ID: 1196004621

View in Genome Browser
Species Human (GRCh38)
Location X:110822420-110822442
Sequence ATATCCCGCAACTGGCTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5067
Summary {0: 5, 1: 520, 2: 1522, 3: 1829, 4: 1191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196004621_1196004630 29 Left 1196004621 X:110822420-110822442 CCTCCGAGCCAGTTGCGGGATAT 0: 5
1: 520
2: 1522
3: 1829
4: 1191
Right 1196004630 X:110822472-110822494 GTTGGAAAAGCACAGTATTCGGG 0: 14
1: 380
2: 1444
3: 1934
4: 2381
1196004621_1196004626 7 Left 1196004621 X:110822420-110822442 CCTCCGAGCCAGTTGCGGGATAT 0: 5
1: 520
2: 1522
3: 1829
4: 1191
Right 1196004626 X:110822450-110822472 TGGTGCGCCGTTTTTTAAGCTGG 0: 346
1: 479
2: 127
3: 26
4: 31
1196004621_1196004629 28 Left 1196004621 X:110822420-110822442 CCTCCGAGCCAGTTGCGGGATAT 0: 5
1: 520
2: 1522
3: 1829
4: 1191
Right 1196004629 X:110822471-110822493 GGTTGGAAAAGCACAGTATTCGG 0: 9
1: 248
2: 1032
3: 1952
4: 2657
1196004621_1196004627 11 Left 1196004621 X:110822420-110822442 CCTCCGAGCCAGTTGCGGGATAT 0: 5
1: 520
2: 1522
3: 1829
4: 1191
Right 1196004627 X:110822454-110822476 GCGCCGTTTTTTAAGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196004621 Original CRISPR ATATCCCGCAACTGGCTCGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr