ID: 1196004623

View in Genome Browser
Species Human (GRCh38)
Location X:110822428-110822450
Sequence AGGAGATTATATCCCGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5689
Summary {0: 10, 1: 432, 2: 1665, 3: 1879, 4: 1703}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196004623_1196004626 -1 Left 1196004623 X:110822428-110822450 CCAGTTGCGGGATATAATCTCCT 0: 10
1: 432
2: 1665
3: 1879
4: 1703
Right 1196004626 X:110822450-110822472 TGGTGCGCCGTTTTTTAAGCTGG 0: 346
1: 479
2: 127
3: 26
4: 31
1196004623_1196004629 20 Left 1196004623 X:110822428-110822450 CCAGTTGCGGGATATAATCTCCT 0: 10
1: 432
2: 1665
3: 1879
4: 1703
Right 1196004629 X:110822471-110822493 GGTTGGAAAAGCACAGTATTCGG 0: 9
1: 248
2: 1032
3: 1952
4: 2657
1196004623_1196004631 24 Left 1196004623 X:110822428-110822450 CCAGTTGCGGGATATAATCTCCT 0: 10
1: 432
2: 1665
3: 1879
4: 1703
Right 1196004631 X:110822475-110822497 GGAAAAGCACAGTATTCGGGTGG 0: 74
1: 1237
2: 1748
3: 2165
4: 950
1196004623_1196004627 3 Left 1196004623 X:110822428-110822450 CCAGTTGCGGGATATAATCTCCT 0: 10
1: 432
2: 1665
3: 1879
4: 1703
Right 1196004627 X:110822454-110822476 GCGCCGTTTTTTAAGCTGGTTGG No data
1196004623_1196004630 21 Left 1196004623 X:110822428-110822450 CCAGTTGCGGGATATAATCTCCT 0: 10
1: 432
2: 1665
3: 1879
4: 1703
Right 1196004630 X:110822472-110822494 GTTGGAAAAGCACAGTATTCGGG 0: 14
1: 380
2: 1444
3: 1934
4: 2381
1196004623_1196004632 25 Left 1196004623 X:110822428-110822450 CCAGTTGCGGGATATAATCTCCT 0: 10
1: 432
2: 1665
3: 1879
4: 1703
Right 1196004632 X:110822476-110822498 GAAAAGCACAGTATTCGGGTGGG 0: 93
1: 1397
2: 2387
3: 1676
4: 1047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196004623 Original CRISPR AGGAGATTATATCCCGCAAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr