ID: 1195994097

View in Genome Browser
Species Human (GRCh38)
Location X:110713950-110713972
Sequence TGGAAATGATCAATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195994088_1195994097 13 Left 1195994088 X:110713914-110713936 CCTGTTGTTTTGGCAAGATGAGC 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1195994097 X:110713950-110713972 TGGAAATGATCAATGGTGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 236
1195994086_1195994097 18 Left 1195994086 X:110713909-110713931 CCTTCCCTGTTGTTTTGGCAAGA 0: 1
1: 0
2: 1
3: 16
4: 203
Right 1195994097 X:110713950-110713972 TGGAAATGATCAATGGTGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 236
1195994087_1195994097 14 Left 1195994087 X:110713913-110713935 CCCTGTTGTTTTGGCAAGATGAG 0: 1
1: 0
2: 0
3: 18
4: 163
Right 1195994097 X:110713950-110713972 TGGAAATGATCAATGGTGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 236
1195994084_1195994097 30 Left 1195994084 X:110713897-110713919 CCAAGTACATAGCCTTCCCTGTT 0: 1
1: 0
2: 0
3: 16
4: 139
Right 1195994097 X:110713950-110713972 TGGAAATGATCAATGGTGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195994097 Original CRISPR TGGAAATGATCAATGGTGGA GGG Intronic
901760171 1:11465854-11465876 GGGAAATGAGCAGTGGCGGATGG - Intergenic
902427913 1:16339229-16339251 TGGAAATGATTAATGTGGAATGG - Intronic
904308109 1:29603563-29603585 TGGAAATGATCCAGGGGAGAAGG - Intergenic
905618819 1:39422495-39422517 TGGAAGAGATCAATGCTCGATGG + Exonic
907159454 1:52359986-52360008 TGGTAATGAACAGTGGTGGCAGG + Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910377439 1:86587835-86587857 TAGAAGTGGTCCATGGTGGATGG - Intergenic
910906841 1:92190251-92190273 TGGAAATGATCAATGAATCAAGG + Intergenic
912959288 1:114181037-114181059 TGGAAATGACCAATGGATGGTGG - Intergenic
915720683 1:157983127-157983149 TGGAAATCACCCAAGGTGGATGG - Intergenic
917273031 1:173299337-173299359 TGCATCTGATCACTGGTGGATGG + Intergenic
917732187 1:177885926-177885948 TGGACATGGGCATTGGTGGAAGG - Intergenic
919987202 1:202683846-202683868 TGGAAATGATCCTTAGTGAATGG - Intronic
920713964 1:208321897-208321919 AGAAAATGATCATTGGTGGGAGG + Intergenic
920824181 1:209409728-209409750 TGAAAATGATCAAGAATGGATGG - Intergenic
921237552 1:213149579-213149601 TGGAAATGATCAATGTAGTGAGG + Intronic
1063627235 10:7701632-7701654 AGGAAATGATCAATGGAAGGAGG + Intergenic
1063879321 10:10514675-10514697 TGGAAATAGTCGGTGGTGGATGG + Intergenic
1064345898 10:14532795-14532817 TGGAGATTATCTATGGTGAAGGG - Intronic
1065731934 10:28717441-28717463 TGGAAACTGGCAATGGTGGAAGG - Intergenic
1067175736 10:43944133-43944155 GGGAAATGCTCACTGGGGGAGGG + Intergenic
1068938760 10:62660541-62660563 TGGAAATGGAGAAAGGTGGATGG + Intronic
1069899820 10:71701048-71701070 TGGACAAGATCAGTGGTGGTGGG - Intronic
1070384463 10:75912153-75912175 GGGAAATGAGTAATGGTGCATGG - Intronic
1071723051 10:88166604-88166626 TGGAAATTATCAATGGGGTCAGG + Intergenic
1072871369 10:99124435-99124457 TGGACATGATTAATGGTGGCAGG - Intronic
1073042464 10:100616965-100616987 TGGAAAAGATGTATGGTAGAAGG - Intergenic
1074281352 10:112054593-112054615 TGGAAATGAAAAAAGGGGGATGG - Intergenic
1074441557 10:113481538-113481560 TGGAAATTATCAATCCTTGAAGG + Intergenic
1074941975 10:118245101-118245123 TGGAAATGATGACTGGATGAGGG + Intergenic
1076269023 10:129134237-129134259 TGGAAATGATAGAAGGGGGAGGG - Intergenic
1076940944 10:133608049-133608071 TGGACAAGATATATGGTGGAGGG + Intergenic
1077345772 11:2051521-2051543 TGGAAATGAAAAATGGAGAATGG - Intergenic
1077346608 11:2060984-2061006 TGGAAATGGAGAATGGTGTATGG - Intergenic
1077826765 11:5818979-5819001 TGGAAATTTCCAATGATGGAGGG - Intronic
1079955785 11:26862954-26862976 TGTAAATGGTCAATGATGAATGG - Intergenic
1082286318 11:50321715-50321737 TGGGAATGGTGAATGGTGGTGGG + Intergenic
1083796074 11:65017545-65017567 TGGGAATGATCAAGAGGGGAAGG + Intronic
1084869033 11:72083299-72083321 TGCAAAGGTTCTATGGTGGAAGG - Intronic
1086268277 11:85028460-85028482 ACGACATGATCAATGGTGGCAGG - Intronic
1086940388 11:92791542-92791564 TGTAAGTGATAAATGGTAGAGGG - Intronic
1088255561 11:107900184-107900206 TCCAAATGATGACTGGTGGAAGG - Intronic
1088553234 11:111036112-111036134 TGGAAATGATCAACTCAGGATGG + Intergenic
1089045374 11:115497700-115497722 TGGAAACCATCAATGAAGGAAGG - Intronic
1092293641 12:7181266-7181288 TGGTGATCAGCAATGGTGGACGG - Intergenic
1092388353 12:8053131-8053153 TGGACATGATCCATGATGTAGGG - Exonic
1093871114 12:24292165-24292187 CAGAAATGATCAATAGTGGCAGG + Intergenic
1094763449 12:33561915-33561937 TGGCAATGATGAGTGCTGGATGG - Intergenic
1095042620 12:37459558-37459580 TGGTAATGATAAATGCTGTAAGG - Intergenic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1098456431 12:70680168-70680190 AGGAAATTATGAATTGTGGATGG - Intronic
1098554358 12:71802013-71802035 TGGAAAAGAACAAAGGTGGAGGG - Intergenic
1100814690 12:98375036-98375058 TGGAAATGATCTACGAGGGATGG - Intergenic
1101545659 12:105710028-105710050 TGGAGATGAAGAAAGGTGGATGG - Intergenic
1102782020 12:115573491-115573513 TGGAGATACTCAGTGGTGGACGG + Intergenic
1104164493 12:126214714-126214736 TGGAAGTGAGCAAAGGTAGAGGG - Intergenic
1104776094 12:131391112-131391134 AGAACATGATCTATGGTGGAAGG - Intergenic
1105045811 12:133002309-133002331 TGGGGATGATAAATGGTGGCTGG - Intronic
1107110143 13:36688646-36688668 TGGAAATGATCAGAGCAGGATGG + Intronic
1108471939 13:50776272-50776294 TGGAAATGATCTATGGTCCTTGG + Intronic
1108668785 13:52660331-52660353 TGATAATCATGAATGGTGGATGG + Intronic
1109185697 13:59265025-59265047 TGGAAATAATCAAGGGAGGTGGG + Intergenic
1109294783 13:60516762-60516784 TGGAAATGATACATGGTGAGTGG - Intronic
1111390286 13:87585302-87585324 TGGATATGATGAAAGGTGAAAGG - Intergenic
1111913748 13:94339581-94339603 ATGAAAAGATCAAGGGTGGAAGG + Intronic
1112622325 13:101065215-101065237 TGGAAATGTTCACTGGAGGACGG + Intronic
1116477295 14:45355704-45355726 TGCAAAGGACCAATGGTGGAGGG + Intergenic
1116713196 14:48396114-48396136 TGGTAATTCTCAATGTTGGAGGG + Intergenic
1118854350 14:69610029-69610051 TGGAGAAGATGAATGGAGGAAGG - Intergenic
1119708724 14:76805488-76805510 TGGCAAGGCACAATGGTGGAAGG - Intronic
1121736361 14:96220753-96220775 TGGACATGGTCAAAGGTGGGGGG - Intronic
1122316450 14:100828370-100828392 AGGAAATGAGAAAGGGTGGAGGG - Intergenic
1202941152 14_KI270725v1_random:147292-147314 TGGTAATGATAAATGCTGTAAGG - Intergenic
1125113819 15:36065358-36065380 AGGAAATGAGCAATGGAAGAAGG - Intergenic
1127768789 15:62213492-62213514 TGGACAAGATATATGGTGGAGGG - Intergenic
1128445427 15:67755513-67755535 TGAAGATGACCAGTGGTGGAAGG - Intronic
1128523569 15:68391425-68391447 TGGAAATGCTCCATGGAAGAGGG - Intronic
1129124193 15:73423629-73423651 TGGTAATGATGAATGCTGGTGGG + Intergenic
1133988617 16:10687946-10687968 AAGAAATGATAAATGCTGGAGGG - Intronic
1134248457 16:12557352-12557374 TGGAGATGCTGAATGGTTGAGGG + Intronic
1135658999 16:24278188-24278210 TGGAAATCATCAGTGGTAAAAGG + Intronic
1137964554 16:52917394-52917416 GGGAAATGCAAAATGGTGGAGGG - Intergenic
1144220251 17:13093230-13093252 TGGATATGATCGATGGTTGATGG + Intergenic
1150174126 17:63032371-63032393 TGCAAATCATCTATGGTAGAGGG + Intronic
1153128612 18:1828095-1828117 TAGAATGGATCACTGGTGGAAGG - Intergenic
1154352984 18:13602425-13602447 TGGGAATCATCATTGGTGGTGGG + Intronic
1155141815 18:23050810-23050832 TGGAAATCAACCATGGTGGAAGG - Intergenic
1155260054 18:24032954-24032976 TTGAAAAGATCAATGCTGGCTGG + Intronic
1156037671 18:32783978-32784000 TGGAAATGCTGATTGGTGCATGG + Intergenic
1156400963 18:36740090-36740112 TGGTAAAAATCAATTGTGGAAGG - Intronic
1163096103 19:15058210-15058232 TGGAAATGACCACTTCTGGAGGG + Exonic
1163269620 19:16244008-16244030 TGCAAATCATCAATGCTTGATGG - Intronic
1164304783 19:23996379-23996401 TGAAAGTGAACAATGGTGAAAGG + Intergenic
1164426140 19:28143362-28143384 TGGAAATGATGAATGGTGGTGGG - Intergenic
1167754111 19:51400438-51400460 TGGACAAGATATATGGTGGAGGG - Intergenic
1168198085 19:54790685-54790707 TGGAAATGGGCAATGGCGGGCGG - Intronic
925144619 2:1572640-1572662 TGCAAATGATCAAAGCTGGAAGG + Intergenic
925554232 2:5111545-5111567 TGAAAAAAAGCAATGGTGGAGGG - Intergenic
933073583 2:77893546-77893568 AGTAAATGATCAATGGTTCATGG + Intergenic
933614747 2:84472043-84472065 TGGACAAGATATATGGTGGAGGG - Intergenic
934789886 2:97050161-97050183 TGGAAAGGGTCAATGGTGGAGGG - Intergenic
934816582 2:97332378-97332400 TGGAAAGGGTCAGTGGTGGAGGG + Intergenic
934821114 2:97376106-97376128 TGGAAAGGGTCAGTGGTGGAGGG - Intergenic
938797129 2:134727129-134727151 TGGAAATGCTTAATGGGGGTGGG + Intergenic
940037217 2:149323582-149323604 TGGACAAGATATATGGTGGAGGG + Intergenic
942031955 2:171971815-171971837 TTGAAATGCTCGATGGTGTAGGG + Intronic
942673959 2:178406975-178406997 ATGAAATGACCAATAGTGGATGG - Intergenic
943880240 2:193133837-193133859 TGGAAATGAGAAATTTTGGAGGG + Intergenic
945068394 2:205966645-205966667 TGGAGCTGATCATTTGTGGAAGG - Intergenic
947102799 2:226639271-226639293 TGGAACAAATCAATGGGGGAAGG + Intergenic
947123765 2:226844814-226844836 TGGAAATCATAAATGGTGATGGG + Intronic
1170074831 20:12408259-12408281 TGGAGATGATCACTGTTGTAGGG + Intergenic
1171253789 20:23670674-23670696 AGGCAAAGATCTATGGTGGATGG - Intergenic
1171804057 20:29658522-29658544 TGGTAATGATAAATGCTGTAAGG + Intergenic
1171839996 20:30197898-30197920 TGGTAATGATAAATGCTGTAAGG - Intergenic
1176582010 21:8539650-8539672 TGGTAATGATAAATGCTGTAAGG + Intergenic
1178310956 21:31529650-31529672 TGGGAAGGAGCAATGCTGGATGG - Intronic
1180264847 22:10516698-10516720 TGGTAATGATAAATGCTGTAAGG + Intergenic
1181987506 22:26810720-26810742 TGGAAATGCCTAATGGGGGAAGG - Intergenic
1182047010 22:27283230-27283252 GGGAAATGAAGAATGGAGGATGG - Intergenic
1184824283 22:46936522-46936544 TGGAGATCATCAAAGGAGGATGG - Intronic
952696960 3:36277018-36277040 TGGAATTGATCAAAGATGGTTGG - Intergenic
954259756 3:49430105-49430127 TGGAAATCAGCAATGGATGAGGG - Intergenic
955494403 3:59516690-59516712 TTGAAATGACAAATGGTGAAAGG + Intergenic
956336799 3:68174182-68174204 TGGAACTGAAAAATGGTGGTTGG + Intronic
956959983 3:74388007-74388029 GGGAAATGTTTAAAGGTGGATGG + Intronic
957043461 3:75355284-75355306 TGAAAATGCTAAATGGTGGCTGG + Intergenic
957075245 3:75597434-75597456 TGTAAATGCTAAATGGTGGCTGG + Intergenic
958967558 3:100576014-100576036 TAGAAATGATCAAAGTTGGCTGG + Intronic
960249698 3:115438336-115438358 TGGAAATTATCCTTGGTTGAAGG + Intergenic
964953041 3:162321037-162321059 TGGAAATAACAAATGCTGGAGGG - Intergenic
965787373 3:172349950-172349972 AGGAAATTATCACTGGTGGCCGG - Intronic
965930384 3:174035648-174035670 TGCAAATGATAAATGGTAGCAGG - Intronic
967803469 3:193690836-193690858 TGGAAATGATCAATTAAGGTGGG - Intronic
970208881 4:13686246-13686268 TCAAAATCATAAATGGTGGAGGG - Intergenic
971766018 4:30833070-30833092 TGGGAATATTCAATGCTGGAGGG + Intronic
976647813 4:87403392-87403414 TGGACAAGATACATGGTGGAGGG - Intergenic
976739088 4:88340299-88340321 TGGAAATGATGAATAGGGCAAGG + Intergenic
977814806 4:101402582-101402604 TGTCAATGATCAATGTTGGGAGG - Intergenic
978226027 4:106336380-106336402 TGGAAATGATCAAATGTGTAGGG + Intronic
978306408 4:107333433-107333455 TGGACAAGATATATGGTGGAGGG + Intergenic
979109776 4:116738582-116738604 TGAATCTGATCAATGGTGGTTGG + Intergenic
980396355 4:132221108-132221130 TGGAAATGATCACTAGTACAAGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
983052380 4:163063351-163063373 TGTAAAGGATCATTGGTAGAGGG - Intergenic
983577673 4:169276088-169276110 TGGAAATAATTAACGCTGGAAGG - Intergenic
984924603 4:184795640-184795662 TGGTAATGAGCAGTGGTGGTTGG - Intronic
987709982 5:21493614-21493636 TGGAAATGACAAATGGTGGCAGG - Intergenic
987923143 5:24309291-24309313 TGGACAAGATATATGGTGGAGGG - Intergenic
988493283 5:31723417-31723439 TAGAAATTATCAATGGTTAAAGG + Intronic
988730973 5:33972142-33972164 TAAAAATGATGCATGGTGGATGG - Intronic
988749630 5:34180549-34180571 TGGAAATGACAAATGGTGGCAGG + Intergenic
989120654 5:38001345-38001367 TTGAAATGATTAATGATAGAAGG + Intergenic
991373728 5:65943778-65943800 TGGAGATGAACAGTGGTGAAGGG - Intronic
991737887 5:69643753-69643775 TGGAAATGACAAGTGGTGGCAGG + Intergenic
991760307 5:69912671-69912693 TGGAAATGACAAGTGGTGGCAGG - Intergenic
991787025 5:70205429-70205451 TGGAAATGACAAGTGGTGGCAGG + Intergenic
991789463 5:70223479-70223501 TGGAAATGACAAGTGGTGGCAGG + Intergenic
991814211 5:70498589-70498611 TGGAAATGACAAGTGGTGGCAGG + Intergenic
991817346 5:70519881-70519903 TGGAAATGACAAGTGGTGGCAGG + Intergenic
991839538 5:70787722-70787744 TGGAAATGACAAGTGGTGGCAGG - Intergenic
991879470 5:71205819-71205841 TGGAAATGACAAGTGGTGGCAGG + Intergenic
991881910 5:71223848-71223870 TGGAAATGACAAGTGGTGGCAGG + Intergenic
992064005 5:73086925-73086947 TGAAAATTATAAATGGTGGTGGG - Intronic
992610533 5:78504707-78504729 TGGAAGTGAGCAATGATTGAGGG - Intronic
994460427 5:100063815-100063837 TGGAAATGACAAGTGGTGGCAGG + Intergenic
994484576 5:100377226-100377248 TGGAAATGACAAGTGGTGGTAGG + Intergenic
995752394 5:115466834-115466856 GGAAAATGATCATTGGTGAAAGG + Intergenic
996139662 5:119890677-119890699 TGGAAATCAGCAATGGTGTGGGG + Intergenic
997685674 5:135786139-135786161 TGGATATGATCCATGGAGCAAGG - Intergenic
997688903 5:135812280-135812302 AAGAAATGATAAATGCTGGAGGG - Intergenic
999621258 5:153476720-153476742 TGGAAATCATCAATATTTGAGGG - Intergenic
1000569298 5:162892210-162892232 TGGAAATAAACATTGATGGATGG - Intergenic
1002164402 5:177335633-177335655 TGGAAATGATGAAAGCTGGTTGG + Intronic
1003316117 6:5013598-5013620 TGGAAGTGATCAAAGGACGATGG + Intergenic
1003721440 6:8707523-8707545 GGGAAATGATCAGTGGTGGAAGG + Intergenic
1005547700 6:26886895-26886917 TGGAAATGACAAGTGGTGGCAGG + Intergenic
1007781778 6:44258462-44258484 TGGAAATGATGAGGGATGGAGGG - Exonic
1007826384 6:44603968-44603990 TGGAAATGCTCCAAGTTGGAGGG + Intergenic
1007830696 6:44636257-44636279 TGGAGATGTTCAAGGGTGGCAGG - Intergenic
1009018463 6:57927969-57927991 TGGAAATGACAAGTGGTGGCAGG + Intergenic
1009690681 6:67028736-67028758 TTGAAATGATCAATGTGGTATGG - Intergenic
1010076339 6:71803236-71803258 TGGAGAGAATCAATGGTGGGTGG + Intergenic
1011947379 6:92923209-92923231 TGGAGATGAACAATGGTTAATGG - Intergenic
1012802704 6:103852475-103852497 TGCAAGTGAGTAATGGTGGAAGG + Intergenic
1015314913 6:131807518-131807540 TGCAAATGAACCATGGAGGAAGG - Intergenic
1015568916 6:134602059-134602081 TGGACAAGATATATGGTGGAGGG - Intergenic
1016103801 6:140136827-140136849 AAGAAATGATAAATGCTGGAGGG + Intergenic
1016211183 6:141535659-141535681 TGAAAAAGTTCAATGTTGGAAGG - Intergenic
1017213320 6:151880754-151880776 TGGGAATGATGAAAGGTGGTAGG + Exonic
1018955529 6:168407778-168407800 GGAACATGAGCAATGGTGGAAGG - Intergenic
1019826698 7:3290453-3290475 TTGAAAGAATAAATGGTGGAAGG - Intergenic
1019851726 7:3565866-3565888 TGGATCTGATCAACTGTGGATGG - Intronic
1020360785 7:7324448-7324470 TGGAAATGAACATTTGTGGAAGG + Intergenic
1021427232 7:20515509-20515531 TGGCAATGCTGAATGGAGGAAGG + Intergenic
1021845562 7:24759065-24759087 TCGAAATGGTCCATGGTGGTAGG + Intergenic
1022194084 7:28046798-28046820 TGAAATAGATCAATGTTGGAAGG - Intronic
1022911061 7:34899956-34899978 GGGAAATGTTCAATTGTGGTGGG + Intergenic
1023002388 7:35823533-35823555 TGGAGAGGATCAAGGATGGAAGG - Intronic
1023065386 7:36372610-36372632 TGGAAATGATTAAGGGAGGAAGG + Intronic
1023135175 7:37044157-37044179 TGAAAATGCTCAATGAGGGATGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1023792878 7:43767637-43767659 TTAAAATGATAAATGCTGGAGGG + Intronic
1023889287 7:44381135-44381157 TGGAGATGATCTGTGTTGGATGG - Exonic
1024689259 7:51781394-51781416 TGGAAATGAACCATGCTAGAAGG + Intergenic
1025288513 7:57689336-57689358 TGGTAATGATAAATGTTGTAAGG - Intergenic
1025732288 7:64117421-64117443 TGGAAATGACGAGTGGTGGCAGG - Intronic
1026672466 7:72402090-72402112 TGGAAATGACAAATGCTGAAGGG - Intronic
1027470668 7:78569831-78569853 TGAAAGTGATCAGTGGTGGCAGG - Intronic
1028684002 7:93572703-93572725 AGGTAATGATTGATGGTGGATGG - Intronic
1029025194 7:97409662-97409684 TGGAAATGATAAATGCTTCATGG + Intergenic
1030467226 7:109918514-109918536 TGGAAATGATCAAAAGAGTAAGG - Intergenic
1031657981 7:124381214-124381236 TGCAAATGTTCATTGGTGGCTGG - Intergenic
1032513436 7:132490064-132490086 GGGAAAGGAGCAATGGGGGAAGG + Intronic
1032973769 7:137197174-137197196 TGGAAATGATAAATATTGGAGGG - Intergenic
1033086231 7:138344578-138344600 TGGACAAGATATATGGTGGAGGG + Intergenic
1033552374 7:142459126-142459148 AGGAAATAAGCAATGGTGGAGGG - Intergenic
1033556919 7:142496181-142496203 AGGCAATAAGCAATGGTGGAGGG - Intergenic
1035046014 7:155966240-155966262 TGTAAAAGAACAATGTTGGAGGG + Exonic
1036989268 8:13573935-13573957 AGGATATGATGAATGATGGAGGG - Intergenic
1039232699 8:35465883-35465905 TCAAAATGAGCAATGGTGGATGG - Intronic
1039789691 8:40865428-40865450 TGGAAATGACCAATGGCAGAGGG + Intronic
1039965943 8:42283912-42283934 TGGAAATGTTGCAGGGTGGATGG + Intronic
1041580296 8:59450801-59450823 TGGAAATCATAAATGGTAGATGG + Intergenic
1042296671 8:67226138-67226160 TGGAAAGAATCAATGGTCGCTGG + Exonic
1044575736 8:93767496-93767518 TGGAAGTAATCAAATGTGGATGG - Intronic
1045133967 8:99191957-99191979 GGAAAATGACAAATGGTGGAGGG + Intronic
1045855278 8:106757773-106757795 TGGGAATGATAGCTGGTGGATGG + Intergenic
1048549038 8:135416577-135416599 CGGTAATGGTCAATGGTGAATGG + Intergenic
1048657456 8:136556770-136556792 AGGAATTGAACAATGCTGGAGGG + Intergenic
1049350979 8:142164531-142164553 TGGAAATGAAGGATGGAGGATGG + Intergenic
1051379159 9:16437256-16437278 TCGAAGTGATGAATGCTGGAAGG + Exonic
1053020913 9:34693332-34693354 AGCAACTGATCAGTGGTGGAAGG + Intergenic
1055429348 9:76227897-76227919 TGGAAATGATGATTGAGGGACGG - Intronic
1056372091 9:85966646-85966668 TGAAAATGTTCAATGTTGGAAGG + Intronic
1056688033 9:88782849-88782871 TGGAAATGAAGAATGGGGAAGGG + Intergenic
1057810021 9:98250541-98250563 TGGAATTGAGGAAGGGTGGAGGG + Intronic
1058321084 9:103631907-103631929 TGTAAATGTGCAATGGTAGAGGG - Intergenic
1059945624 9:119405726-119405748 TGGAAATCATAACTGATGGATGG - Intergenic
1061264862 9:129499038-129499060 AGGAAATGATGGATGGAGGAGGG + Intergenic
1061660718 9:132128378-132128400 TGGCCATGATCTCTGGTGGAGGG - Intergenic
1203612027 Un_KI270749v1:17667-17689 TGGTAATGATAAATGCTGTAAGG + Intergenic
1186275468 X:7933763-7933785 TGCAAATGATCAATAGAGAAGGG - Intergenic
1186399743 X:9246483-9246505 TGGAAGTGATTCATGGTAGAAGG - Intergenic
1186448244 X:9650497-9650519 TGGAAAGGACCAATCTTGGAGGG - Intronic
1187027373 X:15449494-15449516 TGGAAATAATCAGTGGAGAATGG + Intronic
1193507460 X:82362077-82362099 TACAAATGATCAATTGTGGAGGG + Intergenic
1194841027 X:98742356-98742378 TGGAAATGAAGATTAGTGGATGG - Intergenic
1195059962 X:101184520-101184542 TGGACAAGATATATGGTGGAGGG - Intergenic
1195130679 X:101848021-101848043 TGGAAAGCTTCAATGGTGGTGGG + Intronic
1195308192 X:103606441-103606463 TGGAAAAGATCAAGGAAGGATGG + Intergenic
1195345475 X:103946194-103946216 TGCAAAGGACCAATGATGGATGG + Intronic
1195994097 X:110713950-110713972 TGGAAATGATCAATGGTGGAGGG + Intronic
1196233003 X:113246528-113246550 TAGAAATGATAAATGCTTGAGGG - Intergenic
1196663805 X:118295386-118295408 TGGACAAGATACATGGTGGAGGG - Intergenic
1197924798 X:131634975-131634997 AGGAAATGACAGATGGTGGAGGG - Intergenic
1198344462 X:135746200-135746222 TGGAGAAGATATATGGTGGAGGG + Intergenic
1199273149 X:145909392-145909414 TGGAAATGAACAGTGGGTGATGG + Intergenic
1199816857 X:151405096-151405118 TTAAAATGATAAATGCTGGAGGG + Exonic
1200926992 Y:8663518-8663540 TGGAATGGATCAATGCTGGGTGG + Intergenic
1201279201 Y:12326494-12326516 TGGACAAGATATATGGTGGAGGG + Intergenic