ID: 1196003303

View in Genome Browser
Species Human (GRCh38)
Location X:110809133-110809155
Sequence GGAGACTGATCCTGTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196003303_1196003307 1 Left 1196003303 X:110809133-110809155 CCAGTCCCACAGGATCAGTCTCC No data
Right 1196003307 X:110809157-110809179 TCTGAGTTCCCTAAACTAGTTGG No data
1196003303_1196003308 2 Left 1196003303 X:110809133-110809155 CCAGTCCCACAGGATCAGTCTCC No data
Right 1196003308 X:110809158-110809180 CTGAGTTCCCTAAACTAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196003303 Original CRISPR GGAGACTGATCCTGTGGGAC TGG (reversed) Intergenic
No off target data available for this crispr