ID: 1196004617

View in Genome Browser
Species Human (GRCh38)
Location X:110822405-110822427
Sequence CTCGGAGGGTCCTACGCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5210
Summary {0: 903, 1: 1508, 2: 1213, 3: 891, 4: 695}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196004617_1196004627 26 Left 1196004617 X:110822405-110822427 CCGTGGGCGTAGGACCCTCCGAG 0: 903
1: 1508
2: 1213
3: 891
4: 695
Right 1196004627 X:110822454-110822476 GCGCCGTTTTTTAAGCTGGTTGG No data
1196004617_1196004624 2 Left 1196004617 X:110822405-110822427 CCGTGGGCGTAGGACCCTCCGAG 0: 903
1: 1508
2: 1213
3: 891
4: 695
Right 1196004624 X:110822430-110822452 AGTTGCGGGATATAATCTCCTGG 0: 10
1: 404
2: 1630
3: 1837
4: 1670
1196004617_1196004626 22 Left 1196004617 X:110822405-110822427 CCGTGGGCGTAGGACCCTCCGAG 0: 903
1: 1508
2: 1213
3: 891
4: 695
Right 1196004626 X:110822450-110822472 TGGTGCGCCGTTTTTTAAGCTGG 0: 346
1: 479
2: 127
3: 26
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196004617 Original CRISPR CTCGGAGGGTCCTACGCCCA CGG (reversed) Intergenic
Too many off-targets to display for this crispr