ID: 1195997209

View in Genome Browser
Species Human (GRCh38)
Location X:110743288-110743310
Sequence TGACCAATGCTGACTTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195997201_1195997209 21 Left 1195997201 X:110743244-110743266 CCTTCCATGCCTCCTAGGCTTGT 0: 1
1: 0
2: 0
3: 17
4: 247
Right 1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1195997203_1195997209 12 Left 1195997203 X:110743253-110743275 CCTCCTAGGCTTGTGCTCATGAT 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1195997205_1195997209 9 Left 1195997205 X:110743256-110743278 CCTAGGCTTGTGCTCATGATGGC 0: 1
1: 0
2: 4
3: 24
4: 151
Right 1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1195997200_1195997209 22 Left 1195997200 X:110743243-110743265 CCCTTCCATGCCTCCTAGGCTTG 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1195997202_1195997209 17 Left 1195997202 X:110743248-110743270 CCATGCCTCCTAGGCTTGTGCTC 0: 1
1: 0
2: 1
3: 20
4: 239
Right 1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195997209 Original CRISPR TGACCAATGCTGACTTTGGG TGG Intronic
902150633 1:14440219-14440241 TGACAAATGCTAACCTTGGCAGG + Intergenic
905674532 1:39816443-39816465 TGACCAAGGCTGAATGGGGGTGG + Intergenic
913965340 1:143372452-143372474 TGGCTGATGCTGACTTTGGTGGG - Intergenic
914059716 1:144198054-144198076 TGGCTGATGCTGACTTTGGTGGG - Intergenic
914119434 1:144768317-144768339 TGGCTGATGCTGACTTTGGTGGG + Intergenic
916803221 1:168233623-168233645 TCTCCAATACTAACTTTGGGTGG + Intronic
919088093 1:192945557-192945579 TGACAAATGCTGACTTTAACAGG + Intergenic
919979082 1:202631192-202631214 TCACCCATGCTGGCTTTGGTAGG - Intronic
923454085 1:234147946-234147968 TGAGAAATGCTGCCTTAGGGAGG + Intronic
1063900541 10:10728022-10728044 TGACTCATGCTGACTTGGGTTGG + Intergenic
1064273357 10:13885001-13885023 TCAACGATGCTAACTTTGGGGGG - Intronic
1066311947 10:34205938-34205960 GGACCGATGCTGATGTTGGGAGG + Intronic
1070513573 10:77183018-77183040 AGACCAAAGCTAACTTTGGCAGG + Intronic
1073592699 10:104771847-104771869 TGACCAAGGCTGACTCCAGGAGG + Intronic
1074424068 10:113335748-113335770 TGACAAAGGCTGACCTTGGCTGG + Intergenic
1075207476 10:120459492-120459514 TGACAGAGGCTGACTTTTGGGGG + Intronic
1077225386 11:1437148-1437170 AGTCCCATGCTGAATTTGGGAGG + Intronic
1079545903 11:21631632-21631654 TGACCAATGATGACTTTGTATGG - Intergenic
1082644141 11:55701479-55701501 TGACCAATGCTGACTTTTACCGG - Intergenic
1086864774 11:91967306-91967328 TGTAAAGTGCTGACTTTGGGGGG - Intergenic
1088178157 11:107077831-107077853 TGATCAATGTTGACATTTGGAGG + Intergenic
1089528154 11:119110143-119110165 TGACTGATGCTGGCTCTGGGTGG - Exonic
1090362158 11:126181125-126181147 TGAGGATTGCTCACTTTGGGAGG + Intergenic
1091084688 11:132709873-132709895 TGACCAATGCTTAAATTAGGGGG - Intronic
1093816636 12:23557035-23557057 TGACCAATGTTGACTTAATGTGG - Intronic
1094131608 12:27081252-27081274 TGACCGATGGGGACTTTTGGTGG + Exonic
1094190152 12:27689778-27689800 TGAGCAATGCAGCCTTTAGGTGG - Intronic
1097571667 12:61340783-61340805 TGTCCAAAACTGATTTTGGGGGG - Intergenic
1098942413 12:76552726-76552748 GGCCCTATGCTGACTTGGGGTGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1106039405 13:26075366-26075388 TGACAAATCCTGACTTGGGCAGG + Intergenic
1107061972 13:36169257-36169279 TGACCTATACTTACTCTGGGTGG - Intronic
1107077704 13:36341149-36341171 TGATACAAGCTGACTTTGGGAGG + Intronic
1109191220 13:59326643-59326665 TGAACAATGTTTCCTTTGGGAGG - Intergenic
1119861674 14:77940530-77940552 TCTCCAAAGCTGACCTTGGGTGG + Intergenic
1124494684 15:30179150-30179172 TCACCCATGCTGGCTTTGGTAGG - Intergenic
1124748886 15:32359495-32359517 TCACCCATGCTGGCTTTGGTAGG + Intergenic
1128111927 15:65081927-65081949 TGACACATGCTGACTGTGGGTGG - Intergenic
1131478444 15:92761792-92761814 TGAAAAATGCTGAGTTTGGTTGG - Intronic
1132433952 15:101781720-101781742 TGCCCCAGGTTGACTTTGGGCGG - Intergenic
1132553426 16:562746-562768 TGACCAGAGCTCACTTCGGGTGG - Intronic
1132712197 16:1274001-1274023 TGAGCAATGCAGACTGTGAGCGG - Intergenic
1133358746 16:5156723-5156745 TGAGCAATAATGACTTTTGGTGG + Intergenic
1134815240 16:17200237-17200259 TGATAAATGCTGTTTTTGGGGGG - Intronic
1140410264 16:74736885-74736907 TGCCCAGAGGTGACTTTGGGCGG + Intronic
1143377393 17:6474753-6474775 TGGCCAGTGCTGACTGTAGGTGG - Intronic
1144337667 17:14286267-14286289 TAACCCATGTTCACTTTGGGTGG + Intergenic
1146477787 17:33176972-33176994 TGGTCAATGCTGAATTTGGATGG + Intronic
1148360694 17:47010005-47010027 TGACCGATGCTGACTGTAGCTGG + Intronic
1149065855 17:52478483-52478505 TGGCCTATGTTTACTTTGGGTGG - Intergenic
1150418349 17:65005991-65006013 TAAGCACTGCTGACCTTGGGGGG - Intergenic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1154409474 18:14129688-14129710 GGATCTATGCTGACTCTGGGCGG - Intronic
1157879253 18:51304510-51304532 TGAGCTATGCTGACTGTGGTTGG - Intergenic
1160213640 18:76906658-76906680 TGACCAATGCTGTAATTGCGGGG + Intronic
1160508227 18:79439018-79439040 TGACTAATTCTCACTTTGTGTGG + Intronic
1165382576 19:35491636-35491658 TGACCAATGCTGACTCTACCTGG - Intronic
1165506101 19:36231104-36231126 TGACCACAACTGACTTTGGGAGG + Intronic
1202699119 1_KI270712v1_random:149940-149962 TGGCTGATGCTGACTTTGGTGGG - Intergenic
925794589 2:7528319-7528341 GGACCAATCCTGAATCTGGGTGG - Intergenic
926643262 2:15260505-15260527 TGGCCAATGGTGAGTTTAGGAGG + Intronic
927104565 2:19812158-19812180 TCTCCCATGCTGTCTTTGGGAGG - Intergenic
929991548 2:46793728-46793750 TGTCCCATGTTCACTTTGGGGGG + Intergenic
933276337 2:80288305-80288327 TGAGCAAAGCAGAATTTGGGGGG + Intronic
934170069 2:89533426-89533448 TGGCTGATGCTGACTTTGGTGGG - Intergenic
934280370 2:91607734-91607756 TGGCTGATGCTGACTTTGGTGGG - Intergenic
934696820 2:96406008-96406030 TGTCCAACCCTGACTTTGGCAGG + Intergenic
938983032 2:136544811-136544833 TACCAAATGCTTACTTTGGGAGG + Intergenic
940201248 2:151153345-151153367 TGACAGCTGTTGACTTTGGGTGG + Intergenic
940227326 2:151413287-151413309 TGGCCCAGGCTTACTTTGGGAGG - Intronic
941221412 2:162786700-162786722 TGACCTATGTTGATTTGGGGAGG + Intronic
945157399 2:206853802-206853824 AGACATATGCTTACTTTGGGAGG - Intergenic
1169267728 20:4176885-4176907 TGCCCTATGCTGAATTTGGAGGG + Intronic
1171749547 20:29035416-29035438 TGCCCAATGCTTACATTGTGCGG - Intergenic
1174881091 20:54280321-54280343 TGATCAATACTGACTCTGAGAGG + Intergenic
1176315688 21:5240587-5240609 TGCCCAATGCTTACATTGTGCGG + Intergenic
1179502229 21:41817056-41817078 TCACCAATGCTGGCTGTGGTGGG - Intronic
1179518425 21:41925900-41925922 TGACCATGGCTGATTGTGGGAGG - Intronic
1179563226 21:42230222-42230244 TGACTAATGATGTCTTTGGAGGG + Intronic
1182897216 22:33868826-33868848 TGACCATGGCTGACCTTGAGGGG + Intronic
950968040 3:17159945-17159967 TGAGGGATTCTGACTTTGGGTGG + Intronic
953172915 3:40524338-40524360 TGTCCTGTGTTGACTTTGGGAGG - Intergenic
960486138 3:118254988-118255010 TGACCAATGCTGACCTGGTAAGG + Intergenic
961769953 3:129241758-129241780 AAACAAATGCTGACTTTGGGAGG + Intergenic
962367940 3:134798083-134798105 TGACCACAGCCGAGTTTGGGAGG - Intronic
963782386 3:149499243-149499265 TGACAAATGCTCACTTCAGGTGG - Intronic
964788962 3:160432433-160432455 TACCAAATGCTTACTTTGGGAGG + Exonic
965763371 3:172104959-172104981 TGATCAATGCTGGCTTTGAAAGG - Intronic
967752987 3:193135802-193135824 TGAAGATTGCTGTCTTTGGGGGG + Intergenic
969926446 4:10590123-10590145 TGAACAAGGCTGACATTTGGAGG + Intronic
970704133 4:18779803-18779825 TTCCAAATGCTGACTTTGAGAGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
974741296 4:66011764-66011786 TGTCTAATACTGACATTGGGTGG + Intergenic
976772521 4:88669158-88669180 TGACAACTGCTGAATTTGTGTGG - Intronic
976807831 4:89067930-89067952 TGAAAAATGCTGAGTTTGGTTGG - Intronic
979904248 4:126264938-126264960 TGAGAAATGCTGAGTTTGGAAGG + Intergenic
985426957 4:189840611-189840633 TAAGCCATGCTAACTTTGGGAGG + Intergenic
987604252 5:20112223-20112245 TAACTAATACTGACTTGGGGTGG - Intronic
992028485 5:72695912-72695934 TGACCTATGTTGTTTTTGGGAGG - Intergenic
999116603 5:149169562-149169584 TGACCTTTCCTGACTTGGGGAGG - Intronic
1002064412 5:176644941-176644963 TGACCAGTGCTGTCTGTCGGGGG + Intronic
1002976339 6:2081561-2081583 TGACCTAGGCTGACTTTGAGGGG + Intronic
1011752690 6:90469230-90469252 TGACCACTACAGGCTTTGGGAGG + Intergenic
1017466457 6:154698070-154698092 TGACCAAGTCTGAGTTTGCGAGG - Intergenic
1018384025 6:163286653-163286675 TGACCAAGGCTCACATTAGGAGG - Intronic
1018417491 6:163613683-163613705 TGACCAAGGCTGGCTTTTAGAGG - Intergenic
1020088250 7:5323159-5323181 TGACCAATGCAGCCTTGGGGCGG + Intronic
1021056965 7:16060914-16060936 TGACAGTTGCTGACTTAGGGCGG + Intergenic
1021280777 7:18715420-18715442 TGACCCATGCATGCTTTGGGAGG + Intronic
1021963034 7:25891587-25891609 TGCCCACTGCCAACTTTGGGCGG - Intergenic
1024881231 7:54087799-54087821 TTAAAAATGTTGACTTTGGGAGG + Intergenic
1025206061 7:56993954-56993976 TGACCAATGCAGCCTTGGGGCGG - Intergenic
1025665878 7:63582985-63583007 TGACCAATGCAGCCTTGGGGCGG + Intergenic
1026072081 7:67130812-67130834 TGCCAAATGCAGACTGTGGGAGG - Intronic
1026613133 7:71878650-71878672 TGACCAATGTAGAGTGTGGGAGG + Intronic
1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG + Intronic
1029602628 7:101577737-101577759 TTAATAAGGCTGACTTTGGGAGG - Intergenic
1030477172 7:110050399-110050421 TGCCCAATGCTGACTGTTGGAGG + Intergenic
1031576473 7:123421106-123421128 TCACCCAGGCTGACTTTGGGTGG - Intergenic
1033155821 7:138956148-138956170 AACCCAGTGCTGACTTTGGGAGG - Intronic
1035233491 7:157481034-157481056 TGGCCAGTGCTGACTCTGGGAGG + Intergenic
1035811701 8:2497156-2497178 TATCCAACGCTGTCTTTGGGTGG - Intergenic
1039168246 8:34711597-34711619 TGGGCAATGCTGGCCTTGGGAGG + Intergenic
1039475964 8:37839561-37839583 TGACCTCTGCTGTCTTTGCGGGG + Exonic
1039558706 8:38495912-38495934 CGCCCAATGCTGGCTCTGGGAGG + Intergenic
1040579493 8:48685661-48685683 TGACGGATTCTGACTTGGGGAGG + Intergenic
1042779595 8:72476026-72476048 TGACCAAGGCAGGCTTTGGCAGG - Intergenic
1042887064 8:73564039-73564061 TAAGCTATGCTGACTTAGGGGGG - Intronic
1043355412 8:79405808-79405830 TTACACATGCTGCCTTTGGGTGG - Intergenic
1043375743 8:79647459-79647481 TGACCTAGGCTGTATTTGGGGGG + Intronic
1043913860 8:85897312-85897334 TGACAAATGGTGACTTAGGAGGG - Intergenic
1046857905 8:119055434-119055456 TGACCCATGCTAACCTTGTGGGG - Intronic
1047605089 8:126466699-126466721 TGGCCAATTATGAATTTGGGGGG - Intergenic
1049665744 8:143841665-143841687 TGACCCAGGCTGACTTTGATCGG + Intergenic
1051507877 9:17845322-17845344 TGAGCCAAGCTAACTTTGGGAGG - Intergenic
1051644532 9:19254690-19254712 TGACCCATGGTCACTATGGGTGG + Intronic
1053720595 9:40943009-40943031 TGCCCAATGCTTACATTGTGCGG - Intergenic
1054345392 9:63909147-63909169 TGCCCAATGCTTACATTGTGCGG + Intergenic
1055811815 9:80157515-80157537 TTACCCTTGCTGACTTTTGGGGG - Intergenic
1057048037 9:91900695-91900717 TGACAAGTGCTGACTCTAGGTGG - Intronic
1058980980 9:110170417-110170439 AGACTAGTGTTGACTTTGGGGGG + Exonic
1059508985 9:114826403-114826425 TGACAAAGGCTGACTTGGTGTGG + Intergenic
1062508804 9:136893370-136893392 ACACCACTGCTGGCTTTGGGGGG + Intronic
1185856885 X:3544226-3544248 TGGCCAACGCTGCCTTGGGGTGG + Intergenic
1187478517 X:19633448-19633470 TGACCAATTCAGATTTGGGGAGG - Intronic
1187988580 X:24843377-24843399 TGACTAAAGCGGTCTTTGGGAGG + Intronic
1189102940 X:38209921-38209943 TGACCACTGCAGGCTTGGGGAGG - Intronic
1189598709 X:42598377-42598399 TGACCAGTGATGACTGTGGTTGG - Intergenic
1194132925 X:90104790-90104812 TTAAGAATGTTGACTTTGGGAGG + Intergenic
1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG + Intronic
1198417876 X:136439232-136439254 TGACTAATGCTAAGTTGGGGAGG + Intergenic
1200478713 Y:3674868-3674890 TTAAGAATGTTGACTTTGGGAGG + Intergenic
1202594643 Y:26523832-26523854 TGTCCAATGCTGAGATTGAGTGG - Intergenic