ID: 1195993155

View in Genome Browser
Species Human (GRCh38)
Location X:110703215-110703237
Sequence CAGGGGATTCTGATGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 2, 2: 7, 3: 20, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195993148_1195993155 -2 Left 1195993148 X:110703194-110703216 CCTGGGTTTTGACAAGCCTTCCA 0: 1
1: 1
2: 4
3: 53
4: 239
Right 1195993155 X:110703215-110703237 CAGGGGATTCTGATGGATGCAGG 0: 1
1: 2
2: 7
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195993155 Original CRISPR CAGGGGATTCTGATGGATGC AGG Intronic
900768779 1:4524036-4524058 CAGGCGATTCCGATGCATGCTGG - Intergenic
901174432 1:7288572-7288594 CAGGGCAGTGTGCTGGATGCAGG + Intronic
901799404 1:11698921-11698943 CAGGAGATTTTGTTGAATGCAGG - Intronic
902244681 1:15112786-15112808 CAGGTGATTCTCATGCAGGCAGG - Intronic
902259294 1:15212549-15212571 CAGGGGGTTGTGCTGGAAGCAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
904344604 1:29859711-29859733 CAGGAGATGCTGAGGGATGGAGG + Intergenic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
905231259 1:36516127-36516149 CAGGGGGTTCTAAGGCATGCAGG - Intergenic
907078266 1:51597374-51597396 CATAGGACTCTGATTGATGCAGG - Intronic
907391539 1:54161427-54161449 CAGGGGAGTCGGATGGAAGAGGG + Intronic
907445684 1:54506397-54506419 CAGAGGATTCAGATGGACCCTGG - Intergenic
907451000 1:54545809-54545831 CAGGTGATTCTGGTGCAGGCTGG + Intronic
907458547 1:54591700-54591722 CTGGGGATTCATATGGATGTGGG + Intronic
908735692 1:67273988-67274010 CAAGGGATTCTAATGCATTCAGG - Intergenic
912031034 1:105244119-105244141 AAGGGGATTCTGATTTATGGGGG - Intergenic
912868715 1:113283513-113283535 GTGGGGATTCTGACTGATGCTGG - Intergenic
914892591 1:151639914-151639936 CAGTGGGTTCTGTTAGATGCTGG + Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915672117 1:157498580-157498602 CAGGTGATTCTGATGCATCCTGG - Intergenic
916058549 1:161083993-161084015 CAGGGGATACTGATGGAGAAAGG - Intronic
918180943 1:182085725-182085747 CAGGTGATTCTGATGGAGGCAGG + Intergenic
919248465 1:195019947-195019969 AAGGGGGTTCTGATGGTGGCAGG + Intergenic
920481417 1:206325923-206325945 CAGGTGATTCTGATGCAAGGTGG + Intronic
922417364 1:225433617-225433639 CAGAGGATTCTGATAGAAGCAGG + Intergenic
922720142 1:227896148-227896170 CAGGGGAGGCAGCTGGATGCTGG - Intergenic
1062929149 10:1340987-1341009 CAGGGTTCTCTGGTGGATGCTGG - Intronic
1063043054 10:2362568-2362590 CACGGGAGCCTGATGGAGGCTGG - Intergenic
1063550831 10:7031151-7031173 CCAGAGAATCTGATGGATGCAGG + Intergenic
1067176749 10:43955416-43955438 CAGGTGATTCTGATGCCTGCTGG - Intergenic
1067556893 10:47278943-47278965 CAGTGGTTTCTGCTGGCTGCTGG - Intergenic
1067869460 10:49943873-49943895 CATGAGATTGTGATGGAAGCAGG + Intronic
1069669072 10:70186400-70186422 CAGGTAATTCTGATGTTTGCTGG + Intergenic
1069678723 10:70268348-70268370 CAGGAAATTTTGCTGGATGCTGG - Intronic
1072484259 10:95839691-95839713 TATGGGATTGTGCTGGATGCGGG + Exonic
1073159927 10:101383751-101383773 TAGGGGATTTTGATGAATGTTGG + Intronic
1074711870 10:116184395-116184417 AATGGGACACTGATGGATGCTGG - Intronic
1075452618 10:122562496-122562518 CAGATGCTTCTGATGGAGGCAGG - Intronic
1075499277 10:122957525-122957547 CAGGTGATAATCATGGATGCGGG - Intronic
1076226328 10:128779148-128779170 CAGGGGTTTCCCATGCATGCTGG - Intergenic
1078658536 11:13264928-13264950 CAAGCGATTCTGGTGCATGCAGG - Intergenic
1080426335 11:32158205-32158227 AAGGAGACCCTGATGGATGCTGG + Intergenic
1082027562 11:47584060-47584082 CAGGGGAATCTGACTGGTGCTGG + Intronic
1082060181 11:47853381-47853403 CCCGGAATTCTGATGGATGTTGG - Intergenic
1084016888 11:66388961-66388983 CAGGGGAAGCTGCTGGCTGCTGG + Intergenic
1084555224 11:69872093-69872115 CAGGTGAGTGTGATGGATCCAGG - Intergenic
1084890820 11:72236029-72236051 CAGGGGATAGTGATGGATAGAGG - Intronic
1088041731 11:105393268-105393290 CTGGGGTTTCTGATTGAGGCAGG - Intergenic
1090304206 11:125676387-125676409 CTGGGAATTCTGAGTGATGCAGG + Exonic
1091045154 11:132318739-132318761 CAGGGGATTGGGATGGAAGGTGG - Intronic
1091194533 11:133719971-133719993 CAGGGGATGCTCCTGGCTGCAGG - Intergenic
1091699391 12:2650235-2650257 CAGGAGATTATGAGGGAAGCAGG - Intronic
1092061954 12:5558179-5558201 TAGGACATTCTGATAGATGCAGG - Intronic
1093417541 12:18937063-18937085 CAGGGGCTTCCAATGGAAGCAGG + Intergenic
1097290994 12:57914787-57914809 CAGGGAAAGCTGTTGGATGCAGG + Intergenic
1097300574 12:58014470-58014492 CATGGGATGATGCTGGATGCTGG - Intergenic
1101508414 12:105370222-105370244 CACGGGATTCTGATGCAGCCAGG - Intronic
1101995333 12:109521481-109521503 CAGGTAATTCTCATGGATGTAGG - Exonic
1102947251 12:117000449-117000471 CTGTAGATTCTGATGCATGCTGG - Intronic
1103236321 12:119375771-119375793 CATGTGTTTCTGATGCATGCAGG + Intronic
1104165080 12:126219937-126219959 CAGTGGATACTGATGGAGACAGG + Intergenic
1104617793 12:130284920-130284942 CAGGGGAGACTTCTGGATGCTGG + Intergenic
1105428932 13:20319495-20319517 CACGTGATTATTATGGATGCTGG - Intergenic
1105513067 13:21067269-21067291 CAGGAAATTCTGAGGGATTCAGG - Intergenic
1106114827 13:26808355-26808377 CAGGTGATTCTAATGCATGCTGG - Intergenic
1106114842 13:26808485-26808507 CAAGGGATGCTGATGCATCCAGG + Intergenic
1109280031 13:60345205-60345227 CAAGTGCTTCTGATGCATGCTGG + Intergenic
1110647938 13:77910613-77910635 AAGGGCATTCTGATGGATGCAGG - Intronic
1112407889 13:99136913-99136935 CAGGGGATTTTGAAGGATCATGG + Intergenic
1112440719 13:99422892-99422914 CAGGGGATTGTGTTGAATCCAGG - Intergenic
1113424537 13:110197274-110197296 AAGGGAATTCTCATGAATGCAGG - Intronic
1113942289 13:114024616-114024638 CAGTGGCTCCTGATGGGTGCCGG + Intronic
1114225572 14:20735069-20735091 CAGGGGCTATTGATGGAGGCAGG - Intronic
1114227027 14:20748084-20748106 CAGGGGCTATTGATGGAGGCAGG - Exonic
1117644692 14:57839324-57839346 CAGGTGATTCTGATGCAGGCCGG - Intronic
1117661504 14:58010296-58010318 CAGGTGATCCTGATACATGCTGG - Intronic
1118620628 14:67611131-67611153 CAGGGGCATCTTATGGATGACGG - Intergenic
1119194924 14:72710537-72710559 CAGGGGATTCTTGTGTATACTGG - Intronic
1120738778 14:88084312-88084334 CAGGTGGTTCTGAAGGCTGCAGG + Intergenic
1120967959 14:90184293-90184315 CAGGAGAGCCTGAAGGATGCGGG + Exonic
1121382489 14:93485422-93485444 CAGGTGATTCTGATGCAAGCTGG - Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121857405 14:97282748-97282770 CAGGGCATTGTGCTGGATACTGG + Intergenic
1124814404 15:32974549-32974571 CAGGTGATTCTAATGGGAGCAGG - Intronic
1127300065 15:57644222-57644244 TAGGAGCTTCTGAGGGATGCTGG - Intronic
1127556666 15:60094417-60094439 CAGGTGATTCTTATGCAAGCAGG - Intergenic
1128838540 15:70831051-70831073 CAGGTGATTCTGATGCACGCTGG - Exonic
1129366400 15:75058217-75058239 CTGGGGATGCTGATGTATGGTGG - Intronic
1130060202 15:80564173-80564195 CTGGGGAAAATGATGGATGCTGG - Intronic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1131600575 15:93844704-93844726 GAGGGGCTGCTGATGGATCCAGG - Intergenic
1131777062 15:95814377-95814399 CAAGAAATGCTGATGGATGCAGG - Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1133907821 16:10037991-10038013 CAGGGGATTATGATGTAGACTGG - Intronic
1136270986 16:29148193-29148215 CAGGGGGTTCTGATGGGTACTGG - Intergenic
1137293556 16:47068764-47068786 CAGGGCAGTTTAATGGATGCTGG + Intergenic
1137552158 16:49445049-49445071 CAGAGGACTCTGCTGGATGGAGG + Intergenic
1138528573 16:57622641-57622663 CAGGGGCTTCTGAAGGCTGGGGG + Intronic
1140930454 16:79622915-79622937 CACTGGAGTCTGATGGATGGAGG - Intergenic
1141443395 16:84043394-84043416 CAGTGGATTCTGATGCAAACTGG - Intergenic
1141987522 16:87589494-87589516 CAGGGGACTCTGATGCATGTGGG + Intergenic
1142074597 16:88110202-88110224 CAGGGGGTTCTGACGGGTACTGG - Intronic
1143138050 17:4723113-4723135 CACGGGAGTCGGAGGGATGCTGG - Intergenic
1146457755 17:33020596-33020618 CAGTGGCATCTGATGGATACAGG - Intronic
1148341931 17:46878418-46878440 CAGGGCAGTCTGCTGGATGCTGG + Intronic
1149455474 17:56784565-56784587 CTGGTGATTCTGATGCATGCTGG - Intergenic
1149484358 17:57030417-57030439 CAGAGGATTCTGCCTGATGCTGG + Intergenic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1151875436 17:76865555-76865577 CAGGTGATTCTGCTGGAATCTGG + Intergenic
1152134961 17:78498402-78498424 CAGGTGATCCTGACGCATGCTGG - Intronic
1152175045 17:78782003-78782025 CAGGGGGTTTTGAGGGATGAGGG - Intronic
1152930526 17:83107450-83107472 CAGGGGACTGTGAGGGCTGCGGG + Intergenic
1153269650 18:3307569-3307591 CAGTGGATTCAGATGAAAGCTGG - Intergenic
1153625120 18:7016034-7016056 CAGGAGATGCTGAGGGAAGCGGG + Intronic
1157079542 18:44507946-44507968 AAGGGCAGTCTGATGAATGCAGG - Intergenic
1157230738 18:45913435-45913457 CAGGGAATTCTGATGTACGTGGG + Intronic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1157468578 18:47969609-47969631 CAGGAGACACTGATGGTTGCAGG - Intergenic
1157600953 18:48892944-48892966 CATGGCCTTCTGATGGATGGAGG + Intergenic
1157789886 18:50522282-50522304 CAGGTGATTCTGATGCATGCTGG - Intergenic
1158066286 18:53413163-53413185 CAGAGGATTCTGGTGGAGGGAGG + Intronic
1158208919 18:55024298-55024320 CAGGTGATTTTGATGGATCCAGG + Intergenic
1158216806 18:55109184-55109206 CAAGGCACTCTGCTGGATGCTGG - Intergenic
1158518260 18:58148587-58148609 CTGGGGCTTCGGATGTATGCAGG - Intronic
1159706468 18:71695634-71695656 CAGGGGCATCTGAAGGATGTCGG - Intergenic
1160119843 18:76120549-76120571 CAGGGGATGCTGCTGGCAGCTGG - Intergenic
1160222954 18:76990471-76990493 CAGGGGATGGTGAGGGATGAGGG + Intronic
1160528047 18:79548703-79548725 CTGCGGATGCTGATGGCTGCCGG - Intergenic
1161644369 19:5444134-5444156 GAGGGGATCCTGATGGCTGCAGG - Intergenic
1163603938 19:18264185-18264207 CAGGGGACCCTGGTGAATGCTGG + Intronic
1163689845 19:18732548-18732570 CAGAGGATTATTTTGGATGCAGG + Intronic
1163721339 19:18899585-18899607 GAGGGGATGCAGGTGGATGCCGG + Exonic
1166656278 19:44614278-44614300 CAGGGCATTCTGGTGGAAGGGGG - Intronic
1167793936 19:51696994-51697016 CAGGGGATTCTGATGTATGCTGG - Intergenic
925057489 2:866472-866494 CAGGGGACTGTGGAGGATGCAGG - Intergenic
926067180 2:9852092-9852114 CAGGTGATTCTGATGCACTCAGG - Intronic
926172405 2:10560613-10560635 CAGGGGCTTCTGATGCACCCTGG + Intergenic
927275228 2:21256885-21256907 CAGGAGAATCTGATGGCTCCAGG + Intergenic
927332491 2:21882083-21882105 CAGGGGATTCTGCAGAATCCAGG + Intergenic
931289706 2:60861810-60861832 CAGGGGATGCAGATGCATCCAGG - Intergenic
932655970 2:73611400-73611422 CAGGGAGGTCTGATGGCTGCAGG - Intergenic
934147885 2:89113377-89113399 CAGGGCATTCAGATGTGTGCTGG - Intergenic
935731930 2:106071452-106071474 CAGGGGTTTCTGGTGGATAGGGG + Intronic
937974374 2:127573148-127573170 CATGGGACTATGCTGGATGCTGG + Intronic
938230622 2:129655633-129655655 CAGGGGAAACTGATGGACTCTGG + Intergenic
940224839 2:151390364-151390386 CAGGGGAAGCTGCTGGCTGCTGG + Intergenic
940716928 2:157236919-157236941 CATGGGGTTTTTATGGATGCAGG - Intergenic
942600235 2:177633620-177633642 AAGGGGATTTTGATCGCTGCTGG - Intronic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
944017509 2:195060272-195060294 CATGTGATTCTGATGTATACTGG + Intergenic
946752760 2:222909228-222909250 CAGCGAATTCTAATGGAGGCAGG - Intronic
1169470336 20:5879545-5879567 CAGTGGATTCTGTTGTCTGCAGG + Intergenic
1170944390 20:20877921-20877943 CAGGGGATGCTGGGAGATGCAGG - Intergenic
1171235760 20:23523305-23523327 CTGGGAATTCTGATGGAAGCTGG + Intergenic
1172696758 20:36828278-36828300 CAGGGGGTTCTGCAGAATGCCGG - Intronic
1174173961 20:48633527-48633549 CAGGGGCTTCTGAGGCATGTGGG - Intronic
1174521510 20:51134421-51134443 AAAGGGGTTCTGATGTATGCAGG + Intergenic
1175227783 20:57454905-57454927 CTGGGGATTCTGCAGGAGGCTGG + Intergenic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1178685021 21:34703765-34703787 CTGGGGATTCTGCTGGGTCCTGG - Intronic
1179446314 21:41433291-41433313 CAGGTGATTCTGCTGTGTGCTGG + Intronic
1182869567 22:33634235-33634257 CAGGTGATTCTGATGCATACTGG - Intronic
1182876922 22:33700265-33700287 TAGGTCATTCTGATGCATGCTGG + Intronic
1184042657 22:41953178-41953200 GAGGGGCTCCGGATGGATGCAGG + Intergenic
1184099630 22:42335285-42335307 CAGGGGGTGCTGATAGAGGCAGG - Intronic
949820406 3:8110035-8110057 CAGGTGATTCTGATGGTAGTGGG + Intergenic
950699033 3:14727390-14727412 CAGGGGCTCCAGATGGATGATGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951527263 3:23665372-23665394 AAGGGGATTCTGATGCAGGTAGG + Intergenic
952157865 3:30663013-30663035 CAGGGGATGCTGATGACTGCTGG + Intronic
953908264 3:46879199-46879221 GAGAGGAATCTGATGGGTGCTGG - Intronic
954144223 3:48626410-48626432 CAGGGCATTCTGTTGGCTCCCGG - Intronic
955581962 3:60433087-60433109 CAGGGGATAGTGATGGGGGCAGG - Intronic
956251340 3:67237449-67237471 CATGTGATTCTGATGGAAGATGG - Intergenic
959013466 3:101106605-101106627 CAGGTGATTCTTATGGGTGATGG - Intergenic
961232868 3:125334903-125334925 CAGTAGATTCTGCTGTATGCTGG - Intronic
964421516 3:156509043-156509065 CAGGCGATTCTGATTCATGGTGG + Intronic
964952153 3:162308582-162308604 CAGGGCATTCTCATGGAATCAGG - Intergenic
967236008 3:187384271-187384293 CAAGGGATCCTGTGGGATGCTGG - Intergenic
967867626 3:194203599-194203621 CAGGAGAGTTTGATGGGTGCTGG + Intergenic
968436503 4:593178-593200 CAGGGGATGCTGTTGCATGGGGG + Intergenic
968781876 4:2588511-2588533 CAGGTGATGGTGATGGATGAGGG + Intronic
969176501 4:5402887-5402909 CATTGGATTCTGAAGCATGCCGG + Intronic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
970652502 4:18194024-18194046 AAGTCCATTCTGATGGATGCAGG + Intergenic
970827094 4:20289094-20289116 CAGGGGGTGCTGATGCATGTGGG + Intronic
972443168 4:39116927-39116949 CAGGGGAATCTCTTGAATGCGGG - Intronic
980035021 4:127873196-127873218 CACGGGATTGTGAGGGATGATGG - Intergenic
980182727 4:129421912-129421934 CAGCGAAATCTGATGGATGAAGG + Intergenic
982294230 4:153810091-153810113 CAGGGAAGTCGGGTGGATGCAGG - Intergenic
984950901 4:185006983-185007005 CAGGTGATTCTGATGCACACTGG - Intergenic
985386303 4:189451678-189451700 AAGAGGACTCTGATGGATGTAGG + Intergenic
985391961 4:189499355-189499377 CAGGGAATGCTGCTGGATTCAGG + Intergenic
985609008 5:876186-876208 CAGGAGTTTGTGAAGGATGCTGG - Exonic
987289200 5:16491993-16492015 CAGGAGATACTCATGGATCCAGG - Intronic
987787210 5:22516650-22516672 CAGGGCATGGTGATGCATGCCGG + Intronic
990012259 5:51013656-51013678 CAGGTGATTCTGATGCACACTGG - Intergenic
990092871 5:52076276-52076298 TAGGTCATTCTGAAGGATGCTGG - Intronic
990743177 5:58933197-58933219 CAGGAGATTCTGCAGGAGGCCGG + Intergenic
997851063 5:137333021-137333043 CAGGTGATACTGATGGAAGTGGG - Intronic
999179538 5:149659428-149659450 CAGGTGATTCTGATGGAAGCAGG - Intergenic
1000072466 5:157753596-157753618 CAGGTGATTCTGATGCAGGATGG - Intronic
1000787841 5:165568665-165568687 CAGAGGATTTTGATGCATGAGGG - Intergenic
1001343597 5:170869557-170869579 CAGCTGCTTCTGATGGCTGCTGG + Intronic
1003935767 6:10973663-10973685 CAGGTGATTTTGTTGGATGTTGG - Intronic
1004791276 6:19029255-19029277 CAGGGGAATCTCATGAATCCGGG - Intergenic
1005106617 6:22230507-22230529 CAGGTGATTTTGATGCATGCTGG + Intergenic
1007303466 6:40886439-40886461 CAGGGGATTCTGGTAGGTGAGGG + Intergenic
1008371034 6:50730810-50730832 CAGGTGATTCTGATGTATAGTGG + Intronic
1010376128 6:75172965-75172987 CAGGGGATTTTGGTATATGCAGG + Intronic
1010590324 6:77704655-77704677 CAGGTGATTCTCATGAATACTGG + Intronic
1011802258 6:91030709-91030731 CAGGGGTAGCTGATGGATTCGGG + Intergenic
1012368946 6:98479420-98479442 CAGAGGATTCTAATTAATGCAGG + Intergenic
1013303181 6:108823122-108823144 CAGAGGATTCTGGGGGAAGCAGG - Intergenic
1013486399 6:110600580-110600602 CAGGTGATTCTGATGCATGCTGG - Intergenic
1013956765 6:115851268-115851290 CAGGGAATCCTTATGGTTGCAGG - Intergenic
1017198337 6:151726033-151726055 CAGGGGTGTTTGATGTATGCAGG + Intronic
1018523078 6:164674393-164674415 CAGTGGCTTCTGATGGCTCCTGG - Intergenic
1018942550 6:168319279-168319301 CGGGGGTGTCTGATGGATGGAGG - Intronic
1019122594 6:169814620-169814642 CAGGCCATGCTGATGGATGGAGG + Intergenic
1022341626 7:29473696-29473718 CCGGGGGTTCTGATGCCTGCAGG + Intronic
1022342901 7:29485783-29485805 CAGGAGACTCTGATGGCTCCAGG - Intronic
1023058115 7:36305703-36305725 CAGTGGATTCAGATGGAAACTGG + Intergenic
1023233926 7:38064435-38064457 TAGGTGATTCTGGTGGAGGCTGG - Intergenic
1023579873 7:41670378-41670400 CAGGGGTTTCAGTTTGATGCTGG - Intergenic
1024658167 7:51469643-51469665 CAGGGGCTGCTCATGAATGCTGG + Intergenic
1024687034 7:51757375-51757397 CAGGGGATTCTGATGCTTGCTGG - Intergenic
1026889073 7:73971711-73971733 CAGGGGATTCTGGCAGAGGCTGG - Intergenic
1033222250 7:139535977-139535999 CAGGTGATTCTGATGCAGGCTGG - Intronic
1036089743 8:5652736-5652758 CAGTGGATGCTGCTGAATGCAGG + Intergenic
1038315733 8:26482892-26482914 CAGTGGATTCTAATGTGTGCTGG + Intronic
1039974371 8:42348608-42348630 CATGTGATGCTGATGTATGCAGG + Intronic
1043052086 8:75396767-75396789 GAGTGGATCCTGATAGATGCAGG - Intergenic
1045951224 8:107853883-107853905 CAGGTGATTCTGATGCATGCTGG + Intergenic
1050152335 9:2629182-2629204 CTGGGGATTCTGATGCACACGGG + Intronic
1052593196 9:30525401-30525423 CAGGGAATTCTAATGGATTTTGG + Intergenic
1057787175 9:98095983-98096005 CAGTGGATTCTCATGTTTGCAGG + Intronic
1060393552 9:123299833-123299855 CAGGGGCTTCTGAAGGCCGCTGG - Intergenic
1061000408 9:127899389-127899411 CCGGGGATGGGGATGGATGCGGG - Intronic
1061995445 9:134180687-134180709 CAGGGATTCCTCATGGATGCGGG - Intergenic
1062082094 9:134629625-134629647 CTGGGAATTCTCATGGATGCAGG - Intergenic
1062262956 9:135671921-135671943 CACGGGAGTCTGAAGGAGGCTGG + Intergenic
1185789742 X:2919742-2919764 CAGGGGTTTCTGTTGGGGGCTGG - Intronic
1187880166 X:23839371-23839393 CAGGGGAGTCTGCTTGAGGCTGG + Intronic
1189967688 X:46391449-46391471 CAGGTGATTCTGATGTTCGCTGG + Intergenic
1190700918 X:52989447-52989469 CAGGGGATGCTCATGAATGGAGG - Intronic
1190708076 X:53047521-53047543 CAGGGGATTCAGATGCAAGTGGG + Intergenic
1194657757 X:96594143-96594165 CACGTGATTCTGATGCGTGCTGG + Intergenic
1194955474 X:100174251-100174273 CAGGAGCTTCTGACGGCTGCTGG - Intergenic
1195454914 X:105057586-105057608 AAGGGGACTCTGATAGATGGAGG - Intronic
1195993155 X:110703215-110703237 CAGGGGATTCTGATGGATGCAGG + Intronic
1196614165 X:117748566-117748588 CAGGGGATTCTGATGCATGCTGG + Intergenic
1201284642 Y:12368725-12368747 CAGGGGTTTCTGTTGGGGGCTGG + Intergenic
1201675059 Y:16571890-16571912 AAAGGAATTGTGATGGATGCAGG - Intergenic