCAAGGGAGGGAACTGGTAGG - Intergenic
974267301 4:59602159-59602181 TGTCAAAGGAGGGACCTGGTGGG + Intergenic
974359424 4:60857277-60857299 TGTGAAATAATGGAACTGTCAGG - Intergenic
974583628 4:63839470-63839492 AGCAAAATGATGGAACTGGAGGG - Intergenic
974758678 4:66247270-66247292 TGTCATAGGAGGGACCTGGGGGG + Intergenic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
977537981 4:98278718-98278740 TTCCAAATGAAGGAAATGGGGGG + Intronic
979135135 4:117102078-117102100 TGTCAAGTGATGGTACAGGGAGG - Intergenic
980776064 4:137437838-137437860 TGTCAAAGGAGGGACCTGGTGGG + Intergenic
980876775 4:138669683-138669705 TCTCAAGTGATTGAACTTGGAGG - Intergenic
983498930 4:168477893-168477915 TGTCTTAAGAAGGAACTGGGTGG + Intronic
984360930 4:178730847-178730869 TGATAAATGATGGAAGTGGATGG + Intergenic
984389979 4:179117069-179117091 TGCCAAAGGGTGTAACTGGGAGG + Intergenic
984469233 4:180144815-180144837 TGTCAAAATGTGGAACTGGTGGG - Intergenic
984568080 4:181355327-181355349 TGAGAAATGATGAAAATGGGTGG - Intergenic
985194145 4:187409340-187409362 AGTCAAATCATGGAATTGAGAGG + Intergenic
986948701 5:13055955-13055977 TGTCAAAGGAGGGACCTGGTAGG + Intergenic
988836240 5:35035446-35035468 GGTTAAATGATGGAACTGCTGGG - Intronic
989248730 5:39282781-39282803 TGTCAAAGGAAGGACCTGGTGGG - Intergenic
989991449 5:50772363-50772385 TGTCCAATCATGGAACTGCTGGG + Intronic
992101755 5:73414863-73414885 TGTCAAATTTTAGAACTGGGAGG + Intergenic
992128156 5:73664210-73664232 TGTCAAATCATGGAACCAGTGGG + Intronic
995286186 5:110390934-110390956 TGTATTATAATGGAACTGGGAGG - Intronic
995307131 5:110665643-110665665 TGTCAAATGAGGGACCTGGTGGG - Intronic
995942068 5:117598909-117598931 TGTCAAATAATAGGAGTGGGCGG + Intergenic
995988182 5:118206283-118206305 TGTGAAAAGATGGAAGTGGGAGG - Intergenic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
998747977 5:145283298-145283320 TGTAAAATTACGCAACTGGGGGG + Intergenic
1001612188 5:173011854-173011876 TCTGAATTGATGGAAGTGGGTGG - Intronic
1006675595 6:35760480-35760502 TGTCAAAAGAGGGACCTGGTAGG - Intergenic
1007234024 6:40377819-40377841 AGTCATAGGATGGCACTGGGGGG + Intergenic
1009402126 6:63269502-63269524 TATCCAATGATGGACCTAGGAGG - Intergenic
1009824801 6:68854661-68854683 TGTAAAATGCTGGCACAGGGAGG - Intronic
1009988923 6:70817016-70817038 TGGGAAGAGATGGAACTGGGGGG - Intronic
1011794244 6:90935424-90935446 TGTCAATTGCTGGAACTTTGGGG - Intergenic
1012240492 6:96865674-96865696 GGTTAAATGAAGGATCTGGGAGG - Intergenic
1012480797 6:99664732-99664754 TGTGAAGTTATGGGACTGGGAGG + Intergenic
1013516087 6:110887492-110887514 TGTTAAATGATAGATCTGAGTGG + Exonic
1013790228 6:113828056-113828078 TGTCAAGGGATGGAACAGGTGGG - Intergenic
1014737046 6:125105728-125105750 AGTAAAAGGATGGAACTAGGAGG + Intergenic
1015297632 6:131616175-131616197 TGTCAAATGAGGCAAATGAGGGG - Intronic
1016291792 6:142535448-142535470 TGTCAAGAGAGGGAACTGGTGGG + Intergenic
1017841469 6:158226061-158226083 AGTCAAAAGATAGAAGTGGGTGG + Intergenic
1019183083 6:170204719-170204741 TGTCAGATGATGTAAGTGGCCGG + Intergenic
1021338967 7:19439634-19439656 TGTCAAAGGAGGGAACTGGTGGG + Intergenic
1022017833 7:26367381-26367403 TGTCAAATCATGGAATTGGCAGG + Intronic
1022176568 7:27876788-27876810 CCTCAGAGGATGGAACTGGGCGG + Intronic
1023709490 7:42976590-42976612 TGTCAAAGGATGGGCCTGGTGGG - Intergenic
1024059139 7:45685408-45685430 AGTGAAAGGATGGAAGTGGGTGG + Intronic
1024164535 7:46717114-46717136 TGTCATGTGATGGAACAGGAAGG - Intronic
1024642133 7:51338716-51338738 TGTAAAATGATGCTACTTGGAGG + Intergenic
1024902175 7:54332464-54332486 TGTCAAATGAATGAGCTGGATGG - Intergenic
1025865746 7:65379098-65379120 TATCAAATTATTGAACTGGAGGG + Intronic
1027618596 7:80454859-80454881 TGTCAAAATATGGAAGTGGCCGG - Intronic
1028678737 7:93500001-93500023 TATTAAATGATGAAACTGGAAGG + Intronic
1029176152 7:98665979-98666001 GGGAAAATGAAGGAACTGGGGGG - Intergenic
1029745515 7:102513873-102513895 TCTCAAATGATGGCAGGGGGAGG - Intronic
1029763454 7:102612852-102612874 TCTCAAATGATGGCAGGGGGAGG - Intronic
1031800803 7:126242394-126242416 TGTCAAGTGAGGGACCTGGTGGG + Intergenic
1032265869 7:130369440-130369462 TGGGAAATGATGGGACTGGCAGG + Intergenic
1033562726 7:142547886-142547908 TGTCAAGGGAGGGAACTGGTGGG + Intergenic
1034090784 7:148362295-148362317 TGTCAAGGGAGGGACCTGGGGGG - Intronic
1034529852 7:151688928-151688950 TCTCAGAAGATGGAACAGGGAGG - Intronic
1036709321 8:11068204-11068226 TCTGAGATGATGGAGCTGGGAGG - Intronic
1039037869 8:33378956-33378978 TGTCAAGGGAGGGAACTGGTGGG + Intronic
1039582734 8:38680289-38680311 GGACAAATGATGCAACTGGAAGG + Intergenic
1043375758 8:79647573-79647595 TGTCAACAGATGGAATGGGGAGG - Intronic
1043769830 8:84184314-84184336 TTTCAAATGATGGCAGTGGAAGG + Intronic
1044480053 8:92675275-92675297 TGTCACATGATGGAAATCTGTGG + Intergenic
1046625436 8:116572122-116572144 AGCCAAATGATTGAACTGGCAGG - Intergenic
1047068219 8:121311345-121311367 TATCAGAGGGTGGAACTGGGAGG - Intergenic
1047870538 8:129077322-129077344 TTTCAAGTGGTGGAGCTGGGAGG + Intergenic
1048589115 8:135804663-135804685 TGTCAAGGGAAGGACCTGGGGGG + Intergenic
1049625087 8:143616278-143616300 TGCCAAGTGCAGGAACTGGGTGG + Intronic
1051030586 9:12670628-12670650 TGACAAATGATGAAACTTTGAGG - Intergenic
1051365730 9:16320174-16320196 TGTGTAATGATGGATCTGAGGGG - Intergenic
1052018107 9:23492948-23492970 TGTCTCAGGATGGAACTGGATGG + Intergenic
1053096476 9:35332488-35332510 TGGCAAATGATCTAAGTGGGAGG - Intronic
1054139998 9:61520116-61520138 TGTCAAATGATGGTTCTGTAAGG + Intergenic
1186826149 X:13341877-13341899 TGTAAAATGATGTCCCTGGGGGG - Intergenic
1187127360 X:16466557-16466579 TGTGATATGATGGAATTTGGAGG - Intergenic
1187643275 X:21318526-21318548 TGTCATATGAGGGACCTGGTGGG - Intergenic
1187960913 X:24565244-24565266 TATCAAAGGATTGAACTGAGTGG - Intronic
1188662222 X:32774697-32774719 TGTCAAGGGAGGGAACTGGTGGG - Intronic
1195404399 X:104497047-104497069 TGTCGAAGGAGGGAACTGGTGGG - Intergenic
1195993091 X:110702663-110702685 TGTCAAATGATGGAACTGGGAGG + Intronic
1196318229 X:114255101-114255123 TGTCAAAGGAGGGATCTGGTGGG + Intergenic
1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG + Intergenic